BIOFORTIFICATION OF STAPLE CROPS: PROVITAMIN A CASSAVA AS A CASE STUDYCosmos Onyiba
Biofortification refers to micronutrient enrichment of staple crops through plant breeding, to address the negative economic and health consequences of vitamin and mineral deficiencies in humans. It is the process of increasing the bioavailable micronutrient density of staple crops through conventional plant breeding and modern biotechnology to achieve a measurable and positive impact on human health.. Currently, agronomic, conventional, and transgenic biofortification are three common approaches. Progress has been made in breeding orange sweetpotato, provitamin A maize, provitamin A cassava, high zinc rice and high zinc wheat, and high iron beans and high iron pearl millet via conventional breeding. Transgenic biofortification is used when genetic variability for vitamin and mineral targets is too low to meet the desired target levels, or for crops that are very difficult to breed, such as banana. The biofortification of cassava with Provitamin A (beta-carotene) was achieved through pure line and hybrid seed technology as well as genetic engineering. The provitamin A carotenoid in biofortified cassava is primarily β-carotene. In white cassava, there may be trace amounts of β-carotene, which may be present in concentrations as low as 1 mg/g fresh weigh or 3 mg/g dry weigh. Due to the instability of beta-carotene, cooking and processing methods can affect the retention of β-carotene in cassava leading to decrease bioavailability and bioefficacy.
Modern agriculture has been largely successful in meeting the food needs for ever increasing population in developing countries. On the contrary, malnutrition, especially Fe and Zn continue to pose a very serious constraint not only to human health as well economic development of nation that might formerly have got unnoticed. Besides, the micronutrient deficiencies are becoming increasingly common in agriculture as a result of higher levels of removal by ever-more-productive crops combined with breeding for higher yields, at the expense of micronutrient acquisition efficiency (Havlinet al., 2014).Therefore, agriculture must now focus on a new paradigm that will not only produce more food, but deliver better quality food as well.
Bio fortification for Enhanced Nutrition in Rice by Conventional and Molecula...Sathisha TN
Micronutrient malnutrition is widespread, especially in poor populations across the globe where daily caloric intake is confined mainly to staple cereals. Rice, which is a staple food for over half of the world's population, is low in bioavailable micronutrients required for the daily diet. Improvements of the plant-based diets are therefore critical and of high economic value in order to achieve a healthy nutrition of a large segment of the human population. Rice grain biofortification has emerged as a strategic priority for alleviation of micronutrient malnutrition
BIOFORTIFICATION OF STAPLE CROPS: PROVITAMIN A CASSAVA AS A CASE STUDYCosmos Onyiba
Biofortification refers to micronutrient enrichment of staple crops through plant breeding, to address the negative economic and health consequences of vitamin and mineral deficiencies in humans. It is the process of increasing the bioavailable micronutrient density of staple crops through conventional plant breeding and modern biotechnology to achieve a measurable and positive impact on human health.. Currently, agronomic, conventional, and transgenic biofortification are three common approaches. Progress has been made in breeding orange sweetpotato, provitamin A maize, provitamin A cassava, high zinc rice and high zinc wheat, and high iron beans and high iron pearl millet via conventional breeding. Transgenic biofortification is used when genetic variability for vitamin and mineral targets is too low to meet the desired target levels, or for crops that are very difficult to breed, such as banana. The biofortification of cassava with Provitamin A (beta-carotene) was achieved through pure line and hybrid seed technology as well as genetic engineering. The provitamin A carotenoid in biofortified cassava is primarily β-carotene. In white cassava, there may be trace amounts of β-carotene, which may be present in concentrations as low as 1 mg/g fresh weigh or 3 mg/g dry weigh. Due to the instability of beta-carotene, cooking and processing methods can affect the retention of β-carotene in cassava leading to decrease bioavailability and bioefficacy.
