SlideShare a Scribd company logo
1 of 76
Plants & Agriculture
IBERS, Aberystwyth
Public Good Plant Breeding
Agriculture the most important event
in human history
‘The original biotechnology, fundamental to culture, health,
quality environment & biodiversity.’
Agriculture is at the Center of Many of Society’s
Most Important Debates
Exciting time for Agriculture & Plant Breeding
• Global food security
•Enhanced productivity
•Increased yield
•Sustainable production
• Water availability
•Drought-tolerant crops
• Biofuels
•Yield technologies to help meet
demand for both food and fuel
• Global warming
•CO2 footprint
•Fertilizer use
Holistic Research
“No matter how excellent the
research done in one scientific
discipline is, its application in
isolation will have little positive
effect on crop production. What
is needed are venturesome
scientists who can work across
disciplines to produce
appropriate technologies and
who have the courage to make
their case with political leaders
to bring these advances to
fruition. ”
Norman E. Borlaug
Doubly Green Revolution
• The aim
•repeat the success of the Green
Revolution
•on a global scale to include
Africa!!
•in many diverse localities
• and be
•equitable
•sustainable
•and environmentally friendly
sunlight
plants
plant power
science Agriculture, Land
Use & Society
Plants provide sustainable solutions
‘ultimate green & clean technology’
fossil reserves biorenewables
oil...refineries bio...refineries
CHEMICALS MATERIALS FUELS
yesterday today and tomorrow
sunlight
plant biomass
a solar energy source for manufacturing
Agriculture critical to the future of
our planet and humanity
•FOOD,
•FEED,
•FUEL
•CHEMICALS
Daily calorie intake in developing world
Rice 45%
Wheat 29%
Maize 11%
Cassava 3%
Sorghum 2%
Potato 2%
Sweet potato 2%
Millet 2%
Soybean 2%
Bean 1%
Courtesy Tobert Rocheford and
Catherine Bermudez Kandianis
Keith Weller
Doug Wilson
Scott Bauer
Keith Weller
•DuPont Food security index
http://foodsecurity.eiu.com
•Father Green revolution: Norman
Borlaug.
•Civilization founded on crops
•Importance of diversity
Charles Darwin
Evolution is driven by natural selection
Darwin’s mentor
Great Teachers often feature in the development of Great People!
Fundamental role of Diversity &
Selection
Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835
ESEB Congress, Uppsala,
Sweden, August 2007
Selective breeding is a powerful tool
ESEB Congress, Uppsala,
Sweden, August 2007
“Selection works.”
JW Dudley Crop Sci (2007) 47(S3)S20–S31
Eco-systems based approach to
plant breeding
Grass crop domestication – increasing
forage quality
(Mean WSC over 5 years data)
Cultivar Mean Water Soluble
Carbohydrate Content
S23 17.1%
AberDart 20.6%
AberAvon 20.6%
AberStar 21.5%
AberMagic 23.7%
High sugar ryegrass (Environmental/ Quality Trait)
Economic benefits – live weight gain
Environmental benefits – reduced diffuse pollution
- reduced GHG emissions
New traits-new sources genetic diversity
Redirection of metabolic hydrogen
Methods of methane mitigation:
Feed
CH4
CO2
Methanogens
Protozoa
Microbial cells
Science has provided the
key to unlocking the
potential of food
Sugar keeps sheep happy, and has
revolutionised food production, says
Steve Jones.
Steve Jones is professor of genetics at University College London
Conversion of high sugar
grasses to alcohol based
transport fuel
Image courtesy of Steve Martin, TMO Renewables
Harvest
Primary
Processing
(screw press)
Juice
Fibre
Fermentation
Digestion
Co-Products
Co-Products
Ethanol potential:
~ 5000 litres/Ha/yr
Ethanol potential:
~ 5000 litres/Ha/yr
Alternative
uses
Alternative
uses
Single enzyme
Natural Products Biotransformation &
composites
Biorefining Centre of Excellence
Vavilov 1887-1943
•Soviet botanist & geneticist
•Discovered and identified
centres of origin/cultivated
plants
•Criticised the non-
Mendelian concepts of
Lysenko
•Arrested in 1940, died of
malnutrition in prison in
1943.
Crop origins and diversification: multiple births
Science 316, 1830-1835
ESEB Congress, Uppsala,
Sweden, August 2007
Little overlap between centres of origin & today’s
productive agriculture.
ESEB Congress, Uppsala,
Sweden, August 2007
Nature Vol 418, 700-707
Why is this important?
Nature Vol 418, 700-707
Drought in Africa between now and 2090
Red, Orange =
More prone to
drought
Blue =
Wetter and less
prone to
drought
Hadley Centre, Met Office, UK
Crop Biodiversity
The Seed Vault at Svalbard
Global Crop Diversity Trust
Serendipity Natural Hybridisation
Many modern crop species are the result of ancient (or
recent) hybridisation events.
Cotton
Wheat
Oilseed Rape
Maize
Wheat a classic allo-hexaploid
ESEB Congress, Uppsala,
Sweden, August 2007
Science Vol 316, 1862-1866
Wheat a classic allo-hexaploid
ESEB Congress, Uppsala,
Sweden, August 2007
The New Rice for Africa
Monty Jones
2004
• Organisation and importance of Diversity
• Selection is a powerful tool but need to
understand & know what to select for.
• Importance engagement.
– Journalists to articulate and sell stories!
Breeding major technology platform for
food, water & energy security
Next steps ?
Proteomics
Genomics
Analytical Technology
Transgenic Traits
Molecular Engineering
Winter Nurseries
Computer Technology
Plot Mechanisation
Quantitative Genetics
Statistics
Pedigree Breeding
Hybridisation
Open Pollinated Selection
GermplasmImprovement
(HigherSustainableYields)
Time
Plant Breeders use any
combination of these technologies
to develop enhanced products for
customers, and continue to
explore technologies to enhance
this process
New Opportunities for Agriculture
The Life sciences revolution
Molecular biology
Computer science
Mathematics
Exciting time
Unlocking the genetic potential
of the biosphere
Sustainable food
production
Plant
Breeding
May 2000
Life Science Companies
SeedCompanies
Joint Ventures
Cooperatives
Other Companies
GarstGarstSeed Co.Seed Co.
December 1997
20% Equity
ExSeedExSeedGenetics LLCGenetics LLC
AstraZeneca
PLC
United Kingdom
Mogen International NVMogen International NV
The Netherlands
Cooperatie CosunCooperatie CosunUA UA
The Netherlands
InterstateInterstatePayco Payco
August 1996
50% Equity
August 1996
50% Equity
June 1997
$78 M 100% Equity
100%Equity
August 1996
100%Equity
August 1996
100%Equity
Advanta BVAdvanta BV
The Netherlands
RoyalVanderHaveRoyalVanderHaveThe Netherlands
KoipesolKoipesol//AgrosemAgrosem//AgraAgra
Spain ItalyFrance
ZimmermanZimmerman
Hybrids, Inc.Hybrids, Inc.
1998
100%Equity
France
April 1998
100%Equity
November 1998
50% Equity
Land O’ Lakes
November 1998
50% Equity
December 1998
40% Equity
August 1998
100%Equity
July 1999
100%Equity
July 1999
80% Equity
U.S. CooperativeU.S. Cooperative
System:System:CroplanCroplanGenetics, FFR,Genetics, FFR,
GrowMarkGrowMark, etc., etc.
Wilson Seeds, Inc.Wilson Seeds, Inc.
Sturdy Grow Hybrids, Inc.Sturdy Grow Hybrids, Inc.
MaisadourMaisadourSemencesSemencesSASA
Novartis AGNovartis AG
(SyngentaAG)
Switzerland
AgritradingAgritradingItaly
EridaniaEridaniaBeghinBeghin-Say-Say
France
July 1999
20% Equity
SyngentaSyngenta AGAGDiversa Corp.Diversa Corp.
CalgeneCalgene, Inc., Inc.
July 1996
100%Equity
May 1998
$100 M50% Equity
Joint Venture
1982
100%Equity
AgriProAgriProSeedSeed
WheatWheatDivisionDivision
Cargill Hybrid SeedsCargill Hybrid Seeds
North AmericaNorth America
May 1998
$100 M50% Equity
Joint Venture
HybriTechHybriTechEurope SAEurope SA
France
February 1996
90% Equity
February 1996
10% Equity
PauPauEuralisEuralisFrance
CargillCargill, Inc., Inc.
RenessenRenessen
Cargill’sCargill’sInternationalInternational
Seed DivisionSeed Division
Corn States Hybrid Service, Inc.Corn States Hybrid Service, Inc.
Corn States InternationalCorn States InternationalSarlSarl..
AsgrowSeedAsgrowSeed
Company LLCCompany LLC
July 1998
$525 M100%Equity
July 1998
$1.4 B(est)
March 1996
$1.2 B 40% Equity
May 1998
$2.5 B 100%Equity
Total cost $3.7 Billion
November 1996
$240 M100%Equity
January 1997
$1.02 B 100% Equity
November 1997
$150 M100%Equity
April 1996
$30 M 50%Equity
November 1996
$50 M 5% Equity
May 1997
$242 M45% Equity
Total cost $322 Million
April 1996
$150 M100%Equity
November 1997
JV with FT
Sementes
June 1998
DeKalb GeneticsDeKalb Genetics
CorporationCorporation
AgracetusAgracetus, Inc., Inc.
Plant BreedingPlant Breeding
InternationalInternational
Cambridge,Cambridge,LtdLtd..
United Kingdom
First Line Seeds,First Line Seeds,LtdLtd..
Canada
MonsoyMonsoy
Brazil
JacobJacobHartzHartz
Seed Co., Inc.Seed Co., Inc.
1983
100%Equity
Holden’sHolden’s
FoundationFoundation
SeedsSeeds
Monsanto/
Pharmacia
Monsanto/
Pharmacia
Sementes AgroceresSementes AgroceresSASA
Brazil
HybriTechHybriTechSeedSeed
Int’l., Inc.Int’l., Inc.
CustomFarm SeedCustom Farm Seed
July 1997
CereonCereon
Mendel BiotechMendel Biotech
ParadigmGeneticsParadigmGenetics
March 1999
16.4% Equity
UnitedUnitedAgriseedsAgriseeds, Inc., Inc.
Morgan SeedsMorgan Seeds
Argentina
AdvancedAdvancedAgriTraitsAgriTraits
December 1996
$9.4 M18.75%
Equity
March 1999
83.6% Equity
March 1999
$15 M
25% Equity
April 1998
$32 M
100%Equity
September 1996
$34.6 M
100%Equity
February 1996
$72 M
100%Equity
September 1998
100%Equity
