SlideShare a Scribd company logo
Plants & Agriculture
IBERS, Aberystwyth
Public Good Plant Breeding
Agriculture the most important event
in human history
‘The original biotechnology, fundamental to culture, health,
quality environment & biodiversity.’
Agriculture is at the Center of Many of Society’s
Most Important Debates
Exciting time for Agriculture & Plant Breeding
• Global food security
•Enhanced productivity
•Increased yield
•Sustainable production
• Water availability
•Drought-tolerant crops
• Biofuels
•Yield technologies to help meet
demand for both food and fuel
• Global warming
•CO2 footprint
•Fertilizer use
Holistic Research
“No matter how excellent the
research done in one scientific
discipline is, its application in
isolation will have little positive
effect on crop production. What
is needed are venturesome
scientists who can work across
disciplines to produce
appropriate technologies and
who have the courage to make
their case with political leaders
to bring these advances to
fruition. ”
Norman E. Borlaug
Doubly Green Revolution
• The aim
•repeat the success of the Green
Revolution
•on a global scale to include
Africa!!
•in many diverse localities
• and be
•equitable
•sustainable
•and environmentally friendly
sunlight
plants
plant power
science Agriculture, Land
Use & Society
Plants provide sustainable solutions
‘ultimate green & clean technology’
fossil reserves biorenewables
oil...refineries bio...refineries
CHEMICALS MATERIALS FUELS
yesterday today and tomorrow
sunlight
plant biomass
a solar energy source for manufacturing
Agriculture critical to the future of
our planet and humanity
•FOOD,
•FEED,
•FUEL
•CHEMICALS
Daily calorie intake in developing world
Rice 45%
Wheat 29%
Maize 11%
Cassava 3%
Sorghum 2%
Potato 2%
Sweet potato 2%
Millet 2%
Soybean 2%
Bean 1%
Courtesy Tobert Rocheford and
Catherine Bermudez Kandianis
Keith Weller
Doug Wilson
Scott Bauer
Keith Weller
•DuPont Food security index
http://foodsecurity.eiu.com
•Father Green revolution: Norman
Borlaug.
•Civilization founded on crops
•Importance of diversity
Charles Darwin
Evolution is driven by natural selection
Darwin’s mentor
Great Teachers often feature in the development of Great People!
Fundamental role of Diversity &
Selection
Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835
ESEB Congress, Uppsala,
Sweden, August 2007
Selective breeding is a powerful tool
ESEB Congress, Uppsala,
Sweden, August 2007
Domestication
traits: traits that
distinguish seed &
fruit crops from
their progenitors
Vavilov 1887-1943
•Soviet botanist & geneticist
•Discovered and identified
centres of origin/cultivated
plants
•Criticised the non-
Mendelian concepts of
Lysenko
•Arrested in 1940, died of
malnutrition in prison in
1943.
Crop origins and diversification: multiple births
Science 316, 1830-1835
ESEB Congress, Uppsala,
Sweden, August 2007
Little overlap between centres of origin & today’s
productive agriculture.
ESEB Congress, Uppsala,
Sweden, August 2007
Nature Vol 418, 700-707
Why is this important?
Nature Vol 418, 700-707
Drought in Africa between now and 2090
Red, Orange =
More prone to
drought
Blue =
Wetter and less
prone to
drought
Hadley Centre, Met Office, UK
Crop Biodiversity
The Seed Vault at Svalbard
Global Crop Diversity Trust
Sexual reproduction in plants
Maize
Artificial cross pollination
Crossing
Distribution of Miscanthus Species
after Hodkinson & Renvoize et al. 2001
N 55°
N 24°
S 9°
China
Japan
Taiwan
IGER’s hunt for Asian elephant grass
http://www.iger.bbsrc.ac.uk/News/9march2007miscanthus.htm
Crossing
• Hybridisation Strategy
• 2n M. sinensis x 2n M.
sinensis from wide
geographical origins
• 4n M. sacchariflorus x
2n M. sinensis to
produce 3n M. x
giganteus types
Selection
Diverse Genetic Pool Increases Depth and
Breadth of Germplasm
• Increased Yield
• Disease Resistance
• Stress Tolerance
• Grain Quality / Added
Value
• Build on strength of
current germplasm as
well as Molecular
Breeding and Crop
Analytics Capabilities
Crossing
Serendipity Natural Hybridisation
Many modern crop species are the result of ancient (or
recent) hybridisation events.
Cotton
Wheat
Oilseed Rape
Maize
Wheat a classic allo-hexaploid
ESEB Congress, Uppsala,
Sweden, August 2007
Science Vol 316, 1862-1866
Wheat a classic allo-hexaploid
ESEB Congress, Uppsala,
Sweden, August 2007
The New Rice for Africa
Monty Jones
2004
• Organisation and importance of Diversity
• Selection is a powerful tool but need to
understand & know what to select for.
• Importance engagement.
– Journalists to articulate and sell stories!
Breeding major technology platform for
food, water & energy security
Next steps ?
Proteomics
Genomics
Analytical Technology
Transgenic Traits
Molecular Engineering
Winter Nurseries
Computer Technology
Plot Mechanisation
Quantitative Genetics
Statistics
Pedigree Breeding
Hybridisation
Open Pollinated Selection
GermplasmImprovement
(HigherSustainableYields)
Time
Plant Breeders use any
combination of these technologies
to develop enhanced products for
customers, and continue to
explore technologies to enhance
this process
New Opportunities for Agriculture
F1 Hybrids
ESEB Congress, Uppsala,
Sweden, August 2007
Hybrid vrs Open pollinated maize
On the right a
new, hybrid
maize variety
developed by
CIMMYT
with PASS
funding.
On the left, a
local landrace
variety
To put your footer here go to View > Header and Footer 49
USA: Historic Maize Yields
Yield
(tonnes/ha)
6
5
4
3
2
1
0
1875 1925 1975
Gregor Johann Mendel,
(b. 22 July 1822; d. 6 January 1884)
Moravia, Austro-Hungarian Empire
Originator of the concept of the gene
(autosomal inheritance)
Birthplace of Modern Genetic Analysis
Augustinian monastry garden, St. Thomas,
Brünn, Austria
Brno (Czech Rep.)
Experimemts, 1856-1870
A pea flower with the keel cut and opened
to expose the reproductive parts
The seven character differences studied by Mendel
purple-flowered (f) x white flowered (m)
May 2000
Life Science Companies
SeedCompanies
Joint Ventures
Cooperatives
Other Companies
GarstGarstSeed Co.Seed Co.
December 1997
20% Equity
ExSeedExSeedGenetics LLCGenetics LLC
AstraZeneca
PLC
United Kingdom
Mogen International NVMogen International NV
The Netherlands
Cooperatie CosunCooperatie CosunUA UA
The Netherlands
InterstateInterstatePayco Payco
August 1996
50% Equity
August 1996
50% Equity
June 1997
$78 M 100% Equity
100%Equity
August 1996
100%Equity
August 1996
100%Equity
Advanta BVAdvanta BV
The Netherlands
RoyalVanderHaveRoyalVanderHaveThe Netherlands
KoipesolKoipesol//AgrosemAgrosem//AgraAgra
Spain ItalyFrance
ZimmermanZimmerman
Hybrids, Inc.Hybrids, Inc.
1998
100%Equity
France
April 1998
100%Equity
November 1998
50% Equity
Land O’ Lakes
November 1998
50% Equity
December 1998
40% Equity
August 1998
100%Equity
July 1999
100%Equity
July 1999
80% Equity
U.S. CooperativeU.S. Cooperative
System:System:CroplanCroplanGenetics, FFR,Genetics, FFR,
GrowMarkGrowMark, etc., etc.
Wilson Seeds, Inc.Wilson Seeds, Inc.
Sturdy Grow Hybrids, Inc.Sturdy Grow Hybrids, Inc.
MaisadourMaisadourSemencesSemencesSASA
Novartis AGNovartis AG
(SyngentaAG)
Switzerland
AgritradingAgritradingItaly
EridaniaEridaniaBeghinBeghin-Say-Say
France
July 1999
20% Equity
SyngentaSyngenta AGAGDiversa Corp.Diversa Corp.
CalgeneCalgene, Inc., Inc.
July 1996
100%Equity
May 1998
$100 M50% Equity
Joint Venture
1982
100%Equity
AgriProAgriProSeedSeed
WheatWheatDivisionDivision
Cargill Hybrid SeedsCargill Hybrid Seeds
North AmericaNorth America
May 1998
$100 M50% Equity
Joint Venture
HybriTechHybriTechEurope SAEurope SA
France
February 1996
90% Equity
February 1996
10% Equity
PauPauEuralisEuralisFrance
CargillCargill, Inc., Inc.
RenessenRenessen
Cargill’sCargill’sInternationalInternational
Seed DivisionSeed Division
Corn States Hybrid Service, Inc.Corn States Hybrid Service, Inc.
Corn States InternationalCorn States InternationalSarlSarl..
AsgrowSeedAsgrowSeed
Company LLCCompany LLC
July 1998
$525 M100%Equity
July 1998
$1.4 B(est)
March 1996
$1.2 B 40% Equity
May 1998
$2.5 B 100%Equity
Total cost $3.7 Billion
November 1996
$240 M100%Equity
January 1997
$1.02 B 100% Equity
November 1997
$150 M100%Equity
April 1996
$30 M 50%Equity
November 1996
$50 M 5% Equity
May 1997
$242 M45% Equity
Total cost $322 Million
April 1996
$150 M100%Equity
November 1997
JV with FT
Sementes
June 1998
DeKalb GeneticsDeKalb Genetics
CorporationCorporation
AgracetusAgracetus, Inc., Inc.
Plant BreedingPlant Breeding
InternationalInternational
Cambridge,Cambridge,LtdLtd..
United Kingdom
First Line Seeds,First Line Seeds,LtdLtd..
Canada
MonsoyMonsoy
Brazil
JacobJacobHartzHartz
Seed Co., Inc.Seed Co., Inc.
1983
100%Equity
Holden’sHolden’s
FoundationFoundation
SeedsSeeds
Monsanto/
Pharmacia
Monsanto/
Pharmacia
Sementes AgroceresSementes AgroceresSASA
Brazil
HybriTechHybriTechSeedSeed
Int’l., Inc.Int’l., Inc.
CustomFarm SeedCustom Farm Seed
July 1997
CereonCereon
Mendel BiotechMendel Biotech
ParadigmGeneticsParadigmGenetics
March 1999
16.4% Equity
UnitedUnitedAgriseedsAgriseeds, Inc., Inc.
Morgan SeedsMorgan Seeds
Argentina
AdvancedAdvancedAgriTraitsAgriTraits
December 1996
$9.4 M18.75%
Equity
March 1999
83.6% Equity
March 1999
$15 M
25% Equity
April 1998
$32 M
100%Equity
September 1996
$34.6 M
100%Equity
February 1996
$72 M
100%Equity
September 1998
100%Equity
October 1998
$322 M100%Equity
MycogenMycogen
CorporationCorporation
Illinois Foundation Seed, Inc.Illinois Foundation Seed, Inc.
Dow
Agrosciences
Dow
Agrosciences
VerneuilVerneuil
Holding SAHolding SA
France
HibridosHibridosColoradoColoradoLtdaLtda
FTFTBiogeneticsBiogeneticsdedeMilho LtdaMilho Ltda
Brazil
DinamilhoDinamilhoCarolCarol
Productos Agricolas LtdaProductos Agricolas Ltda
Brazil
Large Scale Biology (BioSource)Large Scale Biology (BioSource)
DiversaDiversa)
BayerBayerParadigm
Incyte
LION
Exelixis
BASFBASF
Lynx
Lexicon
Incyte
Exelixis
Ag Chem & Seed Industry
December 1999
24% Equity
1993 80% Equity
December 1999
76% Equity
March 1998
50% Equity
March 1998
50% Equity
12% Equity
BiotechnicaBiotechnica
International, Inc./International, Inc./
LG SeedsLG Seeds
Akin Seed Co.Akin Seed Co.
CallahanCallahan SeedsSeeds
October 1993
80% Equity
March 1994
100%Equity
July 1994
85% Equity
June 1994
100%Equity
October 1990
100%Equity
99%
Equity
1997 55% Equity
Aventis CropScienceAventis CropScience
AgrEvoAgrEvo
Aventis SAAventis SA
France
ScheringScheringAGAG
Germany
1997
25% Equity
KWSKWS SaatSaat
Mais AngevinMais Angevin
France
BiogemmaBiogemma
France
RhoBioRhoBioFrance
France
PauPau EuralisEuralis
France
NickersonNickerson
SeedsSeeds
United Kingdom
Great LakesGreat Lakes
Hybrids, Inc.Hybrids, Inc.
Canada
KingKingAgroAgroInc.Inc.
Canada
GroupeGroupe
LimagrainLimagrain
France
ProagroGroupProagroGroup
India
Plant Genetic SystemsPlant Genetic Systems
International (PGS)International (PGS)
February 1999
100%Equity
August 1996
75% Equity- $550M
Germany
Sementes Ribeiral LtdaSementes Ribeiral Ltda..
Sementes Fartura LtdaSementes Fartura Ltda
Mitla Pesquisa Agricola LtdaMitla Pesquisa Agricola Ltda