Modern agriculture has been largely successful in meeting the food needs for ever increasing population in developing countries. On the contrary, malnutrition, especially Fe and Zn continue to pose a very serious constraint not only to human health as well economic development of nation that might formerly have got unnoticed. Besides, the micronutrient deficiencies are becoming increasingly common in agriculture as a result of higher levels of removal by ever-more-productive crops combined with breeding for higher yields, at the expense of micronutrient acquisition efficiency (Havlinet al., 2014).Therefore, agriculture must now focus on a new paradigm that will not only produce more food, but deliver better quality food as well.
Bio fortification for Enhanced Nutrition in Rice by Conventional and Molecula...Sathisha TN
Micronutrient malnutrition is widespread, especially in poor populations across the globe where daily caloric intake is confined mainly to staple cereals. Rice, which is a staple food for over half of the world's population, is low in bioavailable micronutrients required for the daily diet. Improvements of the plant-based diets are therefore critical and of high economic value in order to achieve a healthy nutrition of a large segment of the human population. Rice grain biofortification has emerged as a strategic priority for alleviation of micronutrient malnutrition
Bio fortification through Genetic EngineeringBalaji Rathod
Crop Bio-fortification is the idea of breeding crops to increase their nutritional value.
Bio-fortification differs from ordinary fortification because it focuses on making plant foods more nutritious as the plants are growing, rather than having nutrients added to the foods when they are being processed.
This is an improvement on ordinary fortification when it comes to providing nutrients for the rural poor, who rarely have access to commercially fortified foods.
“Bio-fortification options/success story - wheat”, presented by Arun Kumar Joshi, CIMMYT at the ReSAKSS-Asia Conference, Nov 14-16, 2011, in Kathmandu, Nepal.
the third world countries are having the issue of hidden hunger or micronutrient deficiency. harvest plus is a CGIAR initiative with a mission of eradication of hidden hunger by 2020. the biofortification programmes are gaining their pace due to this organization.
Biofortification, the process of increasing the bioavailable concentrations of essential elements in edible portions of crop plants through agronomic intervention or genetic selection, may be the solution to malnutrition or hidden hunger mitigation.
Biofortification, the process of breeding nutrients into food crops, provides a comparatively costeffective, sustainable, and long-term means of delivering more micronutrients.
This approach not only will lower the number of severely malnourished people who require treatment by complementary interventions but also will help them maintain improved nutritional status.
A description of the history, variation in methods/ approaches for biofortifying rice, benefits and challenges faced with biofortified rice and consequences for future generations..
Breeding for nutritional quality in pulsesDhanuja Kumar
Legumes have been part of the human diet since the early ages of agriculture. Legumes are consumed in many forms: seedling and young leaves are eaten in salads, fresh immature pods and seeds provide a green vegetable, and dry seeds are cooked in various dishes. Legume seeds provide an exceptionally varied nutrient profile, including proteins, fibres, vitamins and minerals.
Breeding for nutritional quality entails an improvement primarily in protein quantity and quality which are of paramount significance.
PROBLEMS AND PROSPECTS OF BREEDING FOR NUTRITIONAL QUALITY
• Negative correlation between yield and protein content.
• Negative correlation between protein and sulphur containing amino acids
• Lack of proper field screening technique.
Biofortification and its Approaches is a presentation that explores the science and methods behind this sustainable approach to improving human nutrition. It covers the different approaches to biofortification, including traditional breeding, genetic engineering, and agronomic techniques. The presentation also discusses the benefits of biofortification and its potential to help address the global challenge of micronutrient malnutrition.
Here are some of the key topics covered in the presentation:
What is biofortification?
Why is biofortification important?
What are the different approaches to biofortification?
The benefits of biofortification
Case studies of biofortified crops
The future of biofortification
The presentation is suitable for a wide audience, including students, researchers, policymakers, and anyone interested in learning more about this promising approach to improving human nutrition.
