The document discusses how to interpret a person's genome sequence. It explains that while we can identify genetic variations and inherited conditions, a genome sequence alone does not reveal much because DNA is complex code that is difficult to decipher. Environmental factors and how genes interact also influence traits. The document outlines the process of genome sequencing, mapping reads to a reference, variant calling, and challenges in interpretation due to incomplete knowledge and versioning issues.
BauhinaGenome.hk slides used for a school visit to talk DNA, genomics and Bauhinia to year 6 (11-12 year old) science class at the CIS school in Hong Kong.
Bio380 Human Evolution: Waking the deadMark Pallen
Bio380 Human Evolution, genes and genomes lecture on contribution of archaic populations to gene pool of anatomically modern humans, including Neanderthals and Denisovan
BauhinaGenome.hk slides used for a school visit to talk DNA, genomics and Bauhinia to year 6 (11-12 year old) science class at the CIS school in Hong Kong.
Bio380 Human Evolution: Waking the deadMark Pallen
Bio380 Human Evolution, genes and genomes lecture on contribution of archaic populations to gene pool of anatomically modern humans, including Neanderthals and Denisovan
My first lecture on the second year Bio263 module on human evolution. An overview of human evolution and palaeoanthropology. Taxonomy and humanity's place in nature. Who is our closest living relative? Evidence from morphology and molecules.
See also Slidecast on YouTube
http://www.youtube.com/watch?v=28bLQIGRbWU
Pat Heslop-Harrison presentation for International Chromosome Conference Prague September 2018 Meiosis, recombination, pairing, mitochondria, evolution, genomics, oligonucleotides, in situ hybridization, breeding, genetics, cytogenetics, ICC, ICC22
This ppt clarifies the differences and similarities of DNA of human and ape. Gives a conclusion that how the minimum differences gives major differences among human and ape.
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaPat (JS) Heslop-Harrison
PUBLIC SEMINAR At Agro-Biotechnology Institute, ABI Serdang
Prof J. S. “Pat” Heslop-Harrison,
University of Leicester
Academic Icon, University of Malaya
Chromosomes, Crops and Superdomestication
Crop improvement is reliant on the exploitation of new biodiversity and new combinations of diversity. I will discuss our work on genome structure and evolution, involving processes including polyploidy, introgression, recombination and repetitive DNA changes. Identification and measurement of diversity and relationships assists in use of new gene combinations or new crops, through synthesizing new hybrid species, by chromosome engineering or by transgenic strategies. We are studying crops including wheat, Brassica and banana, using genome sequencing, repetitive sequence comparison, and cytogenetics. Plants, pathogens and farmers have been involved in a three-way fight since the start of agriculture, and the concept of superdomestication involves systematic identification of needs from crops, only then followed by finding appropriate characters and bringing them together in new varieties. Crops will continue to deliver the products needed for food, fibre, fuel and fibre in an increasingly sustainable and safe manner.
CONCEPT
HISTORY OF XENOTRANSPLANTATION
IMPORTANCE OF XENOTRANSPLANTATION
CHOOSING OF DONOR SPECIES
XENOTRANSPLANTATION REJECTION
GUIDELINES ON XENO-TRANSPLANTATION BY ICMR
RECENT RESEARCH ON XENOTRANSPLANTATION
See text at http://molcyt.org/2012/11/29/superdomestication-feed-forward-breeding-and-climate-proofing-crops/ which also links the the YouTube talk using these slides
Update version of the SMBE/SESBE Lecture on ENCODE & junk DNA (Graur, Decembe...Dan Graur
How to Assemble a Human Genome? Mix generous amounts of Junk DNA and Indifferent DNA, add a dollop of Garbage DNA and a sprinkling of Functional DNA (Lazarus DNA optional)
My first lecture on the second year Bio263 module on human evolution. An overview of human evolution and palaeoanthropology. Taxonomy and humanity's place in nature. Who is our closest living relative? Evidence from morphology and molecules.
See also Slidecast on YouTube
http://www.youtube.com/watch?v=28bLQIGRbWU
Pat Heslop-Harrison presentation for International Chromosome Conference Prague September 2018 Meiosis, recombination, pairing, mitochondria, evolution, genomics, oligonucleotides, in situ hybridization, breeding, genetics, cytogenetics, ICC, ICC22
This ppt clarifies the differences and similarities of DNA of human and ape. Gives a conclusion that how the minimum differences gives major differences among human and ape.