Brazil
July 1999
100%Equity
Plantec BiotechnologiePlantec Biotechnologie
Germany
1996
95% Equity
15% Equity
Nidera SemillasNidera Semillas
Argentina
Pending
Up to 25% Equity
Agritope/Agrinomics
Diversa
Brazil
DoisDois MarcosMarcos
March 1999
100%Equity
Protein TechnologiesProtein Technologies
InternationalInternational
December 1997
$1.5 B100%Equity
OptimumQualityOptimumQuality
Grains, LLCGrains, LLC
HybrinovaHybrinovaSASA
April 1998
100%Equity
August 1997
50% Equity
E.I. DuPont deE.I. DuPont de
Nemours & Co.Nemours & Co.
Pioneer Hi-Bred
International, Inc.
Pioneer Hi-BredPioneer Hi-Bred
International, Inc.International, Inc.
October 1999
100%Equity
August 1997
50% Equity
Lynx
OGS
AffymetrixCuraGen
Maxygen
Importance Genetics
Market Identification
by Trait, Crop,
species
Transgenic Plant
Development
Cell Culture
Molecular Biology
Genetics
Variety Development
Yield Trials
Product Testing
Products
Genetic diversity
Analytical Screens
Biochemistry
Germplasm Development
Traditional &
Molecular Breeding
Genetics
Molecular Genetics
• 24 ABI 377 Automated sequencers
• 20,000 Lane per week capacity
Gene Discovery
Plant Biology
Genomics
Genetic software & Hardware
ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW
BREEDING
Strategically breed plants
to create new, more robust
seeds that perform better –
and longer – in the field.
AGRONOMICS
Use precision ag, planting density,
plant health protection, and
conservation tillage to make acres
more productive.
BIOTECHNOLOGY
Supplement breeding
advancements by adding
special beneficial genes
to the plant.
“The Three Pillars of Yield”
Wamalwa Farm, Siritanyi FFS, Kanduyi.
Maize-groundnut intercrop providing 5330
kg maize and 1203 kg groundnut per ha.
These results indicate that MBILI can
produce significant food surpluses.
Rasike Farm, Chililila WG. MBILI maize-soyabean
intercrop providing 1215 kg maize and 545 kg
soyabean per ha when conventional intercrops
failed. These results indicate that MBILI is a
means toward greater food security.
Feeding future populations means doubling the productivity of neglected but
nutritious crops such as yams and green bananas
“Selection works.”
JW Dudley Crop Sci (2007) 47(S3)S20–S31
Eco-systems based approach to
plant breeding
Grass crop domestication – increasing
forage quality
(Mean WSC over 5 years data)
Cultivar Mean Water Soluble
Carbohydrate Content
S23 17.1%
AberDart 20.6%
AberAvon 20.6%
AberStar 21.5%
AberMagic 23.7%
High sugar ryegrass (Environmental/ Quality Trait)
Economic benefits – live weight gain
Environmental benefits – reduced diffuse pollution
- reduced GHG emissions
New traits-new sources genetic diversity
Redirection of metabolic hydrogen
Methods of methane mitigation:
Feed
CH4
CO2
Methanogens
Protozoa
Microbial cells
Science has provided the
key to unlocking the
potential of food
Sugar keeps sheep happy, and has
revolutionised food production, says
Steve Jones.
Steve Jones is professor of genetics at University College London
Conversion of high sugar
grasses to alcohol based
transport fuel
Image courtesy of Steve Martin, TMO Renewables
Harvest
Primary
Processing
(screw press)
Juice
Fibre
Fermentation
Digestion
Co-Products
Co-Products
Ethanol potential:
~ 5000 litres/Ha/yr
Ethanol potential:
~ 5000 litres/Ha/yr
Alternative
uses
Alternative
uses
Single enzyme
Natural Products Biotransformation &
composites
Biorefining Centre of Excellence
The Life sciences revolution
Molecular biology
Computer science
Mathematics
Exciting time
Unlocking the genetic potential
of the biosphere
Sustainable food
production
Plant
Breeding
ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG
ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA
ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA
GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT
TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTA
TGGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTAC
CGCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCT
TCTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA
DNA – a common language across living organisms in the biosphere
genome programmes link understanding of biology to agriculture
implications for:
- forestry
- aquaculture
- livestock
- arable
Contemporary Science
Democratisation genomics
Roche 454: Metagenomics,
amplicon sequencing, BAC
sequencing
Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for
amplicons, small genomes, focused GBS and pilot experiments
Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes
Genes provide the foundation of new products for
farmers
biomass utility?
improved agronomy?
tolerance to cold?
yield?
tolerance to drought?
flowering time?
Genes Protein Trait Product
Marker- Aided Selection
• Locating
and
tagging the
genes for
drought
tolerance
© ISTOCKPHOTO
DAVID MARCHAL
Genomics and the People Century
Genomics-based research will make a difference but
only if there is integration across social & natural
sciences.
Iowa maize yield 61-90; 90-08
1960 1970 1980 1990 2000 2010
0
3
6
9
12
b=95 kg/ha/yr
R2
=0.51***
b=206 kg/ha/yr
R2
=0.61***
Year
Maizeyield(t/ha)
GMOs
US maize yields still rising –
why?
-1.0
-0.5
0.0
0.5
1.0
1.5
2.0
1986
1988
1990
1992
1994
1996
1998
2000
2002
2004
2006
Source: Defra & USDA
t/ha
78
Scarcity The green revolution
Set aside, CAP changesSubsidy and Surplus
Security
Set Aside
Biofuels
Food Prices
Food Security
79
Energy
Climate Change
Water (the new oil)
Food Security
Diet and Health
< 1000 1000 - 2000 > 2000
Estimated global water scarcity in 2050
(from Wallace, 2000)
per capita annual renewable freshwater
resource (m3/person/year).
sunlight
plants
plant biodiversity
science Agriculture, Land
Use & Society
Plants provide sustainable solutions
‘ultimate green & clean technology’
Sydney Brenner
“Which type of science to
fund is simple:
all science is problem
driven and should be
judged by the importance
of the problem and the
quality of the solutions
provided.”
A Life in Science
In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating
Ability to Realize Step-Change Improvements
Reference
genomes for
each crop
Genomes
targeted for
specific traits
(disease)
Genome for
every yield plot
GENOMES/YEAR
In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating
Ability to Realize Step-Change Improvements
Reference
genomes for
each crop
Genomes
targeted for
specific traits
(disease)
Genome for
every yield plot
GENOMES/YEAR
Meeting the Demands of a Growing Global Market
• World population continues to increase
• Per capita food consumption continues to rise
• Consumers continue to demand improved taste, convenience, and nutrition
GROWING WORLD POPULATION (B)
Source: FAO, WHO
RISING CEREAL DEMAND (MMT)
1
2
3
4
5
6
7
8
9
1981 1999 2015 2030
500
1000
1500
2000
2500
3000
1981 1999 2015 2030
TRANSITION NATIONS DEVELOPED NATIONS DEVELOPING NATIONS
“To feed the eight billion people expected by 2025, the world will have to double food production…”
CSIS - Seven Revolutions
Growth rates due to early years of the
Green Revolution (1961-1980)
0
0.5
1
1.5
2
2.5
3
3.5
Latin America Asia Middle East Africa
Other inputs
Cultivars
Growth rates due to late years of the
Green Revolution (1981-2000)
-0.5
0
0.5
1
1.5
2
2.5
Latin America Asia Middle East Africa
Other inputs
Cultivars
Public good plant breeding requiresPublic good plant breeding requires
introduction of new sources diversityintroduction of new sources diversity
DiversityDiversity
BreedingBreeding
MethodologyMethodology
Traits &Traits &
ProductsProducts
OatsOats
Forage grassesForage grasses
Turf grassTurf grass
LegumesLegumes
MiscanthusMiscanthus
New Opportunities but also complexityNew Opportunities but also complexity
Performance under
farmers’ conditions
and farmers’
acceptance
Participatory maize breeding in Africa
• Prioritize most important stresses
under farmers’ conditions
• Manage trials on experiment
station and evaluate large numbers
of cultivars,
• Select the best, and …
• Involve farmers
– Mother trials in center of farming
community grown under best-bet
input conditions
– Farmer-representative input
conditions
– Farmer-managed baby trials
• Partnership with extension, NGOs,
rural schools, and farmer
associations
The Mother / Baby trial design
Collaborative, on-farm evaluation of maize cultivars
IMPROVED
GERMPLASM
GENES
GenomicsGenetic Resources
Genetic
Engineering
Marker-assisted
Selection
Conventional
Selection
Genebank accessions
Segregating populations
Forward/reverse genetic systems
Structural
Functional
Plant Breeding Options
Crop Breeding Technology
Options
Ghana’s
Success
Story
• MDG 1 achieved
• Malnourished - 5.8m in
1993 to 2.7 m in 2003.
• Declines in %
underweight children
and mortality
• Strong agricultural
growth since 80s
• 25% increase due to
area expansion
• Maize yield up by 36%,
cassava by 50%
• New maize, yam, rice
and cassava varieties
• A pest resistant cassava.
• Strong growth in
smallholder cocoa &
pineapples
• Market liberalisation
• New rural infrastructure
Sources: Development Outreach,
October, 08;Coulombe & Wodon,
World Bank; Irish Hunger Report
All this is threatened by
Climate Change
• Higher
temperatures
• Greater & more
intense rainfall
• Greater droughts
• River bank erosion
• Rising sea levels
• More intense
cyclones
• Salt water
incursions
biology is the science of thebiology is the science of the
natural world & critical to thenatural world & critical to the
future of agriculture.future of agriculture.
‘all life depends on sunlight
and a green leaf’
The biosphere – nature’s solutions
Separate Niches
Source: Naylor R. and Battisti D. 2008 (pers comm)
Source: Global Biodiversity Trust
Maize has more molecular diversity than
humans and apes combined
Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001)
1.34%
0.09%
1.42%
Selective Breeding is a Powerful Tool
Picture courtesy of Roslin Institute
Projected losses of food caused by
the adverse effects of climate change
(2080)
The idea of blending inheritance
Spermatozoon and egg
contained essences from
various parts of the body;
at conception, these
essences somehow
blended to form a pattern
for the new individual
Ideas in Science come in
fashions
called paradigms
Reasons for choosing to study garden pea
• No morals involved
• Can be grown in a small area
• Produce lots of offspring
• Easily identifiable traits
• Produce true-to-type when
allowed to self- pollinate over
several generations
• Can be artificially cross-
pollinated
Summary and conclusions of Mendel’s experiments
•After crossing pure parental strains, the
F1 produced 100% of one character.
•After self-pollinating the F1, both
characters showed up in a 3:1 ratio.
•Because the same types of ratio kept
coming up, Mendel believed that there
must be some mathematical formula or
explanation for the observed data
•The first assumption made by Mendel
was that there must be a ”pair of
factors” that controls the trait in pea
plant. This “pair of factors” idea helped
him formulate his principles

