SlideShare a Scribd company logo
The post-genomic era Epigenetic sequencing applications and data integration WOUD mini-symposium28/09/2011   Maté Ongenaert Center for Medical Genetics Ghent University Hospital, Belgium
Overview ,[object Object],Introduction DNA-methylation Histonemodifications The interplaybetweenmethylationandhistonemodifications Applications of epigentics Epigeneticsequencing Sequencingthe epigenome Data analysis andintegration
Epigenetics > Introduction -genetics Heritable changes to the DNA or histones without affecting the DNA sequence A whole range of changes are described DNA-methylation Histonetailmodifications Methylation Acetylation Phosphorylation …. Epigenetic changes are interconnected
Epigenetics > Introduction
Epigenetics > Introduction DNA-methylation Histone tail modifications
Epigenetics > DNA-methylation DNA-methylationandcancer Global hypomethylation Localhypermethylation
Epigenetics > Interplay Interplaybetween DNA-methylationandhistonemodifications
Epigenetics > Detection / Prognosis / Prediction (Early) detection– diagnostic Diagnostic: who Screening programs
Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment
Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment
Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment Biomarker
Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment
Epigenetics > Detection / Prognosis / Prediction Prediction Chemotherapy respons (MGMT in brain cancer - temozolomide)
Overview ,[object Object],Introduction DNA-methylation Histonemodifications The interplaybetweenmethylationandhistonemodifications Applications of epigentics Epigeneticsequencing Sequencingthe epigenome Data analysis andintegration
Sequencing the epigenome DNA-methylation Restriction-based Bisulfite-conversionbased Affinity-based MeDIP-seq (Antibody) MBD-seq (Methyl Binding Domain) ,[object Object],ChIP-seq
Sequencing the epigenome Shearing of DNA (Covaris) Sequencing Control of fragment sizeswith high sensitivity DNA chips Concentration determination of the fragmented DNA with Fluostar Optima plate reader MBD2 immunoprecipitation reaction (MethylCollector Kit)
Sequencing the epigenome Sequencing data analysis
Sequencing the epigenome QC (FastQC)
Sequencing the epigenome Mapping @HWUSI-EAS100R:6:73:941:1973#0/1  GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTT  +HWUSI-EAS100R:6:73:941:1973#0/1  !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC6 Identifier (Illumina machine name, lane, tile etc.) Sequence Sequencing quality
Sequencing the epigenome Mapping bowtie -q -n --fr --phred64-quals -x 250 -t -p 4 hg19-1 qseq_2_MID5_W.fastq -2 qseq_2_MID5_C.fastq IMR32.bowtie  Input FASTQ files (two: paired end) Mapping parameters: - q: quality aware (--phred64-quals: Iluminaquality scores instead of Phred)--fr: map on forward and reverse strand of the reference genome- x: map paired-end reads maximum 250 bp apart - p 4: use 4 processes to map (parallelization) - hg19: reference genome
Sequencing the epigenome Mapping HWUSI-EAS509:4:34:13795:1029#0/1 + chr16 57608607 GTCAG… IIIII… 0  HWUSI-EAS509:4:34:13795:1029#0/3/2 - chr16 57608757 GTCCT… IIIII… 0  HWUSI-EAS509:4:34:6016:1041#0/3/2 + chr10 94410976 GTTTC… IIIII… 0  HWUSI-EAS509:4:34:6016:1041#0/1 - chr10 94411127 TGTTT… IIIHH… 0  HWUSI-EAS509:4:34:7281:1043#0/1 + chr4 54043731 GTCTA… IIIII… 0  Chromosomal location (strand, chromosome, pos) Quality of the mapping
Sequencing the epigenome Mapping macs14 -t IMR32.bowtie -f BOWTIE -g hs -n IMR32 -w --single-wig  Input: mapped “treatment” reads and format of mapping (you can also provide a control sample) Parameters:-g hs: human reference genome (for size estimation)- n: name of output files - w: create wig-files for visualisation (counts)
Sequencing the epigenome Mapping Chrstart	end	length	summit	tags	score	fold_enrichment Chr1	14862	15572	711	227	17	86.37	13.55  Chr1	135001 135399 399	197	12	83.27	15.43  Chr1	229428 229950 523	329	10	62.41	14.03
Sequencing the epigenome
Sequencing the epigenome PCDHB-cluster (neuroblastoma CLs)
Sequencing the epigenome PCDHB-cluster in neuroblastoma
Sequencing the epigenome Integrating data sources… H3K27 me3 H3K36 me3 H3K4 me3 RNA-seq Promoter region Gene Body Active gene
Sequencing the epigenome
Conclusions Sequencingepigenomesreveals a wealth of information There is no suchthing as the epigenome Methylome Hydroxymethylome Different histonemodifications Don’tforget the interplayand the dynamics… Start exploring the data byyourselfas youknow the application the best
Acknowledgments ,[object Object]