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaPat (JS) Heslop-Harrison
PUBLIC SEMINAR At Agro-Biotechnology Institute, ABI Serdang
Prof J. S. “Pat” Heslop-Harrison,
University of Leicester
Academic Icon, University of Malaya
Chromosomes, Crops and Superdomestication
Crop improvement is reliant on the exploitation of new biodiversity and new combinations of diversity. I will discuss our work on genome structure and evolution, involving processes including polyploidy, introgression, recombination and repetitive DNA changes. Identification and measurement of diversity and relationships assists in use of new gene combinations or new crops, through synthesizing new hybrid species, by chromosome engineering or by transgenic strategies. We are studying crops including wheat, Brassica and banana, using genome sequencing, repetitive sequence comparison, and cytogenetics. Plants, pathogens and farmers have been involved in a three-way fight since the start of agriculture, and the concept of superdomestication involves systematic identification of needs from crops, only then followed by finding appropriate characters and bringing them together in new varieties. Crops will continue to deliver the products needed for food, fibre, fuel and fibre in an increasingly sustainable and safe manner.
CONCEPT
HISTORY OF XENOTRANSPLANTATION
IMPORTANCE OF XENOTRANSPLANTATION
CHOOSING OF DONOR SPECIES
XENOTRANSPLANTATION REJECTION
GUIDELINES ON XENO-TRANSPLANTATION BY ICMR
RECENT RESEARCH ON XENOTRANSPLANTATION
See text at http://molcyt.org/2012/11/29/superdomestication-feed-forward-breeding-and-climate-proofing-crops/ which also links the the YouTube talk using these slides
Update version of the SMBE/SESBE Lecture on ENCODE & junk DNA (Graur, Decembe...Dan Graur
How to Assemble a Human Genome? Mix generous amounts of Junk DNA and Indifferent DNA, add a dollop of Garbage DNA and a sprinkling of Functional DNA (Lazarus DNA optional)
Social Inc. en IAB Nederland presenteren het
e-book ‘Social Business Now’. Dit e-book is bedoeld voor zowel leidinggevenden als voor mensen op de werkvloer - van communicatiemedewerker en marketeer tot overig personeel - die geïnspireerd willen raken door en kennis willen opdoen over de kansen van social business.
Genetics and the study of human genome is fascinating and has the potential to alter our understanding going back or forward.
Genetics will play a significant role -- atleast as impactful as internet and its effect will be lasting as the wheel. Revolutionary changes are afoot and the world as we know it is over. Much of it is driven by technology. This is a very high level intro to basics of genetics. Lots of reading, consulting genetic experts.
Nadia Pisanti - With the recent New Genome Sequencing Technologies, Medicine and Biology are witnessing a revolution where Computer Science and Data Analysis play a crucial role. In this talk, I will give an overview of perspectives and challenges in this field.
Instructions for Written Assignment 2For the second (and final.docxmaoanderton
Instructions for Written Assignment 2
For the second (and final!) writing assignment, you get to select
one
of the five articles below. Take a brief look at each of the articles to see which one appears the most interesting to
you
. As with the previous written assignment, read the selected article and write a 3-4 page paper (double-spaced, 10-12 pt font, 1000-1500 words) for submission. Each paper should consist primarily of a review of the article (tell me what the article was about), with a short discussion at the end (1/2 page or 2-3 paragraphs)
Do not cut-n-paste from the text or other sources, and please do not include quotations. For the discussion section, pick out and discuss some aspect of the article that you found to be the most interesting, surprising, and/or problematic. Please discuss why this topic was noteworthy to you. Feel free to express your personal opinions, including agreement or disagreement with the arguments (and your reasoning behind these stances).
Again, don't worry about a particular 'style' (e.g., APA, Chicago), but do use college-level grammar, paragraph and sentence formatting, etc.
This the Article
The Article 8. The 2% Difference
If you find yourself sitting close to a chimpanzee, staring face to face and making sustained eye contact, something interesting happens, something that is alternately moving, bewildering, and kind of creepy. When you gaze at this beast, you suddenly realize that the face gazing back is that of a sentient individual, who is recognizably kin. You can't help but wonder, What's the matter with those intelligent design people?