More Related Content

What's hot

Crop diversity
Crop diversityCrop diversity
Crop diversity
Zewde Achiso
 
Forages for the Future Newsletter No 4
Forages for the Future Newsletter No 4Forages for the Future Newsletter No 4
Forages for the Future Newsletter No 4
Tropical Forages Program
 
Conservation of farm animal genetic resources
Conservation of farm animal genetic resourcesConservation of farm animal genetic resources
Conservation of farm animal genetic resources
Illaya Kumar
 
Diversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food securityDiversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food security
Colin Khoury
 
Climate change and animal health
Climate change and animal healthClimate change and animal health
Climate change and animal health
ILRI
 
The Conservation and Use of Crop Genetic Resources for Food Security
The Conservation and Use of Crop Genetic Resources for Food SecurityThe Conservation and Use of Crop Genetic Resources for Food Security
The Conservation and Use of Crop Genetic Resources for Food Security
Colin Khoury
 
Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...
Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...
Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...
Premier Publishers
 
Forages for the Future Newsletter No 5
Forages for the Future Newsletter No 5Forages for the Future Newsletter No 5
Forages for the Future Newsletter No 5
Tropical Forages Program
 
Forages for the Future Newsletter No 7
Forages for the Future Newsletter No 7Forages for the Future Newsletter No 7
Forages for the Future Newsletter No 7
Tropical Forages Program
 
Conservation concerns and collecting priorities for crop wild relatives of Au...
Conservation concerns and collecting priorities for crop wild relatives of Au...Conservation concerns and collecting priorities for crop wild relatives of Au...
Conservation concerns and collecting priorities for crop wild relatives of Au...
Colin Khoury
 
Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...
Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...
Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...
ICRISAT
 
The role of livestock in achieving the SDGs
  The role of livestock in achieving the SDGs  The role of livestock in achieving the SDGs
The role of livestock in achieving the SDGs
ILRI
 
ICRISAT genebank - Preserving a rich heritage for food security
ICRISAT genebank - Preserving a rich heritage for food securityICRISAT genebank - Preserving a rich heritage for food security
ICRISAT genebank - Preserving a rich heritage for food security
ICRISAT
 
Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...
Colin Khoury
 
The emerging middle class and the world market for beef
The emerging middle class and  the world market for beefThe emerging middle class and  the world market for beef
The emerging middle class and the world market for beef
ILRI
 
The livestock revolution and implications for human health and disease
The livestock revolution and implications for human health and diseaseThe livestock revolution and implications for human health and disease
The livestock revolution and implications for human health and disease
ILRI
 
Forages for the Future Newsletter No 9
Forages for the Future Newsletter No 9Forages for the Future Newsletter No 9
Forages for the Future Newsletter No 9
Tropical Forages Program
 
Gm wheat
Gm wheatGm wheat
ILRI overview
ILRI overviewILRI overview
ILRI overview
ILRI
 
Towards successful, and sustainable, livestock futures worldwide
Towards successful, and sustainable, livestock futures worldwideTowards successful, and sustainable, livestock futures worldwide
Towards successful, and sustainable, livestock futures worldwide
ILRI
 

What's hot (20)

Crop diversity
Crop diversityCrop diversity
Crop diversity
 
Forages for the Future Newsletter No 4
Forages for the Future Newsletter No 4Forages for the Future Newsletter No 4
Forages for the Future Newsletter No 4
 
Conservation of farm animal genetic resources
Conservation of farm animal genetic resourcesConservation of farm animal genetic resources
Conservation of farm animal genetic resources
 
Diversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food securityDiversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food security
 
Climate change and animal health
Climate change and animal healthClimate change and animal health
Climate change and animal health
 
The Conservation and Use of Crop Genetic Resources for Food Security
The Conservation and Use of Crop Genetic Resources for Food SecurityThe Conservation and Use of Crop Genetic Resources for Food Security
The Conservation and Use of Crop Genetic Resources for Food Security
 
Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...
Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...
Agronomic, Yield and Quality Performance Evaluation of Improved Vetch Varieti...
 