Keywords: biofortification, nutrition, micronutrient malnutrition, sustainable agriculture, crop breeding, genetic engineering, agronomic techniques
M.S. Swaminathan presents: Achieving the Zero Hunger Challenge & the Role of ...Harvest Plus
Professor M.S. Swaminathan presents "Achieving the Zero Hunger Challenge & the Role of Biofortification" at The 2nd Global Conference on Biofortification: Getting Nutritious Foods to People in Kigali, Rwanda. April 1, 2014
Bio fortification through Genetic EngineeringBalaji Rathod
Crop Bio-fortification is the idea of breeding crops to increase their nutritional value.
Bio-fortification differs from ordinary fortification because it focuses on making plant foods more nutritious as the plants are growing, rather than having nutrients added to the foods when they are being processed.
This is an improvement on ordinary fortification when it comes to providing nutrients for the rural poor, who rarely have access to commercially fortified foods.
“Bio-fortification options/success story - wheat”, presented by Arun Kumar Joshi, CIMMYT at the ReSAKSS-Asia Conference, Nov 14-16, 2011, in Kathmandu, Nepal.
the third world countries are having the issue of hidden hunger or micronutrient deficiency. harvest plus is a CGIAR initiative with a mission of eradication of hidden hunger by 2020. the biofortification programmes are gaining their pace due to this organization.
Biofortification, the process of increasing the bioavailable concentrations of essential elements in edible portions of crop plants through agronomic intervention or genetic selection, may be the solution to malnutrition or hidden hunger mitigation.
Biofortification, the process of breeding nutrients into food crops, provides a comparatively costeffective, sustainable, and long-term means of delivering more micronutrients.
This approach not only will lower the number of severely malnourished people who require treatment by complementary interventions but also will help them maintain improved nutritional status.
A description of the history, variation in methods/ approaches for biofortifying rice, benefits and challenges faced with biofortified rice and consequences for future generations..
Breeding for nutritional quality in pulsesDhanuja Kumar
Legumes have been part of the human diet since the early ages of agriculture. Legumes are consumed in many forms: seedling and young leaves are eaten in salads, fresh immature pods and seeds provide a green vegetable, and dry seeds are cooked in various dishes. Legume seeds provide an exceptionally varied nutrient profile, including proteins, fibres, vitamins and minerals.
Breeding for nutritional quality entails an improvement primarily in protein quantity and quality which are of paramount significance.
PROBLEMS AND PROSPECTS OF BREEDING FOR NUTRITIONAL QUALITY
• Negative correlation between yield and protein content.
• Negative correlation between protein and sulphur containing amino acids
• Lack of proper field screening technique.
Biofortification and its Approaches is a presentation that explores the science and methods behind this sustainable approach to improving human nutrition. It covers the different approaches to biofortification, including traditional breeding, genetic engineering, and agronomic techniques. The presentation also discusses the benefits of biofortification and its potential to help address the global challenge of micronutrient malnutrition.
Here are some of the key topics covered in the presentation:
What is biofortification?
Why is biofortification important?
What are the different approaches to biofortification?
The benefits of biofortification
Case studies of biofortified crops
The future of biofortification
The presentation is suitable for a wide audience, including students, researchers, policymakers, and anyone interested in learning more about this promising approach to improving human nutrition.
Keywords: biofortification, nutrition, micronutrient malnutrition, sustainable agriculture, crop breeding, genetic engineering, agronomic techniques
M.S. Swaminathan presents: Achieving the Zero Hunger Challenge & the Role of ...Harvest Plus
Professor M.S. Swaminathan presents "Achieving the Zero Hunger Challenge & the Role of Biofortification" at The 2nd Global Conference on Biofortification: Getting Nutritious Foods to People in Kigali, Rwanda. April 1, 2014
Biofortification is one solution among many that are needed to solve the complex problem of micronutrient deficiency, and it complements existing interventions.
