Download to read offline
Uploaded byPickerington High School Central
12.4 Mutations
Mutations are changes to DNA that can alter genes and traits. There are two main types of mutations: point mutations, which change a single DNA nucleotide, and frameshift mutations, which add or delete nucleotides, altering the reading frame. Point mutations can be silent, changing no amino acids, missense, changing an amino acid, or nonsense, creating a stop codon. Frameshift mutations typically have more significant effects by changing all subsequent amino acids. Examples given are sickle cell anemia from a point mutation and cystic fibrosis from a frameshift deletion.
More Related Content
Similar to 12.4 Mutations
More from Pickerington High School Central
12.4 Mutations
- 1. Regents Biology 2009-2010 12.4 Mutations Changes to DNA
- 2. Regents Biology Mutations Changesto DNA are called mutations change the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa aa aa aa aa aa aaprotein trait
- 3. Regents Biology Types ofmutations Changes to the letters (A,C,T,G bases) in the DNA point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!
- 4. Regents Biology Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR Does this change the sentence? A LITTLE!
- 5. Regents Biology Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop Does this change the protein? DEPENDS…
- 6. Regents Biology Sickle cellanemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
- 7. Regents Biology Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? Why not? The code has repeats in it!
- 8. Regents Biology Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Really destroyed that protein!
- 9. Regents Biology Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!
- 10. Regents Biology Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA Does this change the protein? A LOT!
- 11. Regents Biology Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA Does this change the protein? A LOT!
- 12. Regents Biology Cystic fibrosis Broken salt channel in cells strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s
- 13. Regents Biology Salt channel transportssalt through protein channel out of cell Osmosis problems!airway salt H2O H2O salt normal lungs cystic fibrosis cells lining lungs salt channel normal mucus thick mucus mucus & bacteria build up = lung infections & damage
- 14. Regents Biology Deletion leadsto Cystic fibrosis deletion Loss of one amino acid!
- 15. Regents Biology 2009-2010 Notto ask questions is a mutation!
Editor's Notes
- #13 Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.
- #14 In people without cystic fibrosis, working cystic fibrosis proteins allow salt (chloride) to enter the air space and water follows by osmosis. The mucus layer is dilute and not very sticky. In people with cystic fibrosis, non-working cystic fibrosis proteins mean no salt (chloride) enters the air space and water doesn't either. The mucus layer is concentrated and very sticky. People with cystic fibrosis have lung problems because: Proteins for diffusion of salt into the airways don't work. (less diffusion) Less salt in the airways means less water in the airways. (less osmosis) Less water in the airways means mucus layer is very sticky (viscous). Sticky mucus cannot be easily moved to clear particles from the lungs. Sticky mucus traps bacteria and causes more lung infections. Therefore, because of less diffusion of salt and less osmosis of water, people with cystic fibrosis have too much sticky mucus in the airways of their lungs and get lots of lung infections. Thus, they are sick a lot.