Forages for the Future Newsletter No 5
Forages for the Future Newsletter No 5Forages for the Future Newsletter No 5
Forages for the Future Newsletter No 5
 
Forages for the Future Newsletter No 7
Forages for the Future Newsletter No 7Forages for the Future Newsletter No 7
Forages for the Future Newsletter No 7
 
Conservation concerns and collecting priorities for crop wild relatives of Au...
Conservation concerns and collecting priorities for crop wild relatives of Au...Conservation concerns and collecting priorities for crop wild relatives of Au...
Conservation concerns and collecting priorities for crop wild relatives of Au...
 
Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...
Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...
Germplasm conservation at ICRISAT RS Paroda Genebank - for sustainable food s...
 
The role of livestock in achieving the SDGs
  The role of livestock in achieving the SDGs  The role of livestock in achieving the SDGs
The role of livestock in achieving the SDGs
 
ICRISAT genebank - Preserving a rich heritage for food security
ICRISAT genebank - Preserving a rich heritage for food securityICRISAT genebank - Preserving a rich heritage for food security
ICRISAT genebank - Preserving a rich heritage for food security
 
Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...
 
The emerging middle class and the world market for beef
The emerging middle class and  the world market for beefThe emerging middle class and  the world market for beef
The emerging middle class and the world market for beef
 
The livestock revolution and implications for human health and disease
The livestock revolution and implications for human health and diseaseThe livestock revolution and implications for human health and disease
The livestock revolution and implications for human health and disease
 
Forages for the Future Newsletter No 9
Forages for the Future Newsletter No 9Forages for the Future Newsletter No 9
Forages for the Future Newsletter No 9
 
Gm wheat
Gm wheatGm wheat
Gm wheat
 
ILRI overview
ILRI overviewILRI overview
ILRI overview
 
Towards successful, and sustainable, livestock futures worldwide
Towards successful, and sustainable, livestock futures worldwideTowards successful, and sustainable, livestock futures worldwide
Towards successful, and sustainable, livestock futures worldwide
 

Viewers also liked

Caso inf definitivo
Caso inf definitivoCaso inf definitivo
Caso inf definitivo
Francisco Fanjul Losa
 
Hemodinamia
HemodinamiaHemodinamia
Un nuevo enfoque de trabajo para la educacion basica
Un nuevo enfoque de trabajo para la educacion basicaUn nuevo enfoque de trabajo para la educacion basica
Un nuevo enfoque de trabajo para la educacion basica
Luis Alberto Ortiz Castañeda
 
Ecg ejercicios 1
Ecg ejercicios 1Ecg ejercicios 1
ECG. Casos prácticos
ECG. Casos prácticosECG. Casos prácticos
ECG. Casos prácticos
cartuja
 
Lectura de electrocardiogramas
Lectura de electrocardiogramasLectura de electrocardiogramas
Lectura de electrocardiogramas
Universidad Autónoma de Sinaloa
 
Entrenamiento en interpretación de ECG
Entrenamiento en interpretación de ECG Entrenamiento en interpretación de ECG
Entrenamiento en interpretación de ECG
Alejandro Paredes C.
 
Manual de electrocardiografia para enfermeria - 2014
Manual de electrocardiografia para enfermeria - 2014Manual de electrocardiografia para enfermeria - 2014
Manual de electrocardiografia para enfermeria - 2014
Violeta Padilla Perez
 
Ciclo cardiaco
Ciclo cardiaco Ciclo cardiaco
Ciclo cardiaco
liz viju
 
Interpretacion electrocardiograma EKG
Interpretacion electrocardiograma EKGInterpretacion electrocardiograma EKG
Interpretación de electrocardiogramas
Interpretación de  electrocardiogramasInterpretación de  electrocardiogramas
Interpretación de electrocardiogramas
Emmanuel Hernandez
 
Anatomía y fisiología cardíaca
Anatomía y fisiología cardíaca Anatomía y fisiología cardíaca
Anatomía y fisiología cardíaca
JD SEP
 
La alegria de_leer_el_electrocardiogramas
La alegria de_leer_el_electrocardiogramasLa alegria de_leer_el_electrocardiogramas
La alegria de_leer_el_electrocardiogramas
Nadya Parsons
 
Espanol slideshare
Espanol slideshareEspanol slideshare
Espanol slideshare
Victor GR
 
Paginas de matematicas
Paginas de matematicasPaginas de matematicas
Paginas de matematicas
espanol
 
Getting Started With SlideShare
Getting Started With SlideShareGetting Started With SlideShare
Getting Started With SlideShare
SlideShare
 

Viewers also liked (16)

Caso inf definitivo
Caso inf definitivoCaso inf definitivo
Caso inf definitivo
 
Hemodinamia
HemodinamiaHemodinamia
Hemodinamia
 
Un nuevo enfoque de trabajo para la educacion basica
Un nuevo enfoque de trabajo para la educacion basicaUn nuevo enfoque de trabajo para la educacion basica
Un nuevo enfoque de trabajo para la educacion basica
 
Ecg ejercicios 1
Ecg ejercicios 1Ecg ejercicios 1
Ecg ejercicios 1
 
ECG. Casos prácticos
ECG. Casos prácticosECG. Casos prácticos
ECG. Casos prácticos
 
Lectura de electrocardiogramas
Lectura de electrocardiogramasLectura de electrocardiogramas
Lectura de electrocardiogramas
 
Entrenamiento en interpretación de ECG
Entrenamiento en interpretación de ECG Entrenamiento en interpretación de ECG
Entrenamiento en interpretación de ECG
 
Manual de electrocardiografia para enfermeria - 2014
Manual de electrocardiografia para enfermeria - 2014Manual de electrocardiografia para enfermeria - 2014
Manual de electrocardiografia para enfermeria - 2014
 
Ciclo cardiaco
Ciclo cardiaco Ciclo cardiaco
Ciclo cardiaco
 
Interpretacion electrocardiograma EKG
Interpretacion electrocardiograma EKGInterpretacion electrocardiograma EKG
Interpretacion electrocardiograma EKG
 
Interpretación de electrocardiogramas
Interpretación de  electrocardiogramasInterpretación de  electrocardiogramas
Interpretación de electrocardiogramas
 
Anatomía y fisiología cardíaca
Anatomía y fisiología cardíaca Anatomía y fisiología cardíaca
Anatomía y fisiología cardíaca
 
La alegria de_leer_el_electrocardiogramas
La alegria de_leer_el_electrocardiogramasLa alegria de_leer_el_electrocardiogramas
La alegria de_leer_el_electrocardiogramas
 
Espanol slideshare
Espanol slideshareEspanol slideshare
Espanol slideshare
 
Paginas de matematicas
Paginas de matematicasPaginas de matematicas
Paginas de matematicas
 
Getting Started With SlideShare
Getting Started With SlideShareGetting Started With SlideShare
Getting Started With SlideShare
 

Similar to B4FA 2012 Nigeria: Plants and Agriculture - Wayne Powell

Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)
Farming Futures
 
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
b4fa
 
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
b4fa
 
Research roundup September 2015 - MAGAZINE
Research roundup September 2015 - MAGAZINEResearch roundup September 2015 - MAGAZINE
Research roundup September 2015 - MAGAZINE
Allison Sears
 
Incremental transformation: systems agronomy in dryland farming systems
Incremental transformation: systems agronomy in dryland farming systemsIncremental transformation: systems agronomy in dryland farming systems
Incremental transformation: systems agronomy in dryland farming systems
Global Plant Council
 
T6 a osseweijer_food security and energy compilation_18nov2014_patricia
T6 a osseweijer_food security and energy compilation_18nov2014_patriciaT6 a osseweijer_food security and energy compilation_18nov2014_patricia
T6 a osseweijer_food security and energy compilation_18nov2014_patricia
Biofuels and Food Security Interactions Workshop
 
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann TutwilerAgricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Independent Science and Partnership Council of the CGIAR
 
Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...
Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...
Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...
diversifoodproject
 
Spain Power Point Presentation
Spain Power Point PresentationSpain Power Point Presentation
Spain Power Point Presentation
minicampusa
 
Making Peas Pay - Sustainable Farming
Making Peas Pay - Sustainable FarmingMaking Peas Pay - Sustainable Farming
Making Peas Pay - Sustainable Farming
School Vegetable Gardening - Victory Gardens
 
Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?
FAO
 
From a local experience of minimum till to a strategy for no-til development ...
From a local experience of minimum till to a strategy for no-til development ...From a local experience of minimum till to a strategy for no-til development ...
From a local experience of minimum till to a strategy for no-til development ...
Joanna Hicks
 
ILRI overview
ILRI overview ILRI overview
ILRI overview
ILRI
 
ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009
ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009
ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009
International Society for Horticultural Science
 
Current issues and trends in Seed Industry, BioAsia 2010
Current issues and trends in Seed Industry, BioAsia 2010Current issues and trends in Seed Industry, BioAsia 2010
Current issues and trends in Seed Industry, BioAsia 2010
BioAsia: The Global Bio Business Forum
 
How to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned PublicHow to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned Public
Kevin Folta
 