8.mejoramiento del valor nutricional de plantastinieblas001
El mejoramiento del valor nutricional de las plantas mediante ingenieria genetica, ha demostrado que muchas deficiencias de estas pueden ser implantadas para su mejora nutricional y nutraceutica
Pollution Abatement of Petroleum HydrocarbonsSheetal Mehla
Abatement of polyaromatic hydrocarbons and other xenotoxic waste compounds that are generated during the refinement and recovery of petroleum and its byproducts.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
Cancer cell metabolism: special Reference to Lactate PathwayAADYARAJPANDEY1
Normal Cell Metabolism:
Cellular respiration describes the series of steps that cells use to break down sugar and other chemicals to get the energy we need to function.
Energy is stored in the bonds of glucose and when glucose is broken down, much of that energy is released.
Cell utilize energy in the form of ATP.
The first step of respiration is called glycolysis. In a series of steps, glycolysis breaks glucose into two smaller molecules - a chemical called pyruvate. A small amount of ATP is formed during this process.
Most healthy cells continue the breakdown in a second process, called the Kreb's cycle. The Kreb's cycle allows cells to “burn” the pyruvates made in glycolysis to get more ATP.
The last step in the breakdown of glucose is called oxidative phosphorylation (Ox-Phos).
It takes place in specialized cell structures called mitochondria. This process produces a large amount of ATP. Importantly, cells need oxygen to complete oxidative phosphorylation.
If a cell completes only glycolysis, only 2 molecules of ATP are made per glucose. However, if the cell completes the entire respiration process (glycolysis - Kreb's - oxidative phosphorylation), about 36 molecules of ATP are created, giving it much more energy to use.
IN CANCER CELL:
Unlike healthy cells that "burn" the entire molecule of sugar to capture a large amount of energy as ATP, cancer cells are wasteful.
Cancer cells only partially break down sugar molecules. They overuse the first step of respiration, glycolysis. They frequently do not complete the second step, oxidative phosphorylation.
This results in only 2 molecules of ATP per each glucose molecule instead of the 36 or so ATPs healthy cells gain. As a result, cancer cells need to use a lot more sugar molecules to get enough energy to survive.
Unlike healthy cells that "burn" the entire molecule of sugar to capture a large amount of energy as ATP, cancer cells are wasteful.
Cancer cells only partially break down sugar molecules. They overuse the first step of respiration, glycolysis. They frequently do not complete the second step, oxidative phosphorylation.
This results in only 2 molecules of ATP per each glucose molecule instead of the 36 or so ATPs healthy cells gain. As a result, cancer cells need to use a lot more sugar molecules to get enough energy to survive.
introduction to WARBERG PHENOMENA:
WARBURG EFFECT Usually, cancer cells are highly glycolytic (glucose addiction) and take up more glucose than do normal cells from outside.
Otto Heinrich Warburg (; 8 October 1883 – 1 August 1970) In 1931 was awarded the Nobel Prize in Physiology for his "discovery of the nature and mode of action of the respiratory enzyme.
WARNBURG EFFECT : cancer cells under aerobic (well-oxygenated) conditions to metabolize glucose to lactate (aerobic glycolysis) is known as the Warburg effect. Warburg made the observation that tumor slices consume glucose and secrete lactate at a higher rate than normal tissues.
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
Seminar of U.V. Spectroscopy by SAMIR PANDASAMIR PANDA
Spectroscopy is a branch of science dealing the study of interaction of electromagnetic radiation with matter.
Ultraviolet-visible spectroscopy refers to absorption spectroscopy or reflect spectroscopy in the UV-VIS spectral region.
Ultraviolet-visible spectroscopy is an analytical method that can measure the amount of light received by the analyte.
2. BIOFORTIFICATION
• Greek word “bios” means “life” and Latin word “fortificare” means
“make strong”.
• Fortification the addition of an ingredient to food to increase the
concentration of a particular element.
• Biofortification is a process for improving the nutritional value of
the edible parts of the plants, through mineral fertilization,
conventional breeding, or transgenic approaches.
3. NEED FOR BIOFORTIFICATION
• Hunger is the physical sensation of desiring food.
• The term “hidden hunger” has been used to describe the
micronutrient malnutrition inherent in human diets that are
adequate in calories but lack vitamins and/or mineral
elements.
