The document discusses major geological drivers of evolution on Earth over time, including tectonic movement, volcanism, climate change, and meteorite impacts. These geological forces have caused large-scale migrations, speciation events, mass extinctions, and adaptive radiations in species. Specific examples of major extinction events are described, such as the Permian-Triassic, Cretaceous-Paleogene, and more recent extinctions following human arrival and activities on various continents and islands.

2. Mini-summary
• Neo-darwinism/Modern synthesis
• Major transitions in evolution
• Geological timescales
• Geological drivers of evolution

4. Vulcanism
• Local climate change (e.g. thermal vents, hot springs...)
•Global climate change: Emission of gasses & particles.
•New geological barriers (migration...)
•New islands (“Malay archipelago”,
Galapagos... Hawaii... )
Deccan traps
Eyjafjall
ajokull

5. 3. Major geological drivers of evolution
Conditions on earth change.
•Tectonic movement (of continental plates)
•Vulcanism
•Climate change
•Meteorites

6. 3. Major geological drivers of evolution
Meteorite impact
?
Vulcanism
? Climate change
Tectonic movement
Consequences: • Large scale migrations
• Speciation
• Mass extinctions
• Adaptive radiations

7. 1.Major transitions in evolution
2.Geological timescales
3.Major geological drivers of evolution
4.Recent major extinction events

8. 4. Recent major extinction events
Pg
fraction of genera present in
each time interval but extinct in
the following interval
KT: K-Pg Cretaceous–Paleogene
Permian-Triassic
Triassic-Jurassic
Ordovician–Silurian
Late Devonian
To d a y

10. Carboniferous/Permian
Pangaea - single
supercontinent
•Oxygen levels.
• Tetrapods and early amniotes.
• Tropical conditions around equatorial landmasses.
• Damp forests: tall trees & lush undergrowth: giant club mosses,
lycopods, ferns & seed ferns.
• Decaying undergrowth forms coal.
• Good habitats for terrestrial invertebrates including spiders,
millipedes and insects (e.g. giant dragonflies, scorpions).

11. Early Permian mammal-like reptiles
Dimetrodon
(sub-class Synapsida = “mammal-like reptiles”)

12. Climate change
(since Cambrian)

13. Permian-Triassic Extinction
Went extinct:
•Up to 96% of marine species & 70% of terrestrial vertebrates
•21 terrestrial tetrapod families (63%)
• 7 orders of insects
Sun et al Science 2012

15. Jurassic/Cretaceous
•Mammal-like reptiles were replaced
as dominant land vertebrates by
reptiles (dinosaurs).
• Lizards, modern amphibians and
early birds appear.
• The conifer- and fern-dominated
vegetation of the Late Triassic
continued into the Jurassic.

16. Cretaceous–Paleogene (KT) extinction
66 million years ago
75% of all species became extinct (50% of genera).
Including:
Ammonite
Mosasaur
(marine reptile) Non-bird
dinosaurs
Most Plant-eating insects
Subsequently, many adaptive radiations to fill newly vacant niches.
eg. mammals, fish, many insects

17. Cretaceous–Paleogene (KT) extinction
http://www.scotese.com/earth.htm)
66 million years ago

18. Evidence for Chixulub impact
Magnetic field near site
Crater: 180km diameter; bolide: 10km.

19. Cretaceous–Paleogene (KT) extinction
66 million years ago
•Bolide impact at Chixulub.
•huge tsunamis
• cloud of dust and water vapour, blocking sun.
•plants & phytoplankton die (bottom of food chain)
--> animals starve
•dramatic climate & temperature changes are
difficult (easier for warm-blooded?)
•Additional causes?
• Some groups were ALREADY in decline
•Additional impacts?
•Deccan traps (India) - 30,000 years
of volcanic activity (lava/gas release)

21. Ongoing Anthropocene extinction
•Hunting
•Habitat destruction, modification & fragmentation
Diprotodon,
Australia, extinct 40,000 ya
Dodo,
Mauritius, extinct since 1662
!
!
Passenger
Pigeon
North America;
extinct since
1914.
Glyptodon,
Americas, extinct ~12000 years
ago