Pumpkin cultivation .pptx
Pumpkin cultivation .pptxPumpkin cultivation .pptx
Pumpkin cultivation .pptx
YogendraKumarBuddhas
 
Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...
Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...
Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...
epsoeurope
 
Seeds for Life: Scaling up Agro-Biodiversity
Seeds for Life: Scaling up Agro-BiodiversitySeeds for Life: Scaling up Agro-Biodiversity
Seeds for Life: Scaling up Agro-Biodiversity
Seeds
 
Agricultural biodiversity - an essential asset for the success and resilience...
Agricultural biodiversity - an essential asset for the success and resilience...Agricultural biodiversity - an essential asset for the success and resilience...
Agricultural biodiversity - an essential asset for the success and resilience...
Bioversity International
 

Similar to B4FA 2012 Nigeria: Plants and Agriculture - Wayne Powell (20)

Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)
 
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
 
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
 
Research roundup September 2015 - MAGAZINE
Research roundup September 2015 - MAGAZINEResearch roundup September 2015 - MAGAZINE
Research roundup September 2015 - MAGAZINE
 
Incremental transformation: systems agronomy in dryland farming systems
Incremental transformation: systems agronomy in dryland farming systemsIncremental transformation: systems agronomy in dryland farming systems
Incremental transformation: systems agronomy in dryland farming systems
 
T6 a osseweijer_food security and energy compilation_18nov2014_patricia
T6 a osseweijer_food security and energy compilation_18nov2014_patriciaT6 a osseweijer_food security and energy compilation_18nov2014_patricia
T6 a osseweijer_food security and energy compilation_18nov2014_patricia
 
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann TutwilerAgricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
 
Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...
Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...
Underutilized and forgotten crops: Definitions and concepts - Ambrogio Costan...
 
Spain Power Point Presentation
Spain Power Point PresentationSpain Power Point Presentation
Spain Power Point Presentation
 
Making Peas Pay - Sustainable Farming
Making Peas Pay - Sustainable FarmingMaking Peas Pay - Sustainable Farming
Making Peas Pay - Sustainable Farming
 
Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?
 
From a local experience of minimum till to a strategy for no-til development ...
From a local experience of minimum till to a strategy for no-til development ...From a local experience of minimum till to a strategy for no-til development ...
From a local experience of minimum till to a strategy for no-til development ...
 
ILRI overview
ILRI overview ILRI overview
ILRI overview
 
ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009
ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009
ISHS Jozef Van Assche Presentation Nairobi Kenya 31 August2009
 
Current issues and trends in Seed Industry, BioAsia 2010
Current issues and trends in Seed Industry, BioAsia 2010Current issues and trends in Seed Industry, BioAsia 2010
Current issues and trends in Seed Industry, BioAsia 2010
 
How to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned PublicHow to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned Public
 
Pumpkin cultivation .pptx
Pumpkin cultivation .pptxPumpkin cultivation .pptx
Pumpkin cultivation .pptx
 
Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...
Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...
Wilhelm Gruissem - Global Plant Council: A coalition of plant and crop societ...
 
Seeds for Life: Scaling up Agro-Biodiversity
Seeds for Life: Scaling up Agro-BiodiversitySeeds for Life: Scaling up Agro-Biodiversity
Seeds for Life: Scaling up Agro-Biodiversity
 
Agricultural biodiversity - an essential asset for the success and resilience...
Agricultural biodiversity - an essential asset for the success and resilience...Agricultural biodiversity - an essential asset for the success and resilience...
Agricultural biodiversity - an essential asset for the success and resilience...
 

More from b4fa

B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon SchmickleB4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
b4fa
 
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph KithamaB4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
b4fa
 
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon SchmickleB4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
b4fa
 
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon SchmickleB4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
b4fa
 
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel OtungeB4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
b4fa
 
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
b4fa
 
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth DansoB4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
b4fa
 
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul AsareB4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
b4fa
 
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel ChambaB4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
b4fa
 
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia CanalesB4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
b4fa
 
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko AsanteB4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
b4fa
 
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
b4fa
 
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George AmeyawB4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
b4fa
 
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris LeaverB4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
b4fa
 
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex AbutuB4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
b4fa
 
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi DanquahB4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
b4fa
 
B4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie JonesB4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie Jones
b4fa
 
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie JonesB4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
b4fa
 
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel OtungeB4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
b4fa
 
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
b4fa
 

More from b4fa (20)

B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon SchmickleB4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
 
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph KithamaB4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
 
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon SchmickleB4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
 
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon SchmickleB4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
 
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel OtungeB4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
 
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
 
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth DansoB4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
 
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul AsareB4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
 
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel ChambaB4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
 
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia CanalesB4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
 
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko AsanteB4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
 
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
 
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George AmeyawB4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
 
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris LeaverB4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
 
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex AbutuB4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
 
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi DanquahB4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
 
B4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie JonesB4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie Jones
 
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie JonesB4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
 
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel OtungeB4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
 
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
 

Recently uploaded

Shallowest Oil Discovery of Turkiye.pptx
Shallowest Oil Discovery of Turkiye.pptxShallowest Oil Discovery of Turkiye.pptx
Shallowest Oil Discovery of Turkiye.pptx
Gokturk Mehmet Dilci
 
Immersive Learning That Works: Research Grounding and Paths Forward
Immersive Learning That Works: Research Grounding and Paths ForwardImmersive Learning That Works: Research Grounding and Paths Forward
Immersive Learning That Works: Research Grounding and Paths Forward
Leonel Morgado
 
GBSN - Biochemistry (Unit 6) Chemistry of Proteins
GBSN - Biochemistry (Unit 6) Chemistry of ProteinsGBSN - Biochemistry (Unit 6) Chemistry of Proteins
GBSN - Biochemistry (Unit 6) Chemistry of Proteins
Areesha Ahmad
 
Equivariant neural networks and representation theory
Equivariant neural networks and representation theoryEquivariant neural networks and representation theory
Equivariant neural networks and representation theory
Daniel Tubbenhauer
 
Authoring a personal GPT for your research and practice: How we created the Q...
Authoring a personal GPT for your research and practice: How we created the Q...Authoring a personal GPT for your research and practice: How we created the Q...
Authoring a personal GPT for your research and practice: How we created the Q...
Leonel Morgado
 
Eukaryotic Transcription Presentation.pptx
Eukaryotic Transcription Presentation.pptxEukaryotic Transcription Presentation.pptx
Eukaryotic Transcription Presentation.pptx
RitabrataSarkar3
 
11.1 Role of physical biological in deterioration of grains.pdf
11.1 Role of physical biological in deterioration of grains.pdf11.1 Role of physical biological in deterioration of grains.pdf
11.1 Role of physical biological in deterioration of grains.pdf
PirithiRaju
 
Katherine Romanak - Geologic CO2 Storage.pdf
Katherine Romanak - Geologic CO2 Storage.pdfKatherine Romanak - Geologic CO2 Storage.pdf
Katherine Romanak - Geologic CO2 Storage.pdf
Texas Alliance of Groundwater Districts
 
THEMATIC APPERCEPTION TEST(TAT) cognitive abilities, creativity, and critic...
THEMATIC  APPERCEPTION  TEST(TAT) cognitive abilities, creativity, and critic...THEMATIC  APPERCEPTION  TEST(TAT) cognitive abilities, creativity, and critic...
THEMATIC APPERCEPTION TEST(TAT) cognitive abilities, creativity, and critic...
Abdul Wali Khan University Mardan,kP,Pakistan
 
The debris of the ‘last major merger’ is dynamically young
The debris of the ‘last major merger’ is dynamically youngThe debris of the ‘last major merger’ is dynamically young
The debris of the ‘last major merger’ is dynamically young
Sérgio Sacani
 
molar-distalization in orthodontics-seminar.pptx
molar-distalization in orthodontics-seminar.pptxmolar-distalization in orthodontics-seminar.pptx
molar-distalization in orthodontics-seminar.pptx
Anagha Prasad
 
Compexometric titration/Chelatorphy titration/chelating titration
Compexometric titration/Chelatorphy titration/chelating titrationCompexometric titration/Chelatorphy titration/chelating titration
Compexometric titration/Chelatorphy titration/chelating titration
Vandana Devesh Sharma
 
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...
Advanced-Concepts-Team
 
aziz sancar nobel prize winner: from mardin to nobel
aziz sancar nobel prize winner: from mardin to nobelaziz sancar nobel prize winner: from mardin to nobel
aziz sancar nobel prize winner: from mardin to nobel
İsa Badur
 
Direct Seeded Rice - Climate Smart Agriculture
Direct Seeded Rice - Climate Smart AgricultureDirect Seeded Rice - Climate Smart Agriculture
Direct Seeded Rice - Climate Smart Agriculture
International Food Policy Research Institute- South Asia Office
 
23PH301 - Optics - Optical Lenses.pptx
23PH301 - Optics  -  Optical Lenses.pptx23PH301 - Optics  -  Optical Lenses.pptx
23PH301 - Optics - Optical Lenses.pptx
RDhivya6
 
HOW DO ORGANISMS REPRODUCE?reproduction part 1
HOW DO ORGANISMS REPRODUCE?reproduction part 1HOW DO ORGANISMS REPRODUCE?reproduction part 1
HOW DO ORGANISMS REPRODUCE?reproduction part 1
Shashank Shekhar Pandey
 