• India is one of the countries having problem of malnutrition
• More than 50% of women, 46% of children below 3 years are
underweight and 38% are stunted.
• As per India state hunger index, all the states are with serious to
alarming indices with M.P. most alarming.
4. • There are 16 essential minerals, but 11 of them are required
in such small amounts and are so abundant in food and
drinking water that deficiency arises only in very unusual
circumstances. The remaining five are present in limiting
amounts in many foods, so a monotonous diet can easily
result in deficiency.
• These minerals are iodine (I), iron (Fe), zinc (Zn), calcium
(Ca), and selenium (Se).
5. • India is one of the worst affected countries in the world, with more
than 50 million cases of goiter and more than two million of
cretinism.
• The UN Standing Committee on Nutrition (UN/SCN) estimates that
140 million children and 7 million pregnant women are VA
deficient, primarily in Africa and South/Southeast Asia.
• The immediate outcome of Fe deficiency is iron deficiency anemia
(IDA), which is thought to affect at least two billion people
worldwide.
• Nearly two billion people are at risk of Zn deficiency,
predominantly children and pregnant women. Signs of severe zinc
deficiency include hair loss, skin lesions, wasting, and persistent
diarrhea.
6. Goal
• The ultimate goal of the biofortification strategy is to reduce mortality and
morbidity rates related to micronutrient malnutrition and to increase food
security, productivity, and the quality of life for poor populations of
developing countries by breeding staple crops that provide, at low cost,
improved levels of bioavailable micronutrients in a fashion sustainable way
over time.
11. Approach/protocol Successful examples
• Marker Technology Marker assisted Selection (MAS) a) High lysine in maize: First successful demonstration of marker
assisted selection; Several QPM hybrids in maize (Gupta et al., 2009,
2013)
b) High provitamin-A in maize (Muthusamy et al., 2014).
• Genetic Engineering (GE) Recombinant DNA approach
(rDNA)
a) High lysine: sorghum (Zhao et al., 2003), rice (Sindhu et al., 1997,
Katsube et al., 1999, Stoger et al., 2001, Christou and Twyman,
2004), wheat (Stoger et al., 2001; Christou and Twyman, 2004)
b) High methionine: rice (Hagan et al., 2003), maize (Lai and Messing,
2002).
• Gene stacking approach a) The three vitamin corn with five stacked genes (Naqvi et al., 2009)
b) Multi-biofortified rice with enhanced pro-vitamin A, zinc, iron and
folate concentrations (De Steur et al., 2012)
• Gene silencing (GS) approach a) Changing of the relative proportions of starch components amylose
and amylopectin in wheat and potato (Lafiandra et al., 2008);
enhanced B-glucan in wheat
b) Modifying levels of proteins and amino acids (Uauy et al., 2006),
GilHumanes et al., 2010 in wheat; O’Quinn et al., 2000); Yang et al.
(2002) in maize c) Modifying levels of fatty acids (Liu et al., 2002a,
2002b; Young et al., 2004, ILSI, 2008) in maize.
• Metabolic engineering Desired levels of qualitative and quantitative enhancement of compounds
of significance in human nutrition. (Dharmapuri et al., 2002- xanthophylls
content in tomato; Diretto et al., 2007a -carotenoid in potato; Fujisawa et
al., 2008-carotenoid in flax seed; Shintani and DellaPenna, 1998-vitamin E
in plants, Storozhenko et al., 2007-folate in rice)
• Direct multiple gene transfer approach a) Expression of complex recombinant macromolecules into the plant
genome in rice (Nicholson et al., 2005).