22. Extinct New 1.Zealand E5
megafauna were not in decline
before human colonization
Morten Erik Allentofta,b,c,1, 1.Rasmus Gilberta, E4
Hellerd,e, Charlotte L. Oskamb, Eline D. Lorenzena,f, Marie L. Halec,
M. Thomas P. Christopher Jacombg, Richard N. Holdawayc,h, and Michael Bunceb,i,1
aCentre for GeoGenetics, Natural History Museum, University of Copenhagen,1350 Copenhagen K, Denmark; bAncient DNA Laboratory, School of Veterinary
and Life Sciences, Murdoch University, Perth, WA 6150, Australia; cSchool of Biological Sciences, University of Canterbury, Christchurch 8140, New Zealand;
dDepartment of Biology, University of Copenhagen, DK-2100 Copenhagen Ø, Denmark; eInstituto Gulbenkian de Ciência, 6 P-2780-156 Oeiras, Portugal;
fDepartment of Integrative Biology, University of California, Berkeley, CA 94720; gSouthern Pacific Archaeological Research, Department of Anthropology
and Archaeology, University of Otago, Dunedin 9054, New Zealand; hPalaecol Research Ltd., Hornby, Christchurch 8042, New Zealand; and iTrace and
Environmental DNA Laboratory, Department of Environment and Agriculture, Curtin University, Perth, WA 6102, Australia
Edited by Robert E. Ricklefs, University of Missouri, St. Louis, MO, and approved February 10, 2014 (received for review August 7, 2013)
The extinction of New Zealand’s moa (Aves: Dinornithiformes) fol-lowed
the arrival of humans in the late 13th century and was the
0.8
final event of the prehistoric Late Quaternary megafauna extinc-tions.
Determining the state of the moa populations in the pre-extinction
period is fundamental to understanding the causes of
the event. We sampled 281 moa individuals and combined radio-carbon
dating with ancient DNA 0.6
analyses to help resolve the ex-tinction
debate and gain insights into moa biology. The samples,
which were predominantly from the last 4,000 years preceding the
extinction, represent four sympatric moa species excavated from
five adjacent fossil deposits. We characterized the moa assem-blage
0.4
using mitochondrial DNA and nuclear microsatellite markers
developed specifically for moa. Although genetic diversity differed
significantly among the four species, we found that the millennia
preceding the extinction were characterized by a remarkable de-gree
0.2
of genetic stability in all species, with no loss of heterozygos-ity
and no shifts in allele frequencies over time. The extinction event
itself was too rapid to bemanifested in the moa gene pools. Contra-dicting
previous claims of a decline in moa before Polynesian settle-ment
in New Zealand, our findings indicate that the populations
were large and stable before suddenly disappearing. This interpre-tation
is supported by approximate Bayesian computation analyses.
Our analyses consolidate the disappearance of moa as the most
rapid, human-facilitated megafauna extinction documented
to date.
birds ranging in size from the ∼12-kg North Island morph of
Euryapteryx curtus to the ∼250-kg females of the two Dinornis
species (8). Moa inhabited a variety of habitats across the New
Zealand archipelago until their extinction shortly after the ar-rival
of Polynesian settlers, estimated at approximately the late
13th century (8–10, 12). The abundance of well-preserved ar-chaeological
sites containing evidence of large-scale exploitation
of moa (e.g., ref. 13) brings the controversy of the role of humans
in the extinction event into sharp focus.
Early claims of environmental changes or poor adaptive abil-ities
of moa as causes for the extinction (reviewed in ref. 8) have
now been largely replaced by the view that direct or indirect
human impacts—including hunting, fires, and the introduction of
exotic species—were the primary drivers (14–18). Ecological
modeling suggests that such human-mediated extinction could
have happened within 100 y of Polynesian colonization (10). In
contrast, it has been argued, based on limited mitochondrial
DNA (mtDNA) data, that moa populations had already col-lapsed
before human arrival, as a consequence of volcanic
eruptions or diseases, suggesting that humans were just one of
several additive factors responsible for the extinction (19).
To address this issue, we investigated the demographic tra-jectories
of four sympatric moa species in the four millennia
leading up to their extinction. We genotyped 281 individuals of
Dinornis robustus (Dinornithidae), Euryapteryx curtus, Pachyornis
0.0
D. robustus
P. elephantopus
E. curtus
E. crassus
20 10 0
Time (kyr)
Time (yr BP)
Polynesian
colonization
40 30
3000 2000 1000 0
1.E3
B
Expected heterozygosity H Log Ne*τ E
Fig. 3. Demographic history and genetic diversity. (A) Bayesian skyline plot

23. Ongoing Anthropocene extinction
•Hunting
•Habitat destruction,
modification & fragmentation
•Pollution/Overexploitation
•Spread of invasive species - &
new pathogens
•Climate change
!

24. Rainforest loss in Sumatra
Margono et al 2012

26. Summary.
•The history of the earth is divided into geological time periods
• These are defined by characteristic flora and fauna
• Large-scale changes in biodiversity (mass extinctions) were triggered
by continental movement and catastrophic events

28. A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils

29. Why is X? Why does ?
Two types of answer:
Proximate explanations: mechanisms responsible for the trait.
(generally within the lifetime of an organism)
Ultimate explanations: fitness consequences of the trait.
(generally over many generations)

30. Some examples
•Why do waxwings migrate South in winter?
•Proximate: a mechanism in their brains senses days are getting
shorter/colder
•Ultimate: Those migrating South have been better at surviving
the winter.
•Why do human babies cry?
•Proximate explanations: cold? hunger? wants attention? high
level of a stress hormone? neural signal for pain?
•Ultimate: babies that don’t cry when they need help are less
likely to survive.