More Related Content

What's hot

SAGE (Serial analysis of Gene Expression)
SAGE (Serial analysis of Gene Expression)SAGE (Serial analysis of Gene Expression)
SAGE (Serial analysis of Gene Expression)
talhakhat
 
Site directed mutagenesis
Site  directed mutagenesisSite  directed mutagenesis
Site directed mutagenesis
Zain Khadim
 
Overview of epigenetics and its role in disease
Overview of epigenetics and its role in diseaseOverview of epigenetics and its role in disease
Overview of epigenetics and its role in disease
Garry D. Lasaga
 
oncogene as a transcription activator
oncogene as a transcription activatoroncogene as a transcription activator
oncogene as a transcription activator
Deepak Rohilla
 
Somatic cell genetics
Somatic cell geneticsSomatic cell genetics
Somatic cell genetics
KAUSHAL SAHU
 
Lambda vector
Lambda vectorLambda vector
Lambda vector
kishoreGupta17
 
Functional genomics, and tools
Functional genomics, and toolsFunctional genomics, and tools
Functional genomics, and tools
KAUSHAL SAHU
 
Agrobacterium MEDIATED GENE TRANSFER
Agrobacterium MEDIATED GENE TRANSFERAgrobacterium MEDIATED GENE TRANSFER
Agrobacterium MEDIATED GENE TRANSFER
GOKUL BAJAJ
 
Molecular tagging
Molecular tagging Molecular tagging
Molecular tagging
Dr. Kirti Mehta
 
Techniques in proteomics
Techniques in proteomicsTechniques in proteomics
Techniques in proteomics
Bahauddin Zakariya University lahore
 
Genome mapping
Genome mapping Genome mapping
Genome mapping
Rashmi Yadav
 
What is Epigenetics?
What is Epigenetics?What is Epigenetics?
What is Epigenetics?
Garry D. Lasaga
 
Proteomics
Proteomics   Proteomics
Proteomics
Mohit Bharti
 
Vector engineering and codon optimization
Vector engineering and codon optimizationVector engineering and codon optimization
Vector engineering and codon optimization
Piyush Jamwal
 
Transfection
TransfectionTransfection
Transfection
Achyut Bora
 
Comparative genomics
Comparative genomicsComparative genomics
Comparative genomicshemantbreeder
 
Agrobacterium mediated gene transformation
Agrobacterium mediated gene transformationAgrobacterium mediated gene transformation
Agrobacterium mediated gene transformation
awareswapnil1111
 

What's hot (20)

SAGE (Serial analysis of Gene Expression)
SAGE (Serial analysis of Gene Expression)SAGE (Serial analysis of Gene Expression)
SAGE (Serial analysis of Gene Expression)
 
Site directed mutagenesis
Site  directed mutagenesisSite  directed mutagenesis
Site directed mutagenesis
 
Epigenetics
EpigeneticsEpigenetics
Epigenetics
 
Overview of epigenetics and its role in disease
Overview of epigenetics and its role in diseaseOverview of epigenetics and its role in disease
Overview of epigenetics and its role in disease
 
oncogene as a transcription activator
oncogene as a transcription activatoroncogene as a transcription activator
oncogene as a transcription activator
 
Somatic cell genetics
Somatic cell geneticsSomatic cell genetics
Somatic cell genetics
 
Lambda vector
Lambda vectorLambda vector
Lambda vector
 
Functional genomics, and tools
Functional genomics, and toolsFunctional genomics, and tools
Functional genomics, and tools
 
Agrobacterium MEDIATED GENE TRANSFER
Agrobacterium MEDIATED GENE TRANSFERAgrobacterium MEDIATED GENE TRANSFER
Agrobacterium MEDIATED GENE TRANSFER
 
Molecular tagging
Molecular tagging Molecular tagging
Molecular tagging
 
Techniques in proteomics
Techniques in proteomicsTechniques in proteomics
Techniques in proteomics
 
Genome mapping
Genome mapping Genome mapping
Genome mapping
 
Transcriptomics
TranscriptomicsTranscriptomics
Transcriptomics
 
Gene transfer (2)
Gene transfer (2)Gene transfer (2)
Gene transfer (2)
 
What is Epigenetics?
What is Epigenetics?What is Epigenetics?
What is Epigenetics?
 