b) Engineered minichromosomes segregating independently of the
host chromosomes in maize (Carlson et al., 2007)
• Synthetic proteins and nucleotides approach Synthetic storage protein in sweet potato (Egnin and Prakash, 1997;
Prakash and Jaynes, 2000)
• Gene Editing Protocols Transcription Activator‐Like
Effector Nucleases (TALENs) approach
a) Several mutations in barley (Wendt et al., 2013) b) Improved quality of
soybean oil (Huan et al., 2014)
16. Pearl millet
MTPs, metal tolerance proteins;
FRO2, ferric chelate reductase;
ZIP, zinc regulator transporter
proteins;
AtIRT1, divalent metal transporter;
NA, Nicotianamine;
YSLs, yellow stripe like transporters;
ITPs, Iron transport proteins;
17. ZIP=ZRT-,IRT-like protein,
YSL=yellow stripe like transporter,
MFS=major facilitator superfamily transporter,
MTP=metal tolerance protein,
HMA=heavy metal ATPase,
FPN=ferroportin, NRAMP=natural resistance-
associated macrophage protein,
VIT=vacuolar iron transporter,
NA=nicotianamine,
Cit=citrate,
SP=small proteins
Protein storage vacuoles(PSVs),
phytate(Phy)
WHEAT
18.
19. Organizations working for biofortification
• The Consortium of International Agricultural Research Centers
(CGIAR) is an independent international organization established
under international law, with full international legal authority and
capacity to enter into treaties, agreements, and contracts, and
which responds to legal proceedings.
• HarvestPlus is the most significant, systematic, and symbolic
program of biofortification through conventional breeding. It is
an interdisciplinary program of plant breeders, molecular
biologists, nutritionists, economists, and communication and
behaviour change experts. The program was launched in 2004
with funding from the Bill and Melinda Gates Foundation and is
now coordinated through the CGIAR.
20. CIAT and IFPRI are the co-convening Centers of HarvestPlus
21.
22. Yadava, D. K., Hossain, F., & Mohapatra, T. (2018). Nutritional security through crop biofortification in India:
Status & future prospects. The Indian journal of medical research, 148(5), 621.
23. CROP VARIETY QUALITY INSTITUTE
Rice
CR Dhan 310
high protein (10.3%) ICAR-National Rice Research Institute,
Cuttack, Odisha.
DRR Dhan 45 high zinc (22.6 ppm) ICAR-Indian Institute of Rice Research,
Hyderabad, Telangana.
Wheat
WB 02
High zinc (42.0 ppm) and iron (40.0 ppm) ICAR-Indian Institute of Wheat and Barley
Research, Karnal, Haryana.
Pusa Vivek QPM9
improved
high provitamin-A (8.15 ppm) and also
contains high tryptophan (0.74%) and lysine
(2.67%) in endosperm protein
ICAR-IARI, New Delhi.
Pearl millet
HHB 299
high iron (73.0 ppm) and zinc (41.0 ppm)
content
Chaudhary Charan Singh-Haryana
Agricultural University, Hisar in
collaboration with (ICRISAT), Patancheru,
Hyderabad, Telangana, under ICAR-All
India Coordinated Research Project on
Pearl millet.
Pomegranate
Solapur Lal
high iron (5.6-6.1 mg/100 g), zinc (0.64-0.69
mg/100 g) and vitamin C (19.4-19.8 mg/100
g) in fresh arils
ICAR-National Research Centre on
Pomegranate, Pune, Maharashtra
Soybean
NRC-127
18.5-20.0 per cent oil and 38.0-40.0 per cent
protein content
ICAR-Indian Institute of Soybean Research,
Indore, Madhya Pradesh.
26. Advantages
• Investment is only required at the research and development
stage, and thereafter the nutritionally enhanced crops are entirely
sustainable.
• Mineral rich plants tend to be more vigorous and more tolerant
of biotic stress, which means yields are likely to improve in line
with mineral content.
• greatest long-term cost-effectiveness overall and is likely to have
an important impact over the next few decades.
• Moreover, plants assimilate minerals into organic forms that are
naturally bioavailable and contribute to the natural taste and
texture of the food.
• Further, fortified or enriched seeds also have more plant vigour,
seedling survival, faster initial emergence and grain yield.
27. Future Challenges
• Detailed knowledge on mechanisms regulating iron
compartmentalization in various plant organs will offer a major
contribution for reaching such goal.