October 1998
$322 M100%Equity
MycogenMycogen
CorporationCorporation
Illinois Foundation Seed, Inc.Illinois Foundation Seed, Inc.
Dow
Agrosciences
Dow
Agrosciences
VerneuilVerneuil
Holding SAHolding SA
France
HibridosHibridosColoradoColoradoLtdaLtda
FTFTBiogeneticsBiogeneticsdedeMilho LtdaMilho Ltda
Brazil
DinamilhoDinamilhoCarolCarol
Productos Agricolas LtdaProductos Agricolas Ltda
Brazil
Large Scale Biology (BioSource)Large Scale Biology (BioSource)
DiversaDiversa)
BayerBayerParadigm
Incyte
LION
Exelixis
BASFBASF
Lynx
Lexicon
Incyte
Exelixis
Ag Chem & Seed Industry
December 1999
24% Equity
1993 80% Equity
December 1999
76% Equity
March 1998
50% Equity
March 1998
50% Equity
12% Equity
BiotechnicaBiotechnica
International, Inc./International, Inc./
LG SeedsLG Seeds
Akin Seed Co.Akin Seed Co.
CallahanCallahan SeedsSeeds
October 1993
80% Equity
March 1994
100%Equity
July 1994
85% Equity
June 1994
100%Equity
October 1990
100%Equity
99%
Equity
1997 55% Equity
Aventis CropScienceAventis CropScience
AgrEvoAgrEvo
Aventis SAAventis SA
France
ScheringScheringAGAG
Germany
1997
25% Equity
KWSKWS SaatSaat
Mais AngevinMais Angevin
France
BiogemmaBiogemma
France
RhoBioRhoBioFrance
France
PauPau EuralisEuralis
France
NickersonNickerson
SeedsSeeds
United Kingdom
Great LakesGreat Lakes
Hybrids, Inc.Hybrids, Inc.
Canada
KingKingAgroAgroInc.Inc.
Canada
GroupeGroupe
LimagrainLimagrain
France
ProagroGroupProagroGroup
India
Plant Genetic SystemsPlant Genetic Systems
International (PGS)International (PGS)
February 1999
100%Equity
August 1996
75% Equity- $550M
Germany
Sementes Ribeiral LtdaSementes Ribeiral Ltda..
Sementes Fartura LtdaSementes Fartura Ltda
Mitla Pesquisa Agricola LtdaMitla Pesquisa Agricola Ltda
Brazil
July 1999
100%Equity
Plantec BiotechnologiePlantec Biotechnologie
Germany
1996
95% Equity
15% Equity
Nidera SemillasNidera Semillas
Argentina
Pending
Up to 25% Equity
Agritope/Agrinomics
Diversa
Brazil
DoisDois MarcosMarcos
March 1999
100%Equity
Protein TechnologiesProtein Technologies
InternationalInternational
December 1997
$1.5 B100%Equity
OptimumQualityOptimumQuality
Grains, LLCGrains, LLC
HybrinovaHybrinovaSASA
April 1998
100%Equity
August 1997
50% Equity
E.I. DuPont deE.I. DuPont de
Nemours & Co.Nemours & Co.
Pioneer Hi-Bred
International, Inc.
Pioneer Hi-BredPioneer Hi-Bred
International, Inc.International, Inc.
October 1999
100%Equity
August 1997
50% Equity
Lynx
OGS
AffymetrixCuraGen
Maxygen
ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG
ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA
ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA
GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT
TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTA
TGGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTAC
CGCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCT
TCTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA
DNA – a common language across living organisms in the biosphere
genome programmes link understanding of biology to agriculture
implications for:
- forestry
- aquaculture
- livestock
- arable
Contemporary Science
Democratisation genomics
Roche 454: Metagenomics,
amplicon sequencing, BAC
sequencing
Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for
amplicons, small genomes, focused GBS and pilot experiments
Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes
Genes provide the foundation of new products for
farmers
biomass utility?
improved agronomy?
tolerance to cold?
yield?
tolerance to drought?
flowering time?
Genes Protein Trait Product
Marker- Aided Selection
• Locating
and
tagging the
genes for
drought
tolerance
Importance Genetics
Market Identification
by Trait, Crop,
species
Transgenic Plant
Development
Cell Culture
Molecular Biology
Genetics
Variety Development
Yield Trials
Product Testing
Products
Genetic diversity
Analytical Screens
Biochemistry
Germplasm Development
Traditional &
Molecular Breeding
Genetics
Molecular Genetics
• 24 ABI 377 Automated sequencers
• 20,000 Lane per week capacity
Gene Discovery
Plant Biology
Genomics
Genetic software & Hardware
ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW
BREEDING
Strategically breed plants
to create new, more robust
seeds that perform better –
and longer – in the field.
AGRONOMICS
Use precision ag, planting density,
plant health protection, and
conservation tillage to make acres
more productive.
BIOTECHNOLOGY
Supplement breeding
advancements by adding
special beneficial genes
to the plant.
“The Three Pillars of Yield”
Wamalwa Farm, Siritanyi FFS, Kanduyi.
Maize-groundnut intercrop providing 5330
kg maize and 1203 kg groundnut per ha.
These results indicate that MBILI can
produce significant food surpluses.
Rasike Farm, Chililila WG. MBILI maize-soyabean
intercrop providing 1215 kg maize and 545 kg
soyabean per ha when conventional intercrops
failed. These results indicate that MBILI is a
means toward greater food security.
Feeding future populations means doubling the productivity of neglected but
nutritious crops such as yams and green bananas
Š ISTOCKPHOTO
DAVID MARCHAL
Genomics and the People Century
Genomics-based research will make a difference but
only if there is integration across social & natural
sciences.
Iowa maize yield 61-90; 90-08
1960 1970 1980 1990 2000 2010
0
3
6
9
12
b=95 kg/ha/yr
R2
=0.51***
b=206 kg/ha/yr
R2
=0.61***
Year
Maizeyield(t/ha)
GMOs
US maize yields still rising –
why?
-1.0
-0.5
0.0
0.5
1.0
1.5
2.0
1986
1988
1990
1992
1994
1996
1998
2000
2002
2004
2006
Source: Defra & USDA
t/ha
59
Scarcity The green revolution
Set aside, CAP changesSubsidy and Surplus
Security
Set Aside
Biofuels
Food Prices
Food Security
60
Energy
Climate Change
Water (the new oil)
Food Security
Diet and Health
< 1000 1000 - 2000 > 2000
Estimated global water scarcity in 2050
(from Wallace, 2000)
per capita annual renewable freshwater
resource (m3/person/year).
sunlight
plants
plant biodiversity
science Agriculture, Land
Use & Society
Plants provide sustainable solutions
‘ultimate green & clean technology’
Sydney Brenner
“Which type of science to
fund is simple:
all science is problem
driven and should be
judged by the importance
of the problem and the
quality of the solutions
provided.”
A Life in Science
In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating
Ability to Realize Step-Change Improvements
Reference
genomes for
each crop
Genomes
targeted for
specific traits
(disease)
Genome for
every yield plot
GENOMES/YEAR
Public good plant breeding requiresPublic good plant breeding requires
introduction of new sources diversityintroduction of new sources diversity
DiversityDiversity
BreedingBreeding
MethodologyMethodology
Traits &Traits &
ProductsProducts
OatsOats
Forage grassesForage grasses
Turf grassTurf grass
LegumesLegumes
MiscanthusMiscanthus
New Opportunities but also complexityNew Opportunities but also complexity
Performance under
farmers’ conditions
and farmers’
acceptance
Participatory maize breeding in Africa
• Prioritize most important stresses
under farmers’ conditions
• Manage trials on experiment
station and evaluate large numbers
of cultivars,
• Select the best, and …
• Involve farmers
– Mother trials in center of farming
community grown under best-bet
input conditions
– Farmer-representative input
conditions
– Farmer-managed baby trials
• Partnership with extension, NGOs,
rural schools, and farmer
associations
The Mother / Baby trial design
Collaborative, on-farm evaluation of maize cultivars
IMPROVED
GERMPLASM
GENES
GenomicsGenetic Resources
Genetic
Engineering
Marker-assisted
Selection
Conventional
Selection
Genebank accessions
Segregating populations
Forward/reverse genetic systems
Structural
Functional
Plant Breeding Options
Crop Breeding Technology
Options
Ghana’s
Success
Story
• MDG 1 achieved
• Malnourished - 5.8m in
1993 to 2.7 m in 2003.
• Declines in %
underweight children
and mortality
• Strong agricultural
growth since 80s
• 25% increase due to
area expansion
• Maize yield up by 36%,
cassava by 50%
• New maize, yam, rice
and cassava varieties
• A pest resistant cassava.
• Strong growth in
smallholder cocoa &
pineapples
• Market liberalisation
• New rural infrastructure
Sources: Development Outreach,
October, 08;Coulombe & Wodon,
World Bank; Irish Hunger Report
All this is threatened by
Climate Change
• Higher
temperatures
• Greater & more
intense rainfall
• Greater droughts
• River bank erosion
• Rising sea levels
• More intense
cyclones
• Salt water
incursions
biology is the science of thebiology is the science of the
natural world & critical to thenatural world & critical to the
future of agriculture.future of agriculture.
‘all life depends on sunlight
and a green leaf’
The biosphere – nature’s solutions
Separate Niches
Source: Naylor R. and Battisti D. 2008 (pers comm)
Source: Global Biodiversity Trust
Maize has more molecular diversity than
humans and apes combined
Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001)
1.34%
0.09%
1.42%
Selective Breeding is a Powerful Tool
Picture courtesy of Roslin Institute
Projected losses of food caused by
the adverse effects of climate change
(2080)