Chimpanzees are close relatives to humans, but they're not identical to us. We are not chimps. Chimps excel at climbing trees, but we beat them hands down at balance-beam routines; they are covered in hair, while we have only the occasional guy with really hairy shoulders. The core differences, however, arise from how we use our brains. Chimps have complex social lives, play power politics, betray and murder each other, make tools, and teach tool use across generations in a way that qualifies as culture. They can even learn to do logic operations with symbols, and they have a relative sense of numbers. Yet those behaviors don't remotely approach the complexity and nuance of human behaviors, and in my opinion there's not the tiniest bit of scientific evidence that chimps have aesthetics, spirituality, or a capacity for irony or poignancy.
What accounts for those differences? A few years ago, the most ambitious project in the history of biology was carried out: the sequencing of the human genome. Then just four months ago, a team of researchers reported that they had likewise sequenced the complete chimpanzee genome. Scientists have long known that chimps and humans share about 98 percent of their DNA. At last, however, one can sit down with two scrolls of computer printout, march through the two genomes, and see exactly where our 2 percent differe.
The Human Genome Project (HGP) was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint.
Lecture given for the Data Mining course at Uppsala university in October 2013. The presentation talks about data analysis in the context of genomics, next-generation sequencing, metagenomics etc.
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
Richard's aventures in two entangled wonderlandsRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
The use of Nauplii and metanauplii artemia in aquaculture (brine shrimp).pptxMAGOTI ERNEST
Although Artemia has been known to man for centuries, its use as a food for the culture of larval organisms apparently began only in the 1930s, when several investigators found that it made an excellent food for newly hatched fish larvae (Litvinenko et al., 2023). As aquaculture developed in the 1960s and ‘70s, the use of Artemia also became more widespread, due both to its convenience and to its nutritional value for larval organisms (Arenas-Pardo et al., 2024). The fact that Artemia dormant cysts can be stored for long periods in cans, and then used as an off-the-shelf food requiring only 24 h of incubation makes them the most convenient, least labor-intensive, live food available for aquaculture (Sorgeloos & Roubach, 2021). The nutritional value of Artemia, especially for marine organisms, is not constant, but varies both geographically and temporally. During the last decade, however, both the causes of Artemia nutritional variability and methods to improve poorquality Artemia have been identified (Loufi et al., 2024).
Brine shrimp (Artemia spp.) are used in marine aquaculture worldwide. Annually, more than 2,000 metric tons of dry cysts are used for cultivation of fish, crustacean, and shellfish larva. Brine shrimp are important to aquaculture because newly hatched brine shrimp nauplii (larvae) provide a food source for many fish fry (Mozanzadeh et al., 2021). Culture and harvesting of brine shrimp eggs represents another aspect of the aquaculture industry. Nauplii and metanauplii of Artemia, commonly known as brine shrimp, play a crucial role in aquaculture due to their nutritional value and suitability as live feed for many aquatic species, particularly in larval stages (Sorgeloos & Roubach, 2021).
ESR spectroscopy in liquid food and beverages.pptxPRIYANKA PATEL
With increasing population, people need to rely on packaged food stuffs. Packaging of food materials requires the preservation of food. There are various methods for the treatment of food to preserve them and irradiation treatment of food is one of them. It is the most common and the most harmless method for the food preservation as it does not alter the necessary micronutrients of food materials. Although irradiated food doesn’t cause any harm to the human health but still the quality assessment of food is required to provide consumers with necessary information about the food. ESR spectroscopy is the most sophisticated way to investigate the quality of the food and the free radicals induced during the processing of the food. ESR spin trapping technique is useful for the detection of highly unstable radicals in the food. The antioxidant capability of liquid food and beverages in mainly performed by spin trapping technique.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
BREEDING METHODS FOR DISEASE RESISTANCE.pptxRASHMI M G
Plant breeding for disease resistance is a strategy to reduce crop losses caused by disease. Plants have an innate immune system that allows them to recognize pathogens and provide resistance. However, breeding for long-lasting resistance often involves combining multiple resistance genes
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
2015 pycon-talk
1. How to interpret your
own genome.
C. Titus Brown
ctbrown@ucdavis.edu
@ctitusbrown
http://ivory.idyll.org/blog/
Second in my ongoing attempt to explain what I actually do to Terry Peppers.
2. Some basic facts about
DNA
The primary DNA sequence consists of strings of A, C, G, and T.
Most human cells contain approximately 6 billion of these.
They are divided into 23 chromosome pairs.