32. Fossils & Fossilization
1. How fossilization works. Some examples of fossils.
2. Dating fossils.
3. What we can learn from fossils?
y . wurm {@} qmul . ac .uk

33. Geological context
Three broad classes of rock:
•Sedimentary rocks: formed by particles (mineral
or organic) gradually settling out of solution, then
compacting to form rock
•Igneous rocks: formed by the cooling of magma
•Metamorphic rocks: modification of existing rocks
under high pressure and heat

34. Fossils: only in sedimentary rocks (deposited on oceanic
shorelines, lake beds, flood plains...)
!
Weathering or erosion can expose the older layers

35. Fossilization
•Two main types:
•Permineralization
• “Natural cast” process
• Fossilization is rare & only in sediment...
•Ancient material also occurs:
• in amber
•by mummification
• in ice

36. Fossil formation at
Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
Caves eventually form below the
surface.
‘Pot holes’ form between the
surface and the caves.
Debris, including animals, fall in!
Compaction and cementing with
water and limestone produces
“Breccia”.

37. Fossil preservation
•Hard part like shells, bones and teeth are usually all that remain
• Soft tissues fossils are rare

38. Why are fossils rare?
• Fossils don’t form often:
•Predators, scavengers, insects consume corpses
•Bacteria and fungi decompose remains
•Even faster in tropics (acid soil, warm, humid...)
!
•Best locations for fossil formation::
• arid deserts, deep water (with low O2)

39. Recmeonvt ecmonetnintse..n. tal
LAURASIA
GONDWANA
Triassic 200
TETHYS
Equator Mya
SEA
Pangaea - single
supercontinent

41. Why are fossils rare?
• Fossils don’t form often:
•Predators, scavengers, insects consume corpses
•Bacteria and fungi decompose remains
•Even faster in tropics (acid soil, warm, humid...)
!
•Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold
!
• Fossils can be lost:
•mountains: lots of erosion
•Metamorphosis and subduction of rocks destroys fossils
!
•Most are still buried rather than exposed at the surface

42. A few examples...

43. Plesiosaur fossil
Aquatic reptile; not a dinosaur. But same time (Mesozoic Era).
A typical fossil skeleton.

44. More typical…
Parts of head, and anvil/brush
of Akmonistion zangerli, shark
from Carboniferous of
Scotland

45. Belemnites
• very abundant during Mezosoic

46. Ammonites
http://www.bbc.co.uk/
nature/life/
Ammonite#p00bkt26

47. Ammonites
Ammonite
Nautilus

48. Archaeopteryx - late Jurassic (150Mya)
Feathers, like soft tissue, are rarely preserved.
But here imprinted in the rock.

49. “Fuzzy Raptor” (a dromaeosaur)

50. The earliest Eutherian Mammal?
Lower Cretaceous of China, 125 Mya
Eomaia scansoria
Ji et al., (2002) Nature
416, 816-822
A climbing mammal from
a lake shore environment

51. Leptictidium tobieni
Paleogene (Messel Shales, Germany)
Soft tissues + gut contents are
preserved
Bipedal (extinct) mammal.

52. Dinosaur footprint
•At the time, this footprint of a dinosaur pressed into soft mud and
became preserved in the now hardened rock. Can inform us on
locomotion.

53. INSECT IN AMBER
• This mosquito was imbedded in tree sap that subsequently
hardened into amber, preserving the insect within.

54. Neanderthal skull from
Iraq
(≈50,000 years old)
!
Very rarely, DNA can
be extracted and
sequenced from such
sub-fossils

55. Some animals get trapped in ice

56. Fossils & Fossilization
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?

57. Dating methods
• Absolute - the item itself is dated
!
• Relative - strata above (younger) and below (older)
are dated and the item expressed relative to these
Best method depends on context & age.

58. Principles of
radiometric dating

59. Dating methods

60. Stratigraphy
As sediment collects, deeper layers are compacted by the ones
above until they harden and become rock.
Deeper Fossils are older than those above.
Thus positions within the rock layers gives fossils a chronological age.

61. Index (Zone) Fossils
•Index fossils: diagnostic fossil species that help dating new finds
!
!
•Here, Locality 3 has no layer B (wasn’t formed or eroded).

62. Photo taken by (Luca Galuzzi) * http://www.galuzzi.it

64. Fossils & Fossilization
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?

65. What can we learn?
Fossils can sometimes directly or indirectly tell us a great
deal about the behavior of an organism, or its lifestyle

66. Fossilized tracks at
Laetoli (Tanzania)
Footprints preserved in
volcanic ash from: 3 hominids
(Australopithecus afarensis)
Numerous other mammals

67. Fossil Ichthyosaur giving birth
• Such special preservations can inform us about the reproductive
pattern in this species (live birth) .

68. Fossil Eggs
Information on development and social/reproductive behavior

69. Interpreting fossils
•Careful interpretation: helps make sense of fossilized remains
•Analysis of hard parts can tell something about soft anatomy (e.g
where muscles are (.e.g muscle scars).
•Geology: --> environment (freshwater/marine/swamp))
• Infer from living organisms & relatives.