More Related Content

What's hot

2016 International Conference on Pulses – Concluding remarks
2016 International Conference on Pulses – Concluding remarks2016 International Conference on Pulses – Concluding remarks
2016 International Conference on Pulses – Concluding remarksCGIAR
 
The role of ex situ crop diversity conservation in adaptation to climate change
The role of ex situ crop diversity conservation in adaptation to climate changeThe role of ex situ crop diversity conservation in adaptation to climate change
The role of ex situ crop diversity conservation in adaptation to climate changeLuigi Guarino
 
Where our Food Crops Come from: A new estimation of countries’ interdependenc...
Where our Food Crops Come from: A new estimation of countries’ interdependenc...Where our Food Crops Come from: A new estimation of countries’ interdependenc...
Where our Food Crops Come from: A new estimation of countries’ interdependenc...CWR Project
 
Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?FAO
 
Conserving crop wild relatives in the United States
Conserving crop wild relatives in the United StatesConserving crop wild relatives in the United States
Conserving crop wild relatives in the United StatesColin Khoury
 
Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9vijay bhosekar
 
Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9vijay bhosekar
 
Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...
Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...
Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...ICARDA
 
Transforming Agri-food Systems to Achieve Healthy Diets for All
Transforming Agri-food Systems to Achieve Healthy Diets for AllTransforming Agri-food Systems to Achieve Healthy Diets for All
Transforming Agri-food Systems to Achieve Healthy Diets for AllCGIAR
 
Partnering on CWR research at three scales: commonalities for success
Partnering on CWR research at three scales: commonalities for successPartnering on CWR research at three scales: commonalities for success
Partnering on CWR research at three scales: commonalities for successCWR Project
 
Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...Colin Khoury
 
Cwr at eucarpia
Cwr at eucarpiaCwr at eucarpia
Cwr at eucarpiacwr_use
 
Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project CWR Project
 
Final livestock future November 2013
Final livestock future November 2013Final livestock future November 2013
Final livestock future November 2013Ayurvet Limited
 
Genetic resources for food security
Genetic resources for food securityGenetic resources for food security
Genetic resources for food securityICRISAT
 
Diversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food securityDiversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food securityColin Khoury
 
A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013
A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013
A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013CWR Project
 
indigenous breeds and their utility
indigenous breeds and their utility  indigenous breeds and their utility
indigenous breeds and their utility SKUAST-Kashmir
 

What's hot (20)

2016 International Conference on Pulses – Concluding remarks
2016 International Conference on Pulses – Concluding remarks2016 International Conference on Pulses – Concluding remarks
2016 International Conference on Pulses – Concluding remarks
 
The role of ex situ crop diversity conservation in adaptation to climate change
The role of ex situ crop diversity conservation in adaptation to climate changeThe role of ex situ crop diversity conservation in adaptation to climate change
The role of ex situ crop diversity conservation in adaptation to climate change
 
Where our Food Crops Come from: A new estimation of countries’ interdependenc...
Where our Food Crops Come from: A new estimation of countries’ interdependenc...Where our Food Crops Come from: A new estimation of countries’ interdependenc...
Where our Food Crops Come from: A new estimation of countries’ interdependenc...
 
Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?Agroecology – a knowledge system for synergy?
Agroecology – a knowledge system for synergy?
 
Conserving crop wild relatives in the United States
Conserving crop wild relatives in the United StatesConserving crop wild relatives in the United States
Conserving crop wild relatives in the United States
 
Sustainability of insect rearing and insect-based food: the Nordic perspectiv...
Sustainability of insect rearing and insect-based food: the Nordic perspectiv...Sustainability of insect rearing and insect-based food: the Nordic perspectiv...
Sustainability of insect rearing and insect-based food: the Nordic perspectiv...
 
Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9
 
Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9Vijay Bhosekar_ PP_Rodale Institute_Feb 9
Vijay Bhosekar_ PP_Rodale Institute_Feb 9
 
Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...
Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...
Spatial Big Data Analytics for Intensification of Pulses: Exploring untapped ...
 
Transforming Agri-food Systems to Achieve Healthy Diets for All
Transforming Agri-food Systems to Achieve Healthy Diets for AllTransforming Agri-food Systems to Achieve Healthy Diets for All
Transforming Agri-food Systems to Achieve Healthy Diets for All
 
Automatisation of insect farming - Wouters, VIVES
Automatisation of insect farming - Wouters, VIVESAutomatisation of insect farming - Wouters, VIVES
Automatisation of insect farming - Wouters, VIVES
 
Partnering on CWR research at three scales: commonalities for success
Partnering on CWR research at three scales: commonalities for successPartnering on CWR research at three scales: commonalities for success
Partnering on CWR research at three scales: commonalities for success
 
Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...Interdependence among countries in plant genetic resources and crop wild rela...
Interdependence among countries in plant genetic resources and crop wild rela...
 
Cwr at eucarpia
Cwr at eucarpiaCwr at eucarpia
Cwr at eucarpia
 
Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project
 
Final livestock future November 2013
Final livestock future November 2013Final livestock future November 2013
Final livestock future November 2013
 
Genetic resources for food security
Genetic resources for food securityGenetic resources for food security
Genetic resources for food security
 
Diversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food securityDiversity in global food supplies and the implications for food security
Diversity in global food supplies and the implications for food security
 
A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013
A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013
A global perspective on CWR- ASA/CSSA/SSSA Tampa 2013
 
indigenous breeds and their utility
indigenous breeds and their utility  indigenous breeds and their utility
indigenous breeds and their utility
 

Viewers also liked

Approach To and Findings From Farming Practices Survey
Approach To and Findings From Farming Practices SurveyApproach To and Findings From Farming Practices Survey
Approach To and Findings From Farming Practices SurveyCRRC-Armenia
 
The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...
The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...
The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...Miles Lane
 
UK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPD
UK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPDUK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPD
UK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPDDesign South East
 
Integrated assessment of farming systems: communicating results. Santiago Dog...
Integrated assessment of farming systems: communicating results. Santiago Dog...Integrated assessment of farming systems: communicating results. Santiago Dog...
Integrated assessment of farming systems: communicating results. Santiago Dog...Joanna Hicks
 
integrated farming system research focusiing in Odisha
integrated farming system research focusiing in Odishaintegrated farming system research focusiing in Odisha
integrated farming system research focusiing in OdishaDebasish Mallick
 
India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...
India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...
India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...Strengthening Climate Resilience
 
Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...
Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...
Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...WorldFish
 
Study on smallholder rice farmers - Feb 2014
Study on smallholder rice farmers - Feb 2014Study on smallholder rice farmers - Feb 2014
Study on smallholder rice farmers - Feb 2014vault_tec
 

Viewers also liked (8)

Approach To and Findings From Farming Practices Survey
Approach To and Findings From Farming Practices SurveyApproach To and Findings From Farming Practices Survey
Approach To and Findings From Farming Practices Survey
 
The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...
The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...
The Rose Garden Forum and the Five Shifts - The Work of Sherlock I. Graham-Ha...
 
UK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPD
UK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPDUK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPD
UK Healthy Cities Network - Stephen Woods / Jennie Cawood, RTPI CPD
 
Integrated assessment of farming systems: communicating results. Santiago Dog...
Integrated assessment of farming systems: communicating results. Santiago Dog...Integrated assessment of farming systems: communicating results. Santiago Dog...
Integrated assessment of farming systems: communicating results. Santiago Dog...
 
integrated farming system research focusiing in Odisha
integrated farming system research focusiing in Odishaintegrated farming system research focusiing in Odisha
integrated farming system research focusiing in Odisha
 
India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...
India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...
India Diversified-INTEGRATED FARMING adaptation strategy for small and margin...
 
Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...
Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...
Science Forum Day 3 - Robert Holmer - A Recipe for Healthy Cities - Vegetable...
 
Study on smallholder rice farmers - Feb 2014
Study on smallholder rice farmers - Feb 2014Study on smallholder rice farmers - Feb 2014
Study on smallholder rice farmers - Feb 2014
 

Similar to B4FA 2012 Ghana: Plants and Agriculture - Wayne Powell

Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)Farming Futures
 
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsbyb4fa
 
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsbyb4fa
 
ILRI overview
ILRI overview ILRI overview
ILRI overview ILRI
 
Halberg organic chemistry agriculture ppt
Halberg organic chemistry agriculture pptHalberg organic chemistry agriculture ppt
Halberg organic chemistry agriculture pptGborKovcs46
 
Climate change and organic agri A Lecture By Allah Dad Khan
Climate change and organic agri A Lecture By Allah Dad Khan Climate change and organic agri A Lecture By Allah Dad Khan
Climate change and organic agri A Lecture By Allah Dad Khan Mr.Allah Dad Khan
 
Spilt milk worth crying over - Mark Eisler
Spilt milk worth crying over - Mark EislerSpilt milk worth crying over - Mark Eisler
Spilt milk worth crying over - Mark EislerSustainable Food Trust
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Beef and sheep: Developing practical solutions for sustainable agriculture' -...
Beef and sheep: Developing practical solutions for sustainable agriculture' -...Beef and sheep: Developing practical solutions for sustainable agriculture' -...
Beef and sheep: Developing practical solutions for sustainable agriculture' -...Farming Futures
 
Pulses in Dry Areas: Importance, Challenges and Potential
Pulses in Dry Areas: Importance, Challenges and PotentialPulses in Dry Areas: Importance, Challenges and Potential
Pulses in Dry Areas: Importance, Challenges and PotentialICARDA
 
Transformational Opportunities to Perennialize Global Farming Creating an Eve...
Transformational Opportunities to Perennialize Global Farming Creating an Eve...Transformational Opportunities to Perennialize Global Farming Creating an Eve...
Transformational Opportunities to Perennialize Global Farming Creating an Eve...World Agroforestry (ICRAF)
 