• Improve the efficiency with which minerals are mobilized in the
soil.
• Reduce the level of antinutritional compounds such as phytic
acid, which inhibit the absorption of minerals in the gut
28. CASE STUDIES
• Development and Evaluation of Low Phytic Acid Soybean by
siRNA Triggered Seed Specific Silencing of Inositol
Polyphosphate 6-/3-/5-Kinase Gene
• Biofortification of field-grown cassava by engineering
expression of an iron transporter and ferritin
29. • They designed and expressed a inositol polyphosphate 6-/3-/5-kinase gene-
specific RNAi construct in the seeds of Pusa-16 soybean cultivar and
subsequently conducted a genotypic, phenotypic and biochemical analysis of
the developed putative transgenic populations and found very low phytic acid
levels, moderate accumulation of inorganic phosphate and elevated mineral
content in some lines. These low phytic acid lines did not show any reduction in
seedling emergence and displayed an overall good agronomic performance.
30. MATERIALS AND METHODS
Construction of RNAi Expression Vector
Generation of Transgenic Plants Expressing RNAi Construct
Transgene Integration Analysis: PCR Examination; Segregation
Analysis; Analysis by Southern Blotting
Transcript Analysis by Quantitative Real-Time PCR
Estimation of Seed Phosphorus Levels
Analysis of Phytic Acid Concentration by HPLC
In Vitro Bioavailability Assay
Agronomic Evaluation of Transgenic Plants: Germination Assay
for Seed Viability; Phenotypic Analysis
Statistical Analysis
31. Vector (305 bp)
(GmIPK2_S; FP 50-CG
CGGATCCGCGTTGCAGAAGCTCAAG-30
and
RP 50-TCCCC GCGGGG
AGCGACACTAATTCAAG-30) and anti-
sense (GmIPK2_As; FP 50-
CCGCTCGAGCGGAACGTC TTCGAGT TC-
30 and
RP 50-
CCATCGATGGCGCTGTGATTAAGTTCGT
A-30)
spacer of soybean
fatty acid
oley1112
desaturase gene
intron (GmFad2-1;
FP 50-TCCCCG
CGGGGAAGGTC
TGTCTTATTTTG
AATC-30 and RP
50CCATCGATGG
TATACCGCACTA
GT AAACCAC-
30)
33. PCR Result:
(FP 50-CGCGGATCCGCGTTGC AGAA GCTCAAG-30) and GmFAD2-1 reverse
(RP 50-CCATC GATGGTATACCGCACTAGTAA ACCAC-30) primers were used to
amplify a 700 bp fragment using thermal cycling conditions of 1 min at 94◦C; 30
cycles of 30 s at 94◦C, 30 s
at 62◦C, 30 s at 72◦C; and a final extension of 10 min at 72◦C.
37. • They used genetic engineering to improve mineral micronutrient concentrations in cassava.
Overexpression of the Arabidopsis thaliana vacuolar iron transporter VIT1 in cassava accumulated three-
to seventimes-higher levels of iron in transgenic storage roots than nontransgenic controls in confined
field trials in Puerto Rico. Plants engineered to coexpress a mutated A. thaliana iron transporter (IRT1) and
A. thaliana ferritin (FER1) accumulated iron levels 7–18 times higher and zinc levels 3–10 times higher than
those in nontransgenic controls in the field. Growth parameters and storage-root yields were unaffected
by transgenic fortification in our field data. Measures of retention and bioaccessibility of iron and zinc in
processed transgenic cassava indicated that IRT1+FER1 plants could provide 40–50% of the EAR for iron
and 60–70% of the EAR for zinc in 1- to 6-year-old children and nonlactating, nonpregnant West African
women.
38. Material and method
• Molecular characterization of in vitro– and greenhouse-grown
transgenic plants
• Plant establishment and growth in the greenhouse
• Determination of total biomass in the greenhouse
• Determination of T-DNA copy number
• Measurement of mineral concentrations
• Bioaccessibility studies
• Determination of EARs.