70. Hallucigenia sparsa (Cambrian Period)
From the Burgess Shale (Canada). Example of a soft bodied
animal fossil, also very old!

71. © BBC - Life in the Undergrowth
Now re-interpreted as an
Onychophoran ("velvet worm")

73. Colors don’t fossilize...
…or do they? (discovered fossilised melanosomes)

75. Fossils - Summary
• Fossils form in sedimentary rock
• Fossilization is a rare process
• Usually, only the hard parts like bone, teeth, exoskeletons and shells
are preserved
• Fossils of different ages occur in different strata, and “index fossils” can
be used to cross-reference between different geographic locations
•Careful interpretation is required.

77. DNA & learning from DNA.

78. DNA in evolution
• Species relationships previously based on:
•bone structures
•morphologies
•development
•behavior
• ecological niche
• ....
1. DNA sequences change
DNA holds lots of additional information:
2. Evolutionary relationships
3.Current evolutionary contexts

79. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination
•mutagens (radiation, chemicals)
• viruses
• transposons
Inherited: only if in germ line.
Not inherited from soma.

80. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
new : TGCAGATAGAGAGAGAGAGCAGAT
Polymerase slippage
in satellite
•Big: inversions, duplications, deletions
Mutations are the source of genetic, inheritable variation

81. What happens to a mutation?
•Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)
• Some are very deleterious;
Some increase fitness.
• --> selection eliminates or fixes them
Eg. antennapedia (hox gene) mutation:
See population genetics lectures & practical

82. 2. DNA clarifies evolutionary
relationships between species
Human: GATTACA
Peacock: GATTGCA
Amoeba: GGCTCCA
Human
Peacock
Amoeba

83. Linnaeus 1735 classification of animals

84. Molecular clock
•Basic hypothesis: more differences - more time has passed
• Allows relative timing
• Allows “absolute timing”
• But:
• rate of differentiation differs:
• between lineages
•between contexts
• small amounts of data: unreliable
•Differential segregation of alleles (see future lectures)
Time
Genetic change

85. Carl Woese in 1977

86. An issue with sequence
phylogenies
•Can be ambiguous if not enough information.

87. Ambiguities in mutations
ancestral
sequence species 1. species 2. What happened

88. An issue with sequence
phylogenies
•Can be ambiguous if not enough information.
•Used to be expensive.
•Mitochondrial gene vs. nuclear gene. Several genes?
•Whole genome sequencing is now dirt cheap! No longer a problem!
(for establishing relationships in past 200-400 million years...)

89. This changes
454
everything.
Illumina
Solid...
Any lab can
sequence
anything!

90. With enough data...

91. Cows are more
closely related to
whales than to
horses
Cetacea
Artiodactyla
Cetartiodactyla

92. Bat echolocation
Echolocation
Evolved twice!
Teeling 2002
Flight

93. Ancient DNA

94. Ancient DNA
Hair sequencing

96. Ancient DNA: below 2km of icecriterion many putative abundance as is typical efficiently low-level due to DNA Approximately the John to and the order genus Saxifraga with more than Arctic environment plant diversity to that which consists purple and by confirming Glacier study showing record In contrast sample, that could very REPORTS
Fig. 1. Sample location and core schematics. (A) Map showing the locations of the Dye 3 (65°11'N,
45°50'W) and GRIP (72°34'N, 37°37'W) drilling sites and the Kap København Formation (82°22'N,
W21°14'W) in Greenland as well as the John Evans Glacier (JEG) (79°49'N, 74°30'W) on Ellesmere