Amrut Mitti - Solution based on diverse agro - ecological
Amrut Mitti - Solution based on diverse agro - ecological Amrut Mitti - Solution based on diverse agro - ecological
Amrut Mitti - Solution based on diverse agro - ecological SSIAST Art Of Living
 
Science-fiction or science-fact? Research for sustainable livestock agri-food...
Science-fiction or science-fact? Research for sustainable livestock agri-food...Science-fiction or science-fact? Research for sustainable livestock agri-food...
Science-fiction or science-fact? Research for sustainable livestock agri-food...ILRI
 
How to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned PublicHow to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned PublicKevin Folta
 

Similar to B4FA 2012 Ghana: Plants and Agriculture - Wayne Powell (20)

Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)Plant science into practice - Tina Barsby (NIAB)
Plant science into practice - Tina Barsby (NIAB)
 
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby
 
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina BarsbyB4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
B4FA 2012 Tanzania: Genetics, plant breeding and agriculture - Tina Barsby
 
ILRI overview
ILRI overview ILRI overview
ILRI overview
 
T6 a osseweijer_food security and energy compilation_18nov2014_patricia
T6 a osseweijer_food security and energy compilation_18nov2014_patriciaT6 a osseweijer_food security and energy compilation_18nov2014_patricia
T6 a osseweijer_food security and energy compilation_18nov2014_patricia
 
Halberg.ppt
Halberg.pptHalberg.ppt
Halberg.ppt
 
Halberg.ppt
Halberg.pptHalberg.ppt
Halberg.ppt
 
Halberg.ppt
Halberg.pptHalberg.ppt
Halberg.ppt
 
Halberg organic chemistry agriculture ppt
Halberg organic chemistry agriculture pptHalberg organic chemistry agriculture ppt
Halberg organic chemistry agriculture ppt
 
Climate change and organic agri A Lecture By Allah Dad Khan
Climate change and organic agri A Lecture By Allah Dad Khan Climate change and organic agri A Lecture By Allah Dad Khan
Climate change and organic agri A Lecture By Allah Dad Khan
 
Spilt milk worth crying over - Mark Eisler
Spilt milk worth crying over - Mark EislerSpilt milk worth crying over - Mark Eisler
Spilt milk worth crying over - Mark Eisler
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
 
Breeding Organic Vegetables
Breeding Organic VegetablesBreeding Organic Vegetables
Breeding Organic Vegetables
 
Beef and sheep: Developing practical solutions for sustainable agriculture' -...
Beef and sheep: Developing practical solutions for sustainable agriculture' -...Beef and sheep: Developing practical solutions for sustainable agriculture' -...
Beef and sheep: Developing practical solutions for sustainable agriculture' -...
 
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann TutwilerAgricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
Agricultural Biodiversity Nourishes People and Sustains the Planet Ann Tutwiler
 
Pulses in Dry Areas: Importance, Challenges and Potential
Pulses in Dry Areas: Importance, Challenges and PotentialPulses in Dry Areas: Importance, Challenges and Potential
Pulses in Dry Areas: Importance, Challenges and Potential
 
Transformational Opportunities to Perennialize Global Farming Creating an Eve...
Transformational Opportunities to Perennialize Global Farming Creating an Eve...Transformational Opportunities to Perennialize Global Farming Creating an Eve...
Transformational Opportunities to Perennialize Global Farming Creating an Eve...
 
Amrut Mitti - Solution based on diverse agro - ecological
Amrut Mitti - Solution based on diverse agro - ecological Amrut Mitti - Solution based on diverse agro - ecological
Amrut Mitti - Solution based on diverse agro - ecological
 
Science-fiction or science-fact? Research for sustainable livestock agri-food...
Science-fiction or science-fact? Research for sustainable livestock agri-food...Science-fiction or science-fact? Research for sustainable livestock agri-food...
Science-fiction or science-fact? Research for sustainable livestock agri-food...
 
How to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned PublicHow to Change the Hearts and Minds of a Concerned Public
How to Change the Hearts and Minds of a Concerned Public
 

More from b4fa

B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon SchmickleB4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickleb4fa
 
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph KithamaB4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithamab4fa
 
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon SchmickleB4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickleb4fa
 
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon SchmickleB4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickleb4fa
 
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel OtungeB4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otungeb4fa
 
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...b4fa
 
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth DansoB4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Dansob4fa
 
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul AsareB4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asareb4fa
 
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel ChambaB4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chambab4fa
 
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia CanalesB4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canalesb4fa
 
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko AsanteB4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asanteb4fa
 
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...b4fa
 
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George AmeyawB4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyawb4fa
 
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris LeaverB4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris Leaverb4fa
 
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex AbutuB4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutub4fa
 
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi DanquahB4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquahb4fa
 
B4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie JonesB4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie Jonesb4fa
 
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie JonesB4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jonesb4fa
 
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel OtungeB4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otungeb4fa
 
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo b4fa
 

More from b4fa (20)

B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon SchmickleB4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
B4FA 2012 Tanzania: Beyond Phony Balance - Sharon Schmickle
 
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph KithamaB4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
B4FA 2012 Tanzania: Science Journalism in Tanzania - Joseph Kithama
 
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon SchmickleB4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
B4FA 2012 Tanzania: Genes - Out of the Lab into the News - Sharon Schmickle
 
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon SchmickleB4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
B4FA 2012 Tanzania: Interview Skills - Sharon Schmickle
 
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel OtungeB4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
B4FA 2013 Ghana: Seed trade environment in Ghana - Daniel Otunge
 
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
B4FA 2013 Ghana: Agricultural biotechnology and the regulatory environment - ...
 
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth DansoB4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
B4FA 2013 Ghana: Pineapple tissue culture - Kenneth Danso
 
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul AsareB4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
B4FA 2013 Ghana: Cassava mosaic disease resistance - Paul Asare
 
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel ChambaB4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
B4FA 2013 Ghana: Bt cotton production in Ghana - Emmanuel Chamba
 
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia CanalesB4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
B4FA 2013 Ghana: F1 hybrid seeds and plants - Claudia Canales
 
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko AsanteB4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
B4FA 2013 Ghana: Breeding rice varieties in Ghana - Maxwell Darko Asante
 
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
B4FA 2013 Ghana: Status of maruca-resistant cowpea project in Ghana - IDK Ato...
 