ESR spectroscopy in liquid food and beverages.pptx
ESR spectroscopy in liquid food and beverages.pptxESR spectroscopy in liquid food and beverages.pptx
ESR spectroscopy in liquid food and beverages.pptx
PRIYANKA PATEL
 
Micronuclei test.M.sc.zoology.fisheries.
Micronuclei test.M.sc.zoology.fisheries.Micronuclei test.M.sc.zoology.fisheries.
Micronuclei test.M.sc.zoology.fisheries.
Aditi Bajpai
 
20240520 Planning a Circuit Simulator in JavaScript.pptx
20240520 Planning a Circuit Simulator in JavaScript.pptx20240520 Planning a Circuit Simulator in JavaScript.pptx
20240520 Planning a Circuit Simulator in JavaScript.pptx
Sharon Liu
 

Recently uploaded (20)

Shallowest Oil Discovery of Turkiye.pptx
Shallowest Oil Discovery of Turkiye.pptxShallowest Oil Discovery of Turkiye.pptx
Shallowest Oil Discovery of Turkiye.pptx
 
Immersive Learning That Works: Research Grounding and Paths Forward
Immersive Learning That Works: Research Grounding and Paths ForwardImmersive Learning That Works: Research Grounding and Paths Forward
Immersive Learning That Works: Research Grounding and Paths Forward
 
GBSN - Biochemistry (Unit 6) Chemistry of Proteins
GBSN - Biochemistry (Unit 6) Chemistry of ProteinsGBSN - Biochemistry (Unit 6) Chemistry of Proteins
GBSN - Biochemistry (Unit 6) Chemistry of Proteins
 
Equivariant neural networks and representation theory
Equivariant neural networks and representation theoryEquivariant neural networks and representation theory
Equivariant neural networks and representation theory
 
Authoring a personal GPT for your research and practice: How we created the Q...
Authoring a personal GPT for your research and practice: How we created the Q...Authoring a personal GPT for your research and practice: How we created the Q...
Authoring a personal GPT for your research and practice: How we created the Q...
 
Eukaryotic Transcription Presentation.pptx
Eukaryotic Transcription Presentation.pptxEukaryotic Transcription Presentation.pptx
Eukaryotic Transcription Presentation.pptx
 
11.1 Role of physical biological in deterioration of grains.pdf
11.1 Role of physical biological in deterioration of grains.pdf11.1 Role of physical biological in deterioration of grains.pdf
11.1 Role of physical biological in deterioration of grains.pdf
 
Katherine Romanak - Geologic CO2 Storage.pdf
Katherine Romanak - Geologic CO2 Storage.pdfKatherine Romanak - Geologic CO2 Storage.pdf
Katherine Romanak - Geologic CO2 Storage.pdf
 
THEMATIC APPERCEPTION TEST(TAT) cognitive abilities, creativity, and critic...
THEMATIC  APPERCEPTION  TEST(TAT) cognitive abilities, creativity, and critic...THEMATIC  APPERCEPTION  TEST(TAT) cognitive abilities, creativity, and critic...
THEMATIC APPERCEPTION TEST(TAT) cognitive abilities, creativity, and critic...
 
The debris of the ‘last major merger’ is dynamically young
The debris of the ‘last major merger’ is dynamically youngThe debris of the ‘last major merger’ is dynamically young
The debris of the ‘last major merger’ is dynamically young
 
molar-distalization in orthodontics-seminar.pptx
molar-distalization in orthodontics-seminar.pptxmolar-distalization in orthodontics-seminar.pptx
molar-distalization in orthodontics-seminar.pptx
 
Compexometric titration/Chelatorphy titration/chelating titration
Compexometric titration/Chelatorphy titration/chelating titrationCompexometric titration/Chelatorphy titration/chelating titration
Compexometric titration/Chelatorphy titration/chelating titration
 
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...
 
aziz sancar nobel prize winner: from mardin to nobel
aziz sancar nobel prize winner: from mardin to nobelaziz sancar nobel prize winner: from mardin to nobel
aziz sancar nobel prize winner: from mardin to nobel
 
Direct Seeded Rice - Climate Smart Agriculture
Direct Seeded Rice - Climate Smart AgricultureDirect Seeded Rice - Climate Smart Agriculture
Direct Seeded Rice - Climate Smart Agriculture
 
23PH301 - Optics - Optical Lenses.pptx
23PH301 - Optics  -  Optical Lenses.pptx23PH301 - Optics  -  Optical Lenses.pptx
23PH301 - Optics - Optical Lenses.pptx
 
HOW DO ORGANISMS REPRODUCE?reproduction part 1
HOW DO ORGANISMS REPRODUCE?reproduction part 1HOW DO ORGANISMS REPRODUCE?reproduction part 1
HOW DO ORGANISMS REPRODUCE?reproduction part 1
 
ESR spectroscopy in liquid food and beverages.pptx
ESR spectroscopy in liquid food and beverages.pptxESR spectroscopy in liquid food and beverages.pptx
ESR spectroscopy in liquid food and beverages.pptx
 
Micronuclei test.M.sc.zoology.fisheries.
Micronuclei test.M.sc.zoology.fisheries.Micronuclei test.M.sc.zoology.fisheries.
Micronuclei test.M.sc.zoology.fisheries.
 
20240520 Planning a Circuit Simulator in JavaScript.pptx
20240520 Planning a Circuit Simulator in JavaScript.pptx20240520 Planning a Circuit Simulator in JavaScript.pptx
20240520 Planning a Circuit Simulator in JavaScript.pptx
 