97. Their presence indicates a northern boreal for-est
ecosystem rather than today’s Arctic environ-ment.
Ancient Biomolecules from
Deep Ice Cores Reveal a Forested
Southern Greenland
Eske Willerslev,1* Enrico Cappellini,2 Wouter Boomsma,3 Rasmus Nielsen,4
Martin B. Hebsgaard,1 Tina B. Brand,1 Michael Hofreiter,5 Michael Bunce,6,7
Hendrik N. Poinar,7 Dorthe Dahl-Jensen,8 Sigfus Johnsen,8 Jørgen Peder Steffensen,8
Ole Bennike,9 Jean-Luc Schwenninger,10 Roger Nathan,10 Simon Armitage,11
Cees-Jan de Hoog,12 Vasily Alfimov,13 Marcus Christl,13 Juerg Beer,14 Raimund Muscheler,15
Joel Barker,16 Martin Sharp,16 Kirsty E. H. Penkman,2 James Haile,17 Pierre Taberlet,18
M. Thomas P. Gilbert,1 Antonella Casoli,19 Elisa Campani,19 Matthew J. Collins2
The other groups identified, including
Asteraceae, Fabaceae, and Poaceae, are mainly
surface (m.b.s.)] indicating the depth of the cores and the positions of the Dye 3, GRIP, and JEG
samples analyzed for DNA, DNA/amino acid racemization/luminescence (underlined), and 10Be/36Cl
(italic). The control GRIP samples are not shown. The lengths (in meters) of the silty sections are
also shown.
Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice
samples. For each taxon (assigned to order, family, or genus level), the
genetic markers (rbcL, trnL, or COI), the number of clone sequences
supporting the identification, and the probability support (in percentage)
are shown. Sequences have been deposited in GenBank under accession
numbers EF588917 to EF588969, except for seven sequences less than 50
bp in size that are shown below. Their taxon identifications are indicated
by symbols.
Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%)
JEG sample
Rosales rbcL 3 90–99
Malpighiales rbcL
trnL
2
5
99–100
99–100
Salicaceae rbcL
trnL
2
4
99–100
100
Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91
Dye 3 sample
Coniferales rbcL
trnL
44
27
97–100
100
Pinaceae* rbcL
Spruce
Pine
It is difficult to obtain fossil data from the 10% of Earth’s terrestrial surface that is covered by thick
glaciers and ice sheets, and hence, trnL
knowledge of the paleoenvironments of these regions has
remained limited. We show that DNA and amino acids from buried organisms can be recovered
from the basal sections of deep ice cores, enabling reconstructions of past flora and fauna. We
show that high-altitude southern Greenland, currently lying below more than 2 kilometers of ice,
was inhabited by a diverse array of conifer trees and insects within the past million years. The
results provide direct evidence in support of a forested southern Greenland and suggest that many
deep ice cores may contain genetic records of paleoenvironments in their basal sections.
The environmental histories of high-latitude
20
25
100
100
Picea
Pinus†
rbcL
trnL
20
17
99–100
90–99
Taxaceae‡ rbcL
trnL
23
2
91–98
100
Poales§ rbcL
trnL
67
17
99–100
97–100
Poaceae§ rbcL
Grasses
trnL
67
13
99–100
100
Asterales rbcL
trnL
18
27
90–100
100
Asteraceae rbcL
trnL
2
27
91
100
Fabales rbcL
trnL
10
3
99–100
99
Fabaceae rbcL
Legumes
trnL
10
3
99–100
99
Fagales rbcL
trnL
10
12
95–99
100
Betulaceae rbcL
regions such as Greenland and Antarctica
are poorly understood because trnL
much of
8
11
The samples studied come from the basal
93–97
98–100
Alnus rbcL
impurity-rich (silty) ice sections of the 2-km-long
trnL
7
9
91–95
98–100
Dye 3 core from south-central Greenland
Lepidoptera COI 12 the 97–fossil 99
evidence is hidden below kilometer-thick
*Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. ice sheets (1–Env_3). 3, We trnL test ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. the idea that the
Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA-TAGGAAGGG.
(4), the 3-km-long Greenland Ice Core Project
(GRIP) core from the summit of the Greenland
ice sheet (5), and the Late Holocene John Evans
Glacier on Ellesmere Island, Nunavut, northern
Canada (Fig. 1). The last-mentioned sample was
included as a control to test for potential exotic
DNA because the glacier has recently overridden
a land surface with a known vegetation cover
(6). As an additional test for long-distance
atmospheric dispersal of DNA, we included
†Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG-GAACAATAATTTTATTTTCTAGAAAAGG.
basal sections of deep ice cores can act as
archives for ancient biomolecules.
§Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT.
112 6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org
of the frozen control for potential have entered the cracks or during Polymerase chain the plasmid DNA of the outer interior, confirming had not penetrated Using PCR, we short amplicons the chloroplast DNA trnL intron from from the Dye 3 and samples. From Dye amplicons of invertebrate subunit I (COI) mitochondrial Attempts to reproducibly the GRIP silty ice Formation sediments results are consistent data demonstrating of biomolecules Evans Glacier silty because these samples younger (John Evans sample (Fig. 1A, DNA from the five and Pleistocene samples from the (volumes: 100 g the samples studied of vertebrate mtDNA.
1Centre for Ancient Genetics, University of Copenhagen,
A previous study of short sequences by means Search Tool likely (15). Denmark. 2BioArch, Departments of Biology and Archaeology,
University of York, UK. 3Bioinformatics Centre, University of
Copenhagen, Denmark. 4Centre for Comparative Genomics,
University of Copenhagen, Denmark. 5Max Planck Institute for
Evolutionary Anthropology, Germany. 6Murdoch University
Ancient DNA Research Laboratory, Murdoch University,
Willerslev 2007
Birch
Butterflies
Daisies/Sunflower