These chromosomes are the primary unit of heredity.
http://classes.biology.ucsd.edu/bimm110.SP07/lectures_WEB/L08.05_Cytogenetics.htm
3. How DNA is interpreted –
“It’s complicated.”
http://www.exploringnature.org/db/detail.php?dbID=106&detID=2454
4. How inheritance & generation
of variation works
http://genetics.thetech.org/ask/ask435
+ approximately 300-
600 mutations
per generation
5. If we knew a person’s genome
sequence perfectly…
We still wouldn’t know all that much!
We could correlate variation between genomes with
diseases.
We could identify parentage and genetic inheritance.
We could probably identify ethnic origin.
We could find known “mistakes” or problems.
6. But… why wouldn’t we know
that much?? Isn’t the genome
the person?
Let’s ignore environmental factors, first of all…
7. Imagine…
…you’re locked in a room, with feral lawyers roaming
around outside;
You have a bunch of source code on a stack of CDs
to understand;
And you’ve been given a Windows 98 machine with
Python installed.
(see David Beazley, “Discovering Python”, PyCon
2014)
This talk came partly from listening to his talk…
8. This “locked room” problem is a
pretty good analogy to genomics!
“Here are 3 billion characters of DNA! Go
figure out what it all means!”
It’s like the previous locked room problem, and:
The code is all written in Perl 8, for which neither a
specification or software interpreter exists.
But you have access to the Internet and a world-wide
collection of other scientists, and (some of) their data and
papers.
Oh, and: the answers hold the keys to life and death.
9. Genomes are still useful! How
do we find sequence?
Primary approach for human genomes is: spend a lot of money
sequencing one, or a few; use that as reference.
Initial cost: $2.7 bn (in 1991)
Current human genome reference is from 13 anonymous
volunteers in Buffalo, NY (Wikipedia ;)
Older technology: identify points of variation, then target for
further investigation.
Current technology: sequence. (The rest of this talk.
Next technology: longer reads. (Sequence more, better.)
10. Working with short read
sequencing - overview
Sequence Map
Call
variants
Interpret
11. Working with short read
sequencing - sequencing
Need about 250 ng of DNA at 2 ng/ul.
“Under $1,000 dollars”
http://biome.biomedcentral.com/welcome-to-the-1000-
genome/
…some up front investment required :)
Sequence Map
Call
variants
Interpret
12. Working with short read
sequencing - sequencing
Sequence Map
Call
variants
Interpret
@D00360:18:H8VC6ADXX:1:1103:1434:46766/1
AACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACA
+
@@@DDDDDFHHFHHIIIBHGIIDGIA;EDGD@CG@FDDEFFB@DCGHGGIG8CHGD
Raw data looks something like this (x 2 bn)
17. Working with short-read
sequencing – annotate variants
Is it a variant known to have an effect?
Is it in a gene?
Is it in a gene and does it have some “obvious” effect (e.g.
breaking the gene)?
Has it been associated with some effect?
Sequence Map
Call
variants
Interpret
19. An example data set
Sequences from a “trio” (son, father, mother) of Ashkenazi
Jews are available, together with medical records (see links
in blog post).
The Ashkenazim branched off from other Jews ~2500 years
ago, flourished during Roman Empire, then “went through a
'severe bottleneck' as they dispersed, reducing a population
of several million to just 400 families who left Northern Italy
around the year 1000.”
http://en.wikipedia.org/wiki/Ashkenazi_Jews#Genetics
20. “Raw” human data:
BAM file: 108 GB
(contains sequences + quality scores)
+ human genome (~3 GB or so)
+ lots of databases of varying size.
Full instructions at:
http://ivory.idyll.org/blog/2015-pycon-talk.html
21. Working with short-read
sequencing – mapping.
Software such as BWA takes in a reference genome and a
set of reads and yields tab-delimited output:
D00360:37:HA3HMADXX:1:2104:14000:62852 163 chr22
16050001 15 87S8M1I10M1D41M1S =
16050476 621 CCA…. 3((…
This contains information about where each read maps, how
well it maps, etc.
Sequence Map
Call
variants
Interpret
22. Most parts of the genome are
sampled many times (~50,
here)
HG002 data set
Sequence Map
Call
variants
Interpret
24. Working with short-read
sequencing – annotate variants
HG002 data setVariants annotated with VEP using Gemini.
Sequence Map
Call
variants
Interpret
25. Most differences are
~uninterpretable!