B4FA 2012 Nigeria: Plants and Agriculture - Wayne Powell

  • 3. Agriculture the most important event in human history ‘The original biotechnology, fundamental to culture, health, quality environment & biodiversity.’
  • 4. Agriculture is at the Center of Many of Society’s Most Important Debates Exciting time for Agriculture & Plant Breeding • Global food security •Enhanced productivity •Increased yield •Sustainable production • Water availability •Drought-tolerant crops • Biofuels •Yield technologies to help meet demand for both food and fuel • Global warming •CO2 footprint •Fertilizer use
  • 5.
  • 6. Holistic Research “No matter how excellent the research done in one scientific discipline is, its application in isolation will have little positive effect on crop production. What is needed are venturesome scientists who can work across disciplines to produce appropriate technologies and who have the courage to make their case with political leaders to bring these advances to fruition. ” Norman E. Borlaug
  • 7.
  • 8. Doubly Green Revolution • The aim •repeat the success of the Green Revolution •on a global scale to include Africa!! •in many diverse localities • and be •equitable •sustainable •and environmentally friendly
  • 9. sunlight plants plant power science Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
  • 10. fossil reserves biorenewables oil...refineries bio...refineries CHEMICALS MATERIALS FUELS yesterday today and tomorrow sunlight plant biomass a solar energy source for manufacturing
  • 11. Agriculture critical to the future of our planet and humanity •FOOD, •FEED, •FUEL •CHEMICALS
  • 12.
  • 13. Daily calorie intake in developing world Rice 45% Wheat 29% Maize 11% Cassava 3% Sorghum 2% Potato 2% Sweet potato 2% Millet 2% Soybean 2% Bean 1%
  • 14.
  • 15.
  • 16. Courtesy Tobert Rocheford and Catherine Bermudez Kandianis Keith Weller Doug Wilson Scott Bauer Keith Weller
  • 17. •DuPont Food security index http://foodsecurity.eiu.com •Father Green revolution: Norman Borlaug. •Civilization founded on crops •Importance of diversity
  • 18. Charles Darwin Evolution is driven by natural selection
  • 19. Darwin’s mentor Great Teachers often feature in the development of Great People!
  • 20. Fundamental role of Diversity & Selection Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
  • 21. Selective breeding is a powerful tool ESEB Congress, Uppsala, Sweden, August 2007
  • 22. Domestication traits: traits that distinguish seed & fruit crops from their progenitors
  • 23. Vavilov 1887-1943 •Soviet botanist & geneticist •Discovered and identified centres of origin/cultivated plants •Criticised the non- Mendelian concepts of Lysenko •Arrested in 1940, died of malnutrition in prison in 1943.
  • 24. Crop origins and diversification: multiple births Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
  • 25. Little overlap between centres of origin & today’s productive agriculture. ESEB Congress, Uppsala, Sweden, August 2007 Nature Vol 418, 700-707
  • 26. Why is this important? Nature Vol 418, 700-707
  • 27. Drought in Africa between now and 2090 Red, Orange = More prone to drought Blue = Wetter and less prone to drought Hadley Centre, Met Office, UK
  • 28. Crop Biodiversity The Seed Vault at Svalbard Global Crop Diversity Trust
  • 30. Maize
  • 33. Distribution of Miscanthus Species after Hodkinson & Renvoize et al. 2001 N 55° N 24° S 9°
  • 34. China Japan Taiwan IGER’s hunt for Asian elephant grass http://www.iger.bbsrc.ac.uk/News/9march2007miscanthus.htm
  • 35. Crossing • Hybridisation Strategy • 2n M. sinensis x 2n M. sinensis from wide geographical origins • 4n M. sacchariflorus x 2n M. sinensis to produce 3n M. x giganteus types
  • 37. Diverse Genetic Pool Increases Depth and Breadth of Germplasm • Increased Yield • Disease Resistance • Stress Tolerance • Grain Quality / Added Value • Build on strength of current germplasm as well as Molecular Breeding and Crop Analytics Capabilities
  • 39. Serendipity Natural Hybridisation Many modern crop species are the result of ancient (or recent) hybridisation events. Cotton Wheat Oilseed Rape Maize
  • 40. Wheat a classic allo-hexaploid ESEB Congress, Uppsala, Sweden, August 2007 Science Vol 316, 1862-1866
  • 41.
  • 42. Wheat a classic allo-hexaploid ESEB Congress, Uppsala, Sweden, August 2007
  • 43. The New Rice for Africa Monty Jones 2004
  • 44. • Organisation and importance of Diversity • Selection is a powerful tool but need to understand & know what to select for. • Importance engagement. – Journalists to articulate and sell stories!
  • 45. Breeding major technology platform for food, water & energy security Next steps ? Proteomics Genomics Analytical Technology Transgenic Traits Molecular Engineering Winter Nurseries Computer Technology Plot Mechanisation Quantitative Genetics Statistics Pedigree Breeding Hybridisation Open Pollinated Selection GermplasmImprovement (HigherSustainableYields) Time Plant Breeders use any combination of these technologies to develop enhanced products for customers, and continue to explore technologies to enhance this process New Opportunities for Agriculture
  • 46.
  • 47. F1 Hybrids ESEB Congress, Uppsala, Sweden, August 2007
  • 48. Hybrid vrs Open pollinated maize On the right a new, hybrid maize variety developed by CIMMYT with PASS funding. On the left, a local landrace variety
  • 49. To put your footer here go to View > Header and Footer 49 USA: Historic Maize Yields Yield (tonnes/ha) 6 5 4 3 2 1 0 1875 1925 1975
  • 50. Gregor Johann Mendel, (b. 22 July 1822; d. 6 January 1884) Moravia, Austro-Hungarian Empire Originator of the concept of the gene (autosomal inheritance) Birthplace of Modern Genetic Analysis Augustinian monastry garden, St. Thomas, Brünn, Austria Brno (Czech Rep.) Experimemts, 1856-1870
  • 51. A pea flower with the keel cut and opened to expose the reproductive parts
  • 52. The seven character differences studied by Mendel
  • 53. purple-flowered (f) x white flowered (m)
  • 54.
  • 55. May 2000 Life Science Companies SeedCompanies Joint Ventures Cooperatives Other Companies GarstGarstSeed Co.Seed Co. December 1997 20% Equity ExSeedExSeedGenetics LLCGenetics LLC AstraZeneca PLC United Kingdom Mogen International NVMogen International NV The Netherlands Cooperatie CosunCooperatie CosunUA UA The Netherlands InterstateInterstatePayco Payco August 1996 50% Equity August 1996 50% Equity June 1997 $78 M 100% Equity 100%Equity August 1996 100%Equity August 1996 100%Equity Advanta BVAdvanta BV The Netherlands RoyalVanderHaveRoyalVanderHaveThe Netherlands KoipesolKoipesol//AgrosemAgrosem//AgraAgra Spain ItalyFrance ZimmermanZimmerman Hybrids, Inc.Hybrids, Inc. 1998 100%Equity France April 1998 100%Equity November 1998 50% Equity Land O’ Lakes November 1998 50% Equity December 1998 40% Equity August 1998 100%Equity July 1999 100%Equity July 1999 80% Equity U.S. CooperativeU.S. Cooperative System:System:CroplanCroplanGenetics, FFR,Genetics, FFR, GrowMarkGrowMark, etc., etc. Wilson Seeds, Inc.Wilson Seeds, Inc. Sturdy Grow Hybrids, Inc.Sturdy Grow Hybrids, Inc. MaisadourMaisadourSemencesSemencesSASA Novartis AGNovartis AG (SyngentaAG) Switzerland AgritradingAgritradingItaly EridaniaEridaniaBeghinBeghin-Say-Say France July 1999 20% Equity SyngentaSyngenta AGAGDiversa Corp.Diversa Corp. CalgeneCalgene, Inc., Inc. July 1996 100%Equity May 1998 $100 M50% Equity Joint Venture 1982 100%Equity AgriProAgriProSeedSeed WheatWheatDivisionDivision Cargill Hybrid SeedsCargill Hybrid Seeds North AmericaNorth America May 1998 $100 M50% Equity Joint Venture HybriTechHybriTechEurope SAEurope SA France February 1996 90% Equity February 1996 10% Equity PauPauEuralisEuralisFrance CargillCargill, Inc., Inc. RenessenRenessen Cargill’sCargill’sInternationalInternational Seed DivisionSeed Division Corn States Hybrid Service, Inc.Corn States Hybrid Service, Inc. Corn States InternationalCorn States InternationalSarlSarl.. AsgrowSeedAsgrowSeed Company LLCCompany LLC July 1998 $525 M100%Equity July 1998 $1.4 B(est) March 1996 $1.2 B 40% Equity May 1998 $2.5 B 100%Equity Total cost $3.7 Billion November 1996 $240 M100%Equity January 1997 $1.02 B 100% Equity November 1997 $150 M100%Equity April 1996 $30 M 50%Equity November 1996 $50 M 5% Equity May 1997 $242 M45% Equity Total cost $322 Million April 1996 $150 M100%Equity November 1997 JV with FT Sementes June 1998 DeKalb GeneticsDeKalb Genetics CorporationCorporation AgracetusAgracetus, Inc., Inc. Plant BreedingPlant Breeding InternationalInternational Cambridge,Cambridge,LtdLtd.. United Kingdom First Line Seeds,First Line Seeds,LtdLtd.. Canada MonsoyMonsoy Brazil JacobJacobHartzHartz Seed Co., Inc.Seed Co., Inc. 1983 100%Equity Holden’sHolden’s FoundationFoundation SeedsSeeds Monsanto/ Pharmacia Monsanto/ Pharmacia Sementes AgroceresSementes AgroceresSASA Brazil HybriTechHybriTechSeedSeed Int’l., Inc.Int’l., Inc. CustomFarm SeedCustom Farm Seed July 1997 CereonCereon Mendel BiotechMendel Biotech ParadigmGeneticsParadigmGenetics March 1999 16.4% Equity UnitedUnitedAgriseedsAgriseeds, Inc., Inc. Morgan SeedsMorgan Seeds Argentina AdvancedAdvancedAgriTraitsAgriTraits December 1996 $9.4 M18.75% Equity March 1999 83.6% Equity March 1999 $15 M 25% Equity April 1998 $32 M 100%Equity September 1996 $34.6 M 100%Equity February 1996 $72 M 100%Equity September 1998 100%Equity October 1998 $322 M100%Equity MycogenMycogen CorporationCorporation Illinois Foundation Seed, Inc.Illinois Foundation Seed, Inc. Dow Agrosciences Dow Agrosciences VerneuilVerneuil Holding SAHolding SA France HibridosHibridosColoradoColoradoLtdaLtda FTFTBiogeneticsBiogeneticsdedeMilho LtdaMilho Ltda Brazil DinamilhoDinamilhoCarolCarol Productos Agricolas LtdaProductos Agricolas Ltda Brazil Large Scale Biology (BioSource)Large Scale Biology (BioSource) DiversaDiversa) BayerBayerParadigm Incyte LION Exelixis BASFBASF Lynx Lexicon Incyte Exelixis Ag Chem & Seed Industry December 1999 24% Equity 1993 80% Equity December 1999 76% Equity March 1998 50% Equity March 1998 50% Equity 12% Equity BiotechnicaBiotechnica International, Inc./International, Inc./ LG SeedsLG Seeds Akin Seed Co.Akin Seed Co. CallahanCallahan SeedsSeeds October 1993 80% Equity March 1994 100%Equity July 1994 85% Equity June 1994 100%Equity October 1990 100%Equity 99% Equity 1997 55% Equity Aventis CropScienceAventis CropScience AgrEvoAgrEvo Aventis SAAventis SA France ScheringScheringAGAG Germany 1997 25% Equity KWSKWS SaatSaat Mais AngevinMais Angevin France BiogemmaBiogemma France RhoBioRhoBioFrance France PauPau EuralisEuralis France NickersonNickerson SeedsSeeds United Kingdom Great LakesGreat Lakes Hybrids, Inc.Hybrids, Inc. Canada KingKingAgroAgroInc.Inc. Canada GroupeGroupe LimagrainLimagrain France ProagroGroupProagroGroup India Plant Genetic SystemsPlant Genetic Systems International (PGS)International (PGS) February 1999 100%Equity August 1996 75% Equity- $550M Germany Sementes Ribeiral LtdaSementes Ribeiral Ltda.. Sementes Fartura LtdaSementes Fartura Ltda Mitla Pesquisa Agricola LtdaMitla Pesquisa Agricola Ltda Brazil July 1999 100%Equity Plantec BiotechnologiePlantec Biotechnologie Germany 1996 95% Equity 15% Equity Nidera SemillasNidera Semillas Argentina Pending Up to 25% Equity Agritope/Agrinomics Diversa Brazil DoisDois MarcosMarcos March 1999 100%Equity Protein TechnologiesProtein Technologies InternationalInternational December 1997 $1.5 B100%Equity OptimumQualityOptimumQuality Grains, LLCGrains, LLC HybrinovaHybrinovaSASA April 1998 100%Equity August 1997 50% Equity E.I. DuPont deE.I. DuPont de Nemours & Co.Nemours & Co. Pioneer Hi-Bred International, Inc. Pioneer Hi-BredPioneer Hi-Bred International, Inc.International, Inc. October 1999 100%Equity August 1997 50% Equity Lynx OGS AffymetrixCuraGen Maxygen