98. Consensus with fossil record?

99. What common ancestor of placental mammals radiated
after K-T (Cretaceous-Palogene) extinction?
Genomic Evidence for Large, Long-Lived Ancestors to
Placental Mammals
J. Romiguier,1 V. Ranwez,1,2 E.J.P. Douzery,1 and N. Galtier*,1
1CNRS, Universite´ Montpellier 2, UMR 5554, ISEM, Montpellier, France
2Montpellier SupAgro, UMR 1334, AGAP, Montpellier, France
*Corresponding author: E-mail: nicolas.galtier@univ-montp2.fr.
Associate editor: Naruya Saitou
Molecular evolution analysis:
Mol Biol Evol 2013
•Earliest placental mammals (ie. eutherians)
•body mass >1kg; lifespan >25years
Abstract
It is widely assumed that our mammalian ancestors, which lived in the Cretaceous era, were tiny animals that survived asteroid impacts in shelters and evolved into modern forms after dinosaurswent extinct, 65Ma. The small size ofmost mammalian fossils essentially supports this view. Paleontology, however, is not conclusive regarding the ancestry mammals, because Cretaceous and Paleocene fossils are not easily estimate the longevity and body mass of early placental mammals. ie. linked very to modern different lineages. Here, from
we use full-genome Analyzing 36 fully sequenced mammalian reconstruct two aspects of the ancestral genome dynamics, namely GC-content “mouse-evolution and like”
nonsynonymous over rate ratio. Linking these molecular evolutionary processes to life-history traits in modern species, we estimate placental mammals had a life span above 25 years and a body mass above Eomaia 1 kg. This is similar or carnivores, but markedly different from mice or shrews, challenging the dominant scansoria
to current primates, cetartiodactyls,
view about mammalian evolution. Our results imply that long-lived mammals existed in the Cretaceous era and were the most successful opening new perspectives about the conditions for survival to the Cretaceous–Tertiary crisis.
Key words: phylogeny, GC-content, dN/dS ratio, GC-biased gene conversion, placentalia, fossils.

100. 3. DNA sequence clarifies current
relationships

101. Three-spined stickleback
Gasterosteus aculeatus
Example 1.
Bill Cresko et al; David Kingsley et al

102. Independent
colonization events
less than 10,000
The freshwater populations, despite their younger age, are divergent both from the oceanic ancestral populations and each other, consistent with our supposition that they represent
independent colonizations from the ancestral oceanic population.
These results are remarkably similar to results obtained previously
from some of these same populations using a small number microsatellite and mtDNA markers [55]. This combination large amounts of genetic variation and overall low-to-moderate
differentiation between populations, phenotypic evolution years in the ago
coupled with recent and freshwater populations, presents ideal situation for identifying genomic regions that have responded
to various kinds of natural selection.
Patterns of genetic diversity distributed across the
genome
To assess genome-wide patterns we examined mean nucleotide
diversity in Saltwater:
(p) and heterozygosity (H) using a Gaussian smoothing function across each linkage group (Figure 4 and S1). Although the overall mean diversity and heterozygosity are 0.00336 and 0.00187, respectively, values vary widely the genome. Nucleotide diversity within genomic regions from 0.0003 to over 0.01, whereas heterozygosity values from 0.0001 to 0.0083. This variation in diversity across genome provides important clues to the evolutionary processes
that in are Freshwater:
maintaining genetic diversity. For example, expected (p) and observed (H) heterozygosity largely correspond,
they differ at a few genomic regions (e.g., on Linkage Group Genomic regions that exhibit significantly (p,1025) low levels diversity and heterozygosity (e.g. on LG II and V, Figure and Figure S1) may be the result of low mutation low recombination rate, purifying or positive selection consistent across populations, or some combination of [9,36,105–107].
F
F
F
S
S
F = Freshwater
S = Saltwater
Bill Cresko et al;
Different amounts of
armor plating

103. RAD = Restriction-site Associated DNA sequencing
each locus sequenced
5–10 times per fish.
F
F
F = Freshwater
Bill Cresko et al;
The freshwater populations, despite their younger age, are more
divergent both from the oceanic ancestral populations and from
each other, consistent with our supposition that they represent
independent colonizations from the ancestral oceanic population.
These results are remarkably similar to results obtained previously
from some of these same populations using a small number of
microsatellite and mtDNA markers [55]. This combination of
large amounts of genetic variation and overall low-to-moderate
differentiation between populations, coupled with recent and rapid
phenotypic evolution in the freshwater populations, presents an
ideal situation for identifying genomic regions that have responded
to various kinds of natural selection.
Patterns of genetic diversity distributed across the
genome
To assess genome-wide patterns we examined mean nucleotide
diversity (p) and heterozygosity (H) using a Gaussian kernel
smoothing function across each linkage group (Figure 4 and Figure
S1). Although the overall mean diversity and heterozygosity values
are 0.00336 and 0.00187, respectively, values vary widely across
the genome. Nucleotide diversity within genomic regions ranges
from 0.0003 to over 0.01, whereas heterozygosity values range
from 0.0001 to 0.0083. This variation in diversity across the
genome provides important clues to the evolutionary processes
that are maintaining genetic diversity. For example, while
expected (p) and observed (H) heterozygosity largely correspond,
they differ at a few genomic regions (e.g., on Linkage Group XI).
Genomic regions that exhibit significantly (p,1025) low levels of
diversity and heterozygosity (e.g. on LG II and V, Figure 4
and Figure S1) may be the result of low mutation rate,
low recombination rate, purifying or positive selection that is
consistent across populations, or some combination of factors
[9,36,105–107].
In contrast, other genomic regions, such as those on LG III and
XIII (Figure 4), show very high levels of both diversity and
heterozygosity. The most striking such region, found near the end
Figure 1. Location of oceanic and freshwater populations
examined. Threespine stickleback were sampled from three freshwa-ter
(Bear Paw Lake [BP], Boot Lake [BL], Mud Lake [ML]) and two oceanic
Population Genomics in Stickleback
F
S
S
S = Saltwater
20 fish per population
45,789 loci genotyped