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George AmeyawB4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
B4FA 2013 Ghana: Cocoa black pod resistance - Abu Dadzie and George Ameyaw
 
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris LeaverB4FA 2013 Ghana: Genetic Engineering - Chris Leaver
B4FA 2013 Ghana: Genetic Engineering - Chris Leaver
 
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex AbutuB4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
B4FA 2013 Ghana: Fundamentals of Science Journalism - Alex Abutu
 
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi DanquahB4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
B4FA 2013 Ghana: Introduction to Genetics - Prof Eric Yirenkyi Danquah
 
B4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie JonesB4FA 2013 Ghana: History of agriculture - Bernie Jones
B4FA 2013 Ghana: History of agriculture - Bernie Jones
 
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie JonesB4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
B4FA 2013 Ghana: Media dialogue Workshop Introduction - Bernie Jones
 
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel OtungeB4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
B4FA 2012 Tanzania: Seed trade environment in Tanzania - Daniel Otunge
 
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
B4FA 2012 Tanzania: MARI Coconut breeding programme - Grace Chipungahelo
 

Recently uploaded

Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...RohitNehra6
 
Ahmedabad Call Girls Service 9537192988 can satisfy every one of your dreams
Ahmedabad Call Girls Service 9537192988 can satisfy every one of your dreamsAhmedabad Call Girls Service 9537192988 can satisfy every one of your dreams
Ahmedabad Call Girls Service 9537192988 can satisfy every one of your dreamsoolala9823
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...anilsa9823
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​  ​Nanoparticles synthesis and characterization​  ​
Nanoparticles synthesis and characterization​ ​kaibalyasahoo82800
 
Scheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docxScheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docxyaramohamed343013
 
Work, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE PhysicsWork, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE Physicsvishikhakeshava1
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...SĂŠrgio Sacani
 
zoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzohaibmir069
 
Module 4: Mendelian Genetics and Punnett Square
Module 4:  Mendelian Genetics and Punnett SquareModule 4:  Mendelian Genetics and Punnett Square
Module 4: Mendelian Genetics and Punnett SquareIsiahStephanRadaza
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxUmerFayaz5
 
Neurodevelopmental disorders according to the dsm 5 tr
Neurodevelopmental disorders according to the dsm 5 trNeurodevelopmental disorders according to the dsm 5 tr
Neurodevelopmental disorders according to the dsm 5 trssuser06f238
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTSĂŠrgio Sacani
 
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfAnalytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfSwapnil Therkar
 
Artificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C PArtificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C PPRINCE C P
 
Luciferase in rDNA technology (biotechnology).pptx
Luciferase in rDNA technology (biotechnology).pptxLuciferase in rDNA technology (biotechnology).pptx
Luciferase in rDNA technology (biotechnology).pptxAleenaTreesaSaji
 
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxAnalytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxSwapnil Therkar
 

Recently uploaded (20)

Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...
 
Ahmedabad Call Girls Service 9537192988 can satisfy every one of your dreams
Ahmedabad Call Girls Service 9537192988 can satisfy every one of your dreamsAhmedabad Call Girls Service 9537192988 can satisfy every one of your dreams
Ahmedabad Call Girls Service 9537192988 can satisfy every one of your dreams
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​  ​Nanoparticles synthesis and characterization​  ​
Nanoparticles synthesis and characterization​ ​
 
Scheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docxScheme-of-Work-Science-Stage-4 cambridge science.docx
Scheme-of-Work-Science-Stage-4 cambridge science.docx
 
Work, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE PhysicsWork, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE Physics
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
 
zoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistan
 
Module 4: Mendelian Genetics and Punnett Square
Module 4:  Mendelian Genetics and Punnett SquareModule 4:  Mendelian Genetics and Punnett Square
Module 4: Mendelian Genetics and Punnett Square
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptx
 
Neurodevelopmental disorders according to the dsm 5 tr
Neurodevelopmental disorders according to the dsm 5 trNeurodevelopmental disorders according to the dsm 5 tr
Neurodevelopmental disorders according to the dsm 5 tr
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfAnalytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
 
Artificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C PArtificial Intelligence In Microbiology by Dr. Prince C P
Artificial Intelligence In Microbiology by Dr. Prince C P
 
The Philosophy of Science
The Philosophy of ScienceThe Philosophy of Science
The Philosophy of Science
 
Engler and Prantl system of classification in plant taxonomy
Engler and Prantl system of classification in plant taxonomyEngler and Prantl system of classification in plant taxonomy
Engler and Prantl system of classification in plant taxonomy
 
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
 
Luciferase in rDNA technology (biotechnology).pptx
Luciferase in rDNA technology (biotechnology).pptxLuciferase in rDNA technology (biotechnology).pptx
Luciferase in rDNA technology (biotechnology).pptx
 
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxAnalytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
 