Total variants: 5,562,545
Between genes: 3,032,670
Between parts of genes
(exons): 2,014,962
Remaining: 514,913
(Only 2% of human genome
makes genes; maybe ~5% of
genome thought to be functional)
HG002 data set
26. OK, you’ve got your variants –
now what??
HT to Slate Star Codex,
http://slatestarcodex.com/2014/11/12/how-to-use-23andme-irresponsibly/
27. Chasing down a disease-
related variant: Canavan
disease.
http://www.snpedia.com/index.php/Rs12948217
28. chr17:3397702 (hg19) in HG002 sample (son)
The son and both parents
are heterozygous (1/2) for
this – they are carriers,
but not afflicted with
disease.
¼ of their children would
have homozygous allele
and probably be affected
by Canavan’s Disease:
“Children who inherit two
copies of the gene
appear normal at birth,
but between three and
nine months of age they
begin to show symptoms
... These children cannot
sit, crawl, or talk, and few
live past age 10.”
http://www.snpedia.com/index.php/Can
ease
29. Challenges in actually
interpreting – “version hell”.
Variant is actually a T.
Snpedia says A is the problematic variant, but that’s on
hg38.
On hg19, which is what variants were called on, relevant
gene is on reverse strand so T => A.
30. Human migrations into Europe (~40kya – fall of Roman Empire)
Veeramah and Novembre, doi:10.1101/cshperspect.a008516
31. Veeramah and Novembre, doi:10.1101/cshperspect.a008516
Human genetic comparisons overlayed on map of Europe.
32. Predicting new disease
variants:Can we find associations between variants and diseases?
“Genome Wide Association Study (GWAS)”
Wellcome Trust CCT, 2007,
doi:10.1038/nature05911
33. …cautions of GWAS:
Need to account for relatedness in samples;
Large sample sizes needed;
Complex statistics needed & “multiple testing” issues;
Different identifier/database mixtures;
Correlation is not causation;
Large effects are rare – typically many small signals
combined.
The data science problem from hell!
35. Short term
Lots more data! “Millions to billions of human
genomes” coming.
Individual data – est 300,000 human genomes
sequenced in 2014.
Tumor and somatic data.
Time course data (“narcissome”) - Mike Snyder
Newer sequencing data types – e.g. longer reads.
see: http://www.nature.com/news/the-rise-of-the-narciss-ome-1.10240
36. Short-term software
problems
Increasingly many open source Python projects
(bcbio, Gemini);
Help with integration between tools (dependency
hell, versioning hell);
Optimization of specific approaches not so
important.
Lack of concordance => technical problem.
General speed ~meh
Flexible and robust libraries still maturing.
37. Medium term
We’ll be sequencing everything all the time (but still
won’t really know what it means); => data integration
and data mining.
Large scale sequencing is rapidly being extended to
agriculture, ecology, and veterinary medicine.
We will soon be able to “edit” whatever genomes we
want (check out CRISPR), but will not have a good
idea of what to actually edit (c.f. Perl8 analogy,
above).
Read up on “gene drive” if you want the bejeezus scared out of you:
http://news.sciencemag.org/biology/2015/03/chain-reaction-spreads-gene-
through-insects
38. Longer term
No one knows.
We’ve only had large scale sequencing & the human
genome for ~15 years!!
Free associate the following:
cheap sequencing; quantified self; Internet of Things.
39. How to get involved?
A lot of the software is open source!
(bwa, samtools, etc. etc.)
…but:
Warning: genomics is large, and deep, and largely invisible, and
has its own culture.
Sadly, your best bet is probably to come do a PhD with someone like me, for
free.
(just kidding! …)
40. bcbio and Gemini
Help with:
Gemini: SQLite to PostgreSQL conversion;
Gemini: “bigwig” parsing performance;
bcbio: improving use & cleanliness of Cloud port
bcbio: moving to Common Workflow Language (note,
reference implementation in Python)
See talk blog post at http://ivory.idyll.org/2015-pycon-
talk.html for more info.
41. How can you sequence your
own genome?
Most genetic testing services (23andme, etc.) don’t
actually sequence your 6 billion bases of DNA; they
instead use a more targeted approach and look at
common variants or known disease variants.
If it costs < $1000, they’re not actually sequencing you :)
DNA extraction, etc, is fairly straightforward if you have
access to a lab and the necessary expertise.
Main suggestion: see http://www.personalgenomes.org/
42. Thanks for coming!
Please see links to data, instructions, and more reading at
http://ivory.idyll.org/blog/2015-pycon-talk.html