104. Differentiation between populations (FST)
Population Genomics Freshwater
Saltwater vs.
Saltwater
vs.
Freshwater
Figure 6. Genome-wide differentiation among populations. FST across the genome, with colored bars indicating significantly (p#1025, blue; p#1027, red) and reduced (p#1025, green) values. Vertical gray shading indicates boundaries of the linkage groups and scaffolds, and gold shading indicates the nine peaks of substantial population differentiation discussed in the text. (A) FST between the populations (RS and RB; note that no regions of FST are significantly elevated or reduced). (B,C,D) Differentiation of each single freshwater from the two oceanic populations, shown as the mean of the two pairwise comparisons (with RS and RB): (B) BP, (C) BL, (D) ML. Colored plot represent regions where both pairwise comparisons exceeded the corresponding significance threshold. (E) Overall population differentiation
between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML).
doi:10.1371/journal.pgen.1000862.g006
PLoS Genetics | www.plosgenetics.org 8 February 2010 | Volume 6 | Issue 2 Freshwater
vs. Saltwater
FST bewteen 2 populations: 0 = populations have same alleles in similar frequencies
1 = populations have completely different alleles
Bill Cresko et al; David Kingsley et al

105. Nine identified regions
• Identified regions include:
• 31 that likely to affect morphology or osmoregulation
• some previously identified via crosses; most new
• E.g. EDA gene.
• “rare” recessive allele (found in 1-5% of ocean individuals)
• the “rare” allele went to fixation in all freshwater
populations (ie. all individuals homozygous for the
rare allele)

106. Example 2: Little fire ant Wasmannia
DNA identifies family relationships
Normally,
* males (haploid) carry only maternal DNA
* workers and new queens (all diploid) carry
DNA from their father and their mother
Fournier et al 2005

107. NATURE|Vol 435|30 June 2005 LETTERS
Table 1 | Genotypes of queens (Q), their mates (M) and workers (w) in one nest (E-3) at each of the 11 microsatellite loci
Individual Waur-225 Waur-275 Waur-418 Waur-566 Waur-680 Waur-716 Waur-730 Waur-1166 Waur-2164 Waur-3176 Waur-1gam
Queens
Q-1 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-2 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-3 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-4 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-5 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-6 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-7 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-8 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Males
M-1 269 107 118 265 187 192 214 95 320 244 282
M-2 269 107 118 265 187 192 214 95 320 244 282
M-3 269 107 118 265 187 192 214 95 320 244 282
M-4 269 107 118 265 187 192 214 95 320 244 282
M-5 269 107 118 265 187 192 214 95 320 244 282
M-6 269 107 118 265 187 192 214 95 320 244 282
M-7 269 107 118 265 187 192 214 95 320 244 282
M-8 269 107 118 265 187 192 214 95 320 244 282
Workers
w-1 223 269 115 107 112 118 263 265 171 187 198 192 160 214 95 95 306 320 230 244 298 282
w-2 225 269 115 107 100 118 263 265 171 187 184 192 158 214 95 95 298 320 230 244 288 282
w-3 223 269 105 107 112 118 263 265 171 187 198 192 160 214 97 95 298 320 230 244 298 282
w-4 225 269 115 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 288 282
w-5 223 269 105 107 100 118 263 265 171 187 198 192 158 214 97 95 306 320 230 244 298 282
w-6 225 269 115 107 112 118 263 265 171 187 184 192 160 214 97 95 306 320 230 244 288 282
w-7 223 269 105 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 298 282
w-8 225 269 115 107 112 118 263 265 171 187 184 192 158 214 97 95 298 320 230 244 288 282
The identities of mates were determined by the sperm collected in the queen’s spermathecae. Queens and males’ genotypes illustrate their clonal production, whereas workers’ genotypes are
consistent with normal sexual reproduction. Paternal alleles are in italics.
reproduction (that is, by ameiotic parthenogenesis). In 33 of the 34
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the same
nest shared an identical genotype at each of the 11 loci (Table 1 and
Fig. 1). The single exception was nest B-12, in which queens differed
at 1 of the 11 loci: four queens were heterozygous at Waur-2164
and the remaining three queens were homozygous for one of the