B4FA 2012 Ghana: Plants and Agriculture - Wayne Powell

  • 3. Agriculture the most important event in human history ‘The original biotechnology, fundamental to culture, health, quality environment & biodiversity.’
  • 4. Agriculture is at the Center of Many of Society’s Most Important Debates Exciting time for Agriculture & Plant Breeding • Global food security •Enhanced productivity •Increased yield •Sustainable production • Water availability •Drought-tolerant crops • Biofuels •Yield technologies to help meet demand for both food and fuel • Global warming •CO2 footprint •Fertilizer use
  • 5.
  • 6. Holistic Research “No matter how excellent the research done in one scientific discipline is, its application in isolation will have little positive effect on crop production. What is needed are venturesome scientists who can work across disciplines to produce appropriate technologies and who have the courage to make their case with political leaders to bring these advances to fruition. ” Norman E. Borlaug
  • 7.
  • 8. Doubly Green Revolution • The aim •repeat the success of the Green Revolution •on a global scale to include Africa!! •in many diverse localities • and be •equitable •sustainable •and environmentally friendly
  • 9. sunlight plants plant power science Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
  • 10. fossil reserves biorenewables oil...refineries bio...refineries CHEMICALS MATERIALS FUELS yesterday today and tomorrow sunlight plant biomass a solar energy source for manufacturing
  • 11. Agriculture critical to the future of our planet and humanity •FOOD, •FEED, •FUEL •CHEMICALS
  • 12.
  • 13. Daily calorie intake in developing world Rice 45% Wheat 29% Maize 11% Cassava 3% Sorghum 2% Potato 2% Sweet potato 2% Millet 2% Soybean 2% Bean 1%
  • 14.
  • 15.
  • 16. Courtesy Tobert Rocheford and Catherine Bermudez Kandianis Keith Weller Doug Wilson Scott Bauer Keith Weller
  • 17. •DuPont Food security index http://foodsecurity.eiu.com •Father Green revolution: Norman Borlaug. •Civilization founded on crops •Importance of diversity
  • 18. Charles Darwin Evolution is driven by natural selection
  • 19. Darwin’s mentor Great Teachers often feature in the development of Great People!
  • 20. Fundamental role of Diversity & Selection Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
  • 21. Selective breeding is a powerful tool ESEB Congress, Uppsala, Sweden, August 2007
  • 22. “Selection works.” JW Dudley Crop Sci (2007) 47(S3)S20–S31
  • 23. Eco-systems based approach to plant breeding
  • 24. Grass crop domestication – increasing forage quality (Mean WSC over 5 years data) Cultivar Mean Water Soluble Carbohydrate Content S23 17.1% AberDart 20.6% AberAvon 20.6% AberStar 21.5% AberMagic 23.7%
  • 25. High sugar ryegrass (Environmental/ Quality Trait) Economic benefits – live weight gain Environmental benefits – reduced diffuse pollution - reduced GHG emissions
  • 26. New traits-new sources genetic diversity Redirection of metabolic hydrogen Methods of methane mitigation: Feed CH4 CO2 Methanogens Protozoa Microbial cells
  • 27. Science has provided the key to unlocking the potential of food Sugar keeps sheep happy, and has revolutionised food production, says Steve Jones. Steve Jones is professor of genetics at University College London
  • 28. Conversion of high sugar grasses to alcohol based transport fuel Image courtesy of Steve Martin, TMO Renewables Harvest Primary Processing (screw press) Juice Fibre Fermentation Digestion Co-Products Co-Products Ethanol potential: ~ 5000 litres/Ha/yr Ethanol potential: ~ 5000 litres/Ha/yr Alternative uses Alternative uses Single enzyme
  • 29. Natural Products Biotransformation & composites Biorefining Centre of Excellence
  • 30. Vavilov 1887-1943 •Soviet botanist & geneticist •Discovered and identified centres of origin/cultivated plants •Criticised the non- Mendelian concepts of Lysenko •Arrested in 1940, died of malnutrition in prison in 1943.
  • 31. Crop origins and diversification: multiple births Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
  • 32. Little overlap between centres of origin & today’s productive agriculture. ESEB Congress, Uppsala, Sweden, August 2007 Nature Vol 418, 700-707
  • 33. Why is this important? Nature Vol 418, 700-707
  • 34. Drought in Africa between now and 2090 Red, Orange = More prone to drought Blue = Wetter and less prone to drought Hadley Centre, Met Office, UK
  • 35. Crop Biodiversity The Seed Vault at Svalbard Global Crop Diversity Trust
  • 36. Serendipity Natural Hybridisation Many modern crop species are the result of ancient (or recent) hybridisation events. Cotton Wheat Oilseed Rape Maize
  • 37. Wheat a classic allo-hexaploid ESEB Congress, Uppsala, Sweden, August 2007 Science Vol 316, 1862-1866
  • 38.
  • 39. Wheat a classic allo-hexaploid ESEB Congress, Uppsala, Sweden, August 2007
  • 40. The New Rice for Africa Monty Jones 2004
  • 41. • Organisation and importance of Diversity • Selection is a powerful tool but need to understand & know what to select for. • Importance engagement. – Journalists to articulate and sell stories!
  • 42. Breeding major technology platform for food, water & energy security Next steps ? Proteomics Genomics Analytical Technology Transgenic Traits Molecular Engineering Winter Nurseries Computer Technology Plot Mechanisation Quantitative Genetics Statistics Pedigree Breeding Hybridisation Open Pollinated Selection GermplasmImprovement (HigherSustainableYields) Time Plant Breeders use any combination of these technologies to develop enhanced products for customers, and continue to explore technologies to enhance this process New Opportunities for Agriculture
  • 43.
  • 44. The Life sciences revolution Molecular biology Computer science Mathematics Exciting time Unlocking the genetic potential of the biosphere Sustainable food production Plant Breeding
  • 45. May 2000 Life Science Companies SeedCompanies Joint Ventures Cooperatives Other Companies GarstGarstSeed Co.Seed Co. December 1997 20% Equity ExSeedExSeedGenetics LLCGenetics LLC AstraZeneca PLC United Kingdom Mogen International NVMogen International NV The Netherlands Cooperatie CosunCooperatie CosunUA UA The Netherlands InterstateInterstatePayco Payco August 1996 50% Equity August 1996 50% Equity June 1997 $78 M 100% Equity 100%Equity August 1996 100%Equity August 1996 100%Equity Advanta BVAdvanta BV The Netherlands RoyalVanderHaveRoyalVanderHaveThe Netherlands KoipesolKoipesol//AgrosemAgrosem//AgraAgra Spain ItalyFrance ZimmermanZimmerman Hybrids, Inc.Hybrids, Inc. 1998 100%Equity France April 1998 100%Equity November 1998 50% Equity Land O’ Lakes November 1998 50% Equity December 1998 40% Equity August 1998 100%Equity July 1999 100%Equity July 1999 80% Equity U.S. CooperativeU.S. Cooperative System:System:CroplanCroplanGenetics, FFR,Genetics, FFR, GrowMarkGrowMark, etc., etc. Wilson Seeds, Inc.Wilson Seeds, Inc. Sturdy Grow Hybrids, Inc.Sturdy Grow Hybrids, Inc. MaisadourMaisadourSemencesSemencesSASA Novartis AGNovartis AG (SyngentaAG) Switzerland AgritradingAgritradingItaly EridaniaEridaniaBeghinBeghin-Say-Say France July 1999 20% Equity SyngentaSyngenta AGAGDiversa Corp.Diversa Corp. CalgeneCalgene, Inc., Inc. July 1996 100%Equity May 1998 $100 M50% Equity Joint Venture 1982 100%Equity AgriProAgriProSeedSeed WheatWheatDivisionDivision Cargill Hybrid SeedsCargill Hybrid Seeds North AmericaNorth America May 1998 $100 M50% Equity Joint Venture HybriTechHybriTechEurope SAEurope SA France February 1996 90% Equity February 1996 10% Equity PauPauEuralisEuralisFrance CargillCargill, Inc., Inc. RenessenRenessen Cargill’sCargill’sInternationalInternational Seed DivisionSeed Division Corn States Hybrid Service, Inc.Corn States Hybrid Service, Inc. Corn States InternationalCorn States InternationalSarlSarl.. AsgrowSeedAsgrowSeed Company LLCCompany LLC July 1998 $525 M100%Equity July 1998 $1.4 B(est) March 1996 $1.2 B 40% Equity May 1998 $2.5 B 100%Equity Total cost $3.7 Billion November 1996 $240 M100%Equity January 1997 $1.02 B 100% Equity November 1997 $150 M100%Equity April 1996 $30 M 50%Equity November 1996 $50 M 5% Equity May 1997 $242 M45% Equity Total cost $322 Million April 1996 $150 M100%Equity November 1997 JV with FT Sementes June 1998 DeKalb GeneticsDeKalb Genetics CorporationCorporation AgracetusAgracetus, Inc., Inc. Plant BreedingPlant Breeding InternationalInternational Cambridge,Cambridge,LtdLtd.. United Kingdom First Line Seeds,First Line Seeds,LtdLtd.. Canada MonsoyMonsoy Brazil JacobJacobHartzHartz Seed Co., Inc.Seed Co., Inc. 1983 100%Equity Holden’sHolden’s FoundationFoundation SeedsSeeds Monsanto/ Pharmacia Monsanto/ Pharmacia Sementes AgroceresSementes AgroceresSASA Brazil HybriTechHybriTechSeedSeed Int’l., Inc.Int’l., Inc. CustomFarm SeedCustom Farm Seed July 1997 CereonCereon Mendel BiotechMendel Biotech ParadigmGeneticsParadigmGenetics March 1999 16.4% Equity UnitedUnitedAgriseedsAgriseeds, Inc., Inc. Morgan SeedsMorgan