  • 56. Importance Genetics Market Identification by Trait, Crop, species Transgenic Plant Development Cell Culture Molecular Biology Genetics Variety Development Yield Trials Product Testing Products Genetic diversity Analytical Screens Biochemistry Germplasm Development Traditional & Molecular Breeding Genetics Molecular Genetics • 24 ABI 377 Automated sequencers • 20,000 Lane per week capacity Gene Discovery Plant Biology Genomics
  • 57. Genetic software & Hardware
  • 58. ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW BREEDING Strategically breed plants to create new, more robust seeds that perform better – and longer – in the field. AGRONOMICS Use precision ag, planting density, plant health protection, and conservation tillage to make acres more productive. BIOTECHNOLOGY Supplement breeding advancements by adding special beneficial genes to the plant. “The Three Pillars of Yield”
  • 59. Wamalwa Farm, Siritanyi FFS, Kanduyi. Maize-groundnut intercrop providing 5330 kg maize and 1203 kg groundnut per ha. These results indicate that MBILI can produce significant food surpluses. Rasike Farm, Chililila WG. MBILI maize-soyabean intercrop providing 1215 kg maize and 545 kg soyabean per ha when conventional intercrops failed. These results indicate that MBILI is a means toward greater food security.
  • 60. Feeding future populations means doubling the productivity of neglected but nutritious crops such as yams and green bananas
  • 61. “Selection works.” JW Dudley Crop Sci (2007) 47(S3)S20–S31
  • 62. Eco-systems based approach to plant breeding
  • 63. Grass crop domestication – increasing forage quality (Mean WSC over 5 years data) Cultivar Mean Water Soluble Carbohydrate Content S23 17.1% AberDart 20.6% AberAvon 20.6% AberStar 21.5% AberMagic 23.7%
  • 64. High sugar ryegrass (Environmental/ Quality Trait) Economic benefits – live weight gain Environmental benefits – reduced diffuse pollution - reduced GHG emissions
  • 65. New traits-new sources genetic diversity Redirection of metabolic hydrogen Methods of methane mitigation: Feed CH4 CO2 Methanogens Protozoa Microbial cells
  • 66. Science has provided the key to unlocking the potential of food Sugar keeps sheep happy, and has revolutionised food production, says Steve Jones. Steve Jones is professor of genetics at University College London
  • 67. Conversion of high sugar grasses to alcohol based transport fuel Image courtesy of Steve Martin, TMO Renewables Harvest Primary Processing (screw press) Juice Fibre Fermentation Digestion Co-Products Co-Products Ethanol potential: ~ 5000 litres/Ha/yr Ethanol potential: ~ 5000 litres/Ha/yr Alternative uses Alternative uses Single enzyme
  • 68. Natural Products Biotransformation & composites Biorefining Centre of Excellence
  • 69. The Life sciences revolution Molecular biology Computer science Mathematics Exciting time Unlocking the genetic potential of the biosphere Sustainable food production Plant Breeding
  • 70. ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTA TGGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTAC CGCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCT TCTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA DNA – a common language across living organisms in the biosphere genome programmes link understanding of biology to agriculture implications for: - forestry - aquaculture - livestock - arable Contemporary Science
  • 71. Democratisation genomics Roche 454: Metagenomics, amplicon sequencing, BAC sequencing Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for amplicons, small genomes, focused GBS and pilot experiments Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes
  • 72. Genes provide the foundation of new products for farmers biomass utility? improved agronomy? tolerance to cold? yield? tolerance to drought? flowering time? Genes Protein Trait Product
  • 73. Marker- Aided Selection • Locating and tagging the genes for drought tolerance
  • 75. Genomics and the People Century Genomics-based research will make a difference but only if there is integration across social & natural sciences.
  • 76. Iowa maize yield 61-90; 90-08 1960 1970 1980 1990 2000 2010 0 3 6 9 12 b=95 kg/ha/yr R2 =0.51*** b=206 kg/ha/yr R2 =0.61*** Year Maizeyield(t/ha) GMOs
  • 77. US maize yields still rising – why? -1.0 -0.5 0.0 0.5 1.0 1.5 2.0 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 Source: Defra & USDA t/ha
  • 78. 78 Scarcity The green revolution Set aside, CAP changesSubsidy and Surplus Security Set Aside Biofuels Food Prices Food Security
  • 79. 79 Energy Climate Change Water (the new oil) Food Security Diet and Health < 1000 1000 - 2000 > 2000 Estimated global water scarcity in 2050 (from Wallace, 2000) per capita annual renewable freshwater resource (m3/person/year).
  • 80. sunlight plants plant biodiversity science Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
  • 81. Sydney Brenner “Which type of science to fund is simple: all science is problem driven and should be judged by the importance of the problem and the quality of the solutions provided.” A Life in Science
  • 82. In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating Ability to Realize Step-Change Improvements Reference genomes for each crop Genomes targeted for specific traits (disease) Genome for every yield plot GENOMES/YEAR
  • 83. In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating Ability to Realize Step-Change Improvements Reference genomes for each crop Genomes targeted for specific traits (disease) Genome for every yield plot GENOMES/YEAR
  • 84. Meeting the Demands of a Growing Global Market • World population continues to increase • Per capita food consumption continues to rise • Consumers continue to demand improved taste, convenience, and nutrition GROWING WORLD POPULATION (B) Source: FAO, WHO RISING CEREAL DEMAND (MMT) 1 2 3 4 5 6 7 8 9 1981 1999 2015 2030 500 1000 1500 2000 2500 3000 1981 1999 2015 2030 TRANSITION NATIONS DEVELOPED NATIONS DEVELOPING NATIONS “To feed the eight billion people expected by 2025, the world will have to double food production…” CSIS - Seven Revolutions
  • 85. Growth rates due to early years of the Green Revolution (1961-1980) 0 0.5 1 1.5 2 2.5 3 3.5 Latin America Asia Middle East Africa Other inputs Cultivars
  • 86. Growth rates due to late years of the Green Revolution (1981-2000) -0.5 0 0.5 1 1.5 2 2.5 Latin America Asia Middle East Africa Other inputs Cultivars
  • 87. Public good plant breeding requiresPublic good plant breeding requires introduction of new sources diversityintroduction of new sources diversity DiversityDiversity BreedingBreeding MethodologyMethodology Traits &Traits & ProductsProducts OatsOats Forage grassesForage grasses Turf grassTurf grass LegumesLegumes MiscanthusMiscanthus New Opportunities but also complexityNew Opportunities but also complexity
  • 88. Performance under farmers’ conditions and farmers’ acceptance Participatory maize breeding in Africa • Prioritize most important stresses under farmers’ conditions • Manage trials on experiment station and evaluate large numbers of cultivars, • Select the best, and … • Involve farmers – Mother trials in center of farming community grown under best-bet input conditions – Farmer-representative input conditions – Farmer-managed baby trials • Partnership with extension, NGOs, rural schools, and farmer associations The Mother / Baby trial design Collaborative, on-farm evaluation of maize cultivars
  • 91. Ghana’s Success Story • MDG 1 achieved • Malnourished - 5.8m in 1993 to 2.7 m in 2003. • Declines in % underweight children and mortality • Strong agricultural growth since 80s • 25% increase due to area expansion • Maize yield up by 36%, cassava by 50% • New maize, yam, rice and cassava varieties • A pest resistant cassava. • Strong growth in smallholder cocoa & pineapples • Market liberalisation • New rural infrastructure Sources: Development Outreach, October, 08;Coulombe & Wodon, World Bank; Irish Hunger Report
  • 92. All this is threatened by Climate Change • Higher temperatures • Greater & more intense rainfall • Greater droughts • River bank erosion • Rising sea levels • More intense cyclones • Salt water incursions
  • 93. biology is the science of thebiology is the science of the natural world & critical to thenatural world & critical to the future of agriculture.future of agriculture. ‘all life depends on sunlight and a green leaf’
  • 94. The biosphere – nature’s solutions
  • 95. Separate Niches Source: Naylor R. and Battisti D. 2008 (pers comm) Source: Global Biodiversity Trust
  • 96.
  • 97. Maize has more molecular diversity than humans and apes combined Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001) 1.34% 0.09% 1.42%
  • 98. Selective Breeding is a Powerful Tool Picture courtesy of Roslin Institute
  • 99. Projected losses of food caused by the adverse effects of climate change (2080)
  • 100. The idea of blending inheritance Spermatozoon and egg contained essences from various parts of the body; at conception, these essences somehow blended to form a pattern for the new individual Ideas in Science come in fashions called paradigms
  • 101. Reasons for choosing to study garden pea • No morals involved • Can be grown in a small area • Produce lots of offspring • Easily identifiable traits • Produce true-to-type when allowed to self- pollinate over several generations • Can be artificially cross- pollinated
  • 102. Summary and conclusions of Mendel’s experiments •After crossing pure parental strains, the F1 produced 100% of one character. •After self-pollinating the F1, both characters showed up in a 3:1 ratio. •Because the same types of ratio kept coming up, Mendel believed that there must be some mathematical formula or explanation for the observed data •The first assumption made by Mendel was that there must be a ”pair of factors” that controls the trait in pea plant. This “pair of factors” idea helped him formulate his principles