108. Downloaded from rspb.royalsocietypublishing.org on January Here:
reproduction (that is, by ameiotic parthenogenesis). In 33 of the nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the same
nest shared an identical genotype at each of the 11 loci (Table 1 Fig. 1). The single exception was nest B-12, in which queens differed
at 1 of the 11 loci: four queens were heterozygous at Waur-2164
and the remaining three queens were homozygous for one of two alleles. This variation probably reflects a mutation or recombi-nation
* workers carry DNA
from mother & father
* new queens are 100%
clones of their mother
* new males are 100%
clones of their father
event in one queen followed by clonal reproduction within
the nest. The history of this genetic change could be reconstructed
from the genotypes of queens collected in neighbouring nests (Figs and 2). Nine queens from two neighbouring nests (B-11 and B-had the same genotype as the four heterozygous queens for locus
Waur-2164, indicating that the mutation or recombination event
probably was from a heterozygote to a homozygote queen. The three
homozygote queens from nest B-12 had a unique genotype in population, which further supports this interpretation.
A comparison between nests supports the view of restricted female
gene flow, with budding being the main mode of colony formation.
Within three of the five sites of collection (A, C and D) all queens the same genotype at the 11 loci (Fig. 2). In one of the two other 2680 M. Pearcy et al. Sib mating without inbreeding
(B), all queens from 8 of the 17 nests also had an identical genotype,
whereas in the other site (E) the queen genotypes were different in three nests sampled. Taken together, these data indicate that queens
belonging to the same lineage of clonally produced individuals
frequently head closely queen located nests. mate
Moreover, genetic differen-tiation
between sites was very strong, with a single occurrence genotypes shared between sites (the eight queens of nest E-3 genotypes identical to the most common genotype found at site showing that gene flow by females is extremely restricted.
In stark contrast to reproductive females, the genotypic analyses
revealed that workers are produced by normal sexual reproduction
(Table 1). Over all 31 queenright nests, each of the 248 genotyped
workers had, at seven or more loci, one allele that was absent queens of their nest. Moreover, the 232 workers from the 29 nests which the sperm in the queen’s spermathecae was successfully
obtained had all genotypes consistent with those expected under
Figure 2 | Neighbour-joining dendrogram of the genetic (allele-shared)
distances between queens (Q), gynes (G) and male sperms (M) collected
over all the five sites (A–E). The collection number of each nest is given
two other ant species: emeryi [21,22]. study, it is likely also translates sib mating on the W. auropunctata studies have shown derive from a characterized by single male genotype. and a single male is also compatible a single mated gynes workers males
Interestingly, lay male eggs that least two potential being clonally genome could [21]. Indeed, Figure 2. Clonal reproduction in queens and males. The
figure summarizes the reproduction system of P. longicornis
in the study population. Maternal (light) and paternal
(dark) chromosomes are displayed. Contribution to the
genome of the offspring is indicated by arrows (dashed

109. Example 3: Species-interactions via
DNA sequencing
Correspondences Screening mammal
biodiversity using
DNA from leeches
Ida Bærholm Schnell1,2,†,
Philip Francis Thomsen2,†,
Nicholas Wilkinson3,
Morten Rasmussen2,
Lars R.D. Jensen1, Eske Willerslev2,
Mads F. Bertelsen1,
and M. Thomas P. Gilbert2,*
With nearly one quarter of mammalian
species threatened, an accurate
description of their distribution and
conservation status is needed [1].
For rare, shy or cryptic species,
in the medical leech (Hirudo medicinalis)
viruses remain detectable in the blood
meal for up to 27 weeks, indicating viral
nucleic acid survival [4,5]. To examine
whether PCR amplifiable mammalian
DNA persists in ingested blood, we
fed 26 medical leeches (Hirudo spp.)
freshly drawn goat (Capra hircus)
blood (Supplemental information) then
sequentially killed them over 141 days.
Following extraction of total DNA, a
goat-specific quantitative PCR assay
demonstrated mitochondrial DNA
(mtDNA) survival in all leeches, thus
persistence of goat DNA, for at least
4 months (Figure 1A; Supplemental
information).
We subsequently applied the
method to monitor terrestrial
mammal biodiversity in a challenging
environment. Haemadipsa spp. leeches
were collected in a densely forested
biotope in the Central Annamite region
how
new
into
John
expression in
differentiation.
sex
586.
genes
central
fish.
determination
Magazine
R263
Figure 1. Monitoring mammals with leeches.
(A) Survival of mtDNA in goat blood ingested by Hirudo medicinalis over time, relative to freshly
drawn sample (100%, ca. 2.4E+09 mtDNA copies/gram blood). Mitochondrial DNA remained
detectable in all fed leeches, with a minimum observed level at 1.6E+04 mtDNA/gram blood
ingested. The line shows a simple exponential decay model, p < 0.001, R2 = 0.43 (Supplemental
information). (B) Vietnamese field site location and examples of mammals identified in Hae-madipsa
spp. leeches. From left to right: Annamite striped rabbit, small-toothed ferret-badger,

110. Conservation