Seeds Argentina AdvancedAdvancedAgriTraitsAgriTraits December 1996 $9.4 M18.75% Equity March 1999 83.6% Equity March 1999 $15 M 25% Equity April 1998 $32 M 100%Equity September 1996 $34.6 M 100%Equity February 1996 $72 M 100%Equity September 1998 100%Equity October 1998 $322 M100%Equity MycogenMycogen CorporationCorporation Illinois Foundation Seed, Inc.Illinois Foundation Seed, Inc. Dow Agrosciences Dow Agrosciences VerneuilVerneuil Holding SAHolding SA France HibridosHibridosColoradoColoradoLtdaLtda FTFTBiogeneticsBiogeneticsdedeMilho LtdaMilho Ltda Brazil DinamilhoDinamilhoCarolCarol Productos Agricolas LtdaProductos Agricolas Ltda Brazil Large Scale Biology (BioSource)Large Scale Biology (BioSource) DiversaDiversa) BayerBayerParadigm Incyte LION Exelixis BASFBASF Lynx Lexicon Incyte Exelixis Ag Chem & Seed Industry December 1999 24% Equity 1993 80% Equity December 1999 76% Equity March 1998 50% Equity March 1998 50% Equity 12% Equity BiotechnicaBiotechnica International, Inc./International, Inc./ LG SeedsLG Seeds Akin Seed Co.Akin Seed Co. CallahanCallahan SeedsSeeds October 1993 80% Equity March 1994 100%Equity July 1994 85% Equity June 1994 100%Equity October 1990 100%Equity 99% Equity 1997 55% Equity Aventis CropScienceAventis CropScience AgrEvoAgrEvo Aventis SAAventis SA France ScheringScheringAGAG Germany 1997 25% Equity KWSKWS SaatSaat Mais AngevinMais Angevin France BiogemmaBiogemma France RhoBioRhoBioFrance France PauPau EuralisEuralis France NickersonNickerson SeedsSeeds United Kingdom Great LakesGreat Lakes Hybrids, Inc.Hybrids, Inc. Canada KingKingAgroAgroInc.Inc. Canada GroupeGroupe LimagrainLimagrain France ProagroGroupProagroGroup India Plant Genetic SystemsPlant Genetic Systems International (PGS)International (PGS) February 1999 100%Equity August 1996 75% Equity- $550M Germany Sementes Ribeiral LtdaSementes Ribeiral Ltda.. Sementes Fartura LtdaSementes Fartura Ltda Mitla Pesquisa Agricola LtdaMitla Pesquisa Agricola Ltda Brazil July 1999 100%Equity Plantec BiotechnologiePlantec Biotechnologie Germany 1996 95% Equity 15% Equity Nidera SemillasNidera Semillas Argentina Pending Up to 25% Equity Agritope/Agrinomics Diversa Brazil DoisDois MarcosMarcos March 1999 100%Equity Protein TechnologiesProtein Technologies InternationalInternational December 1997 $1.5 B100%Equity OptimumQualityOptimumQuality Grains, LLCGrains, LLC HybrinovaHybrinovaSASA April 1998 100%Equity August 1997 50% Equity E.I. DuPont deE.I. DuPont de Nemours & Co.Nemours & Co. Pioneer Hi-Bred International, Inc. Pioneer Hi-BredPioneer Hi-Bred International, Inc.International, Inc. October 1999 100%Equity August 1997 50% Equity Lynx OGS AffymetrixCuraGen Maxygen
  • 46. ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTA TGGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTAC CGCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCT TCTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA DNA – a common language across living organisms in the biosphere genome programmes link understanding of biology to agriculture implications for: - forestry - aquaculture - livestock - arable Contemporary Science
  • 47. Democratisation genomics Roche 454: Metagenomics, amplicon sequencing, BAC sequencing Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for amplicons, small genomes, focused GBS and pilot experiments Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes
  • 48. Genes provide the foundation of new products for farmers biomass utility? improved agronomy? tolerance to cold? yield? tolerance to drought? flowering time? Genes Protein Trait Product
  • 49. Marker- Aided Selection • Locating and tagging the genes for drought tolerance
  • 50. Importance Genetics Market Identification by Trait, Crop, species Transgenic Plant Development Cell Culture Molecular Biology Genetics Variety Development Yield Trials Product Testing Products Genetic diversity Analytical Screens Biochemistry Germplasm Development Traditional & Molecular Breeding Genetics Molecular Genetics • 24 ABI 377 Automated sequencers • 20,000 Lane per week capacity Gene Discovery Plant Biology Genomics
  • 51. Genetic software & Hardware
  • 52. ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW BREEDING Strategically breed plants to create new, more robust seeds that perform better – and longer – in the field. AGRONOMICS Use precision ag, planting density, plant health protection, and conservation tillage to make acres more productive. BIOTECHNOLOGY Supplement breeding advancements by adding special beneficial genes to the plant. “The Three Pillars of Yield”
  • 53. Wamalwa Farm, Siritanyi FFS, Kanduyi. Maize-groundnut intercrop providing 5330 kg maize and 1203 kg groundnut per ha. These results indicate that MBILI can produce significant food surpluses. Rasike Farm, Chililila WG. MBILI maize-soyabean intercrop providing 1215 kg maize and 545 kg soyabean per ha when conventional intercrops failed. These results indicate that MBILI is a means toward greater food security.
  • 54. Feeding future populations means doubling the productivity of neglected but nutritious crops such as yams and green bananas
  • 56. Genomics and the People Century Genomics-based research will make a difference but only if there is integration across social & natural sciences.
  • 57. Iowa maize yield 61-90; 90-08 1960 1970 1980 1990 2000 2010 0 3 6 9 12 b=95 kg/ha/yr R2 =0.51*** b=206 kg/ha/yr R2 =0.61*** Year Maizeyield(t/ha) GMOs
  • 58. US maize yields still rising – why? -1.0 -0.5 0.0 0.5 1.0 1.5 2.0 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 Source: Defra & USDA t/ha
  • 59. 59 Scarcity The green revolution Set aside, CAP changesSubsidy and Surplus Security Set Aside Biofuels Food Prices Food Security
  • 60. 60 Energy Climate Change Water (the new oil) Food Security Diet and Health < 1000 1000 - 2000 > 2000 Estimated global water scarcity in 2050 (from Wallace, 2000) per capita annual renewable freshwater resource (m3/person/year).
  • 61. sunlight plants plant biodiversity science Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
  • 62. Sydney Brenner “Which type of science to fund is simple: all science is problem driven and should be judged by the importance of the problem and the quality of the solutions provided.” A Life in Science
  • 63. In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating Ability to Realize Step-Change Improvements Reference genomes for each crop Genomes targeted for specific traits (disease) Genome for every yield plot GENOMES/YEAR
  • 64. Public good plant breeding requiresPublic good plant breeding requires introduction of new sources diversityintroduction of new sources diversity DiversityDiversity BreedingBreeding MethodologyMethodology Traits &Traits & ProductsProducts OatsOats Forage grassesForage grasses Turf grassTurf grass LegumesLegumes MiscanthusMiscanthus New Opportunities but also complexityNew Opportunities but also complexity
  • 65. Performance under farmers’ conditions and farmers’ acceptance Participatory maize breeding in Africa • Prioritize most important stresses under farmers’ conditions • Manage trials on experiment station and evaluate large numbers of cultivars, • Select the best, and … • Involve farmers – Mother trials in center of farming community grown under best-bet input conditions – Farmer-representative input conditions – Farmer-managed baby trials • Partnership with extension, NGOs, rural schools, and farmer associations The Mother / Baby trial design Collaborative, on-farm evaluation of maize cultivars
  • 68. Ghana’s Success Story • MDG 1 achieved • Malnourished - 5.8m in 1993 to 2.7 m in 2003. • Declines in % underweight children and mortality • Strong agricultural growth since 80s • 25% increase due to area expansion • Maize yield up by 36%, cassava by 50% • New maize, yam, rice and cassava varieties • A pest resistant cassava. • Strong growth in smallholder cocoa & pineapples • Market liberalisation • New rural infrastructure Sources: Development Outreach, October, 08;Coulombe & Wodon, World Bank; Irish Hunger Report
  • 69. All this is threatened by Climate Change • Higher temperatures • Greater & more intense rainfall • Greater droughts • River bank erosion • Rising sea levels • More intense cyclones • Salt water incursions
  • 70. biology is the science of thebiology is the science of the natural world & critical to thenatural world & critical to the future of agriculture.future of agriculture. ‘all life depends on sunlight and a green leaf’
  • 71. The biosphere – nature’s solutions
  • 72. Separate Niches Source: Naylor R. and Battisti D. 2008 (pers comm) Source: Global Biodiversity Trust
  • 73.
  • 74. Maize has more molecular diversity than humans and apes combined Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001) 1.34% 0.09% 1.42%
  • 75. Selective Breeding is a Powerful Tool Picture courtesy of Roslin Institute
  • 76. Projected losses of food caused by the adverse effects of climate change (2080)