Proteomics
Proteomics   Proteomics
Proteomics
 
Vector engineering and codon optimization
Vector engineering and codon optimizationVector engineering and codon optimization
Vector engineering and codon optimization
 
Transfection
TransfectionTransfection
Transfection
 
Comparative genomics
Comparative genomicsComparative genomics
Comparative genomics
 
Agrobacterium mediated gene transformation
Agrobacterium mediated gene transformationAgrobacterium mediated gene transformation
Agrobacterium mediated gene transformation
 

Similar to The post-genomic era: epigenetic sequencing applications and data integration

2011 Rna Course Part 1
2011 Rna Course Part 12011 Rna Course Part 1
2011 Rna Course Part 1
ICGEB
 
The utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomas
The utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomasThe utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomas
The utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomas
Nukleer Tıp Uzmanı
 
transformers_multimodal_ehr.pdf
transformers_multimodal_ehr.pdftransformers_multimodal_ehr.pdf
transformers_multimodal_ehr.pdf
Paris Women in Machine Learning and Data Science
 
Webinar analyzing complex genomic variants in somatic cancer
Webinar  analyzing complex genomic variants in somatic cancer Webinar  analyzing complex genomic variants in somatic cancer
Webinar analyzing complex genomic variants in somatic cancer
Lisa Owen
 
Examining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencingExamining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencing
Stephen Turner
 
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
semualkaira
 
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
semualkaira
 
PET/MR imaging in neurodegenerative diseases
PET/MR imaging in neurodegenerative diseasesPET/MR imaging in neurodegenerative diseases
PET/MR imaging in neurodegenerative diseases
Walid Rezk
 
Brain PET imaging
Brain PET imagingBrain PET imaging
Brain PET imaging
Dr- Mustafa Ahmed Alazam
 
Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020
Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020 Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020
Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020
hivlifeinfo
 
2023 Mid-Year CPT/HCPCS Code Set Updates
2023 Mid-Year CPT/HCPCS Code Set Updates2023 Mid-Year CPT/HCPCS Code Set Updates
2023 Mid-Year CPT/HCPCS Code Set Updates
Health Catalyst
 
The Transforming Genetic Medicine Initiative (TGMI)
The Transforming Genetic Medicine Initiative (TGMI)The Transforming Genetic Medicine Initiative (TGMI)
The Transforming Genetic Medicine Initiative (TGMI)
Genome Reference Consortium
 
Aug2015 analysis team 10 mason epigentics
Aug2015 analysis team 10 mason epigenticsAug2015 analysis team 10 mason epigentics
Aug2015 analysis team 10 mason epigentics
GenomeInABottle
 
Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010
Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010
Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010
All India Institute of Medical Sciences
 
Genomic Epidemiology: How High Throughput Sequencing changed our view on bac...
Genomic Epidemiology:  How High Throughput Sequencing changed our view on bac...Genomic Epidemiology:  How High Throughput Sequencing changed our view on bac...
Genomic Epidemiology: How High Throughput Sequencing changed our view on bac...
João André Carriço
 
Lopez-Bigas talk at the EBI/EMBL Cancer Genomics Workshop
Lopez-Bigas talk at the EBI/EMBL Cancer Genomics WorkshopLopez-Bigas talk at the EBI/EMBL Cancer Genomics Workshop
Lopez-Bigas talk at the EBI/EMBL Cancer Genomics WorkshopNuria Lopez-Bigas
 
Incorporating New ART Options Into First-line and Switch Strategies for HIV C...
Incorporating New ART Options Into First-line and Switch Strategies for HIV C...Incorporating New ART Options Into First-line and Switch Strategies for HIV C...
Incorporating New ART Options Into First-line and Switch Strategies for HIV C...
hivlifeinfo
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Torsten Seemann
 
WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...
WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...
WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...
Scintica Instrumentation
 
Positron emission tomography wireless acquisition architecture
Positron emission tomography wireless acquisition architecturePositron emission tomography wireless acquisition architecture
Positron emission tomography wireless acquisition architecture
Toscana Open Research
 

Similar to The post-genomic era: epigenetic sequencing applications and data integration (20)

2011 Rna Course Part 1
2011 Rna Course Part 12011 Rna Course Part 1
2011 Rna Course Part 1
 
The utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomas
The utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomasThe utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomas
The utility of 18F-fluorocholine PET/CT in the imaging of parathyroid adenomas
 
transformers_multimodal_ehr.pdf
transformers_multimodal_ehr.pdftransformers_multimodal_ehr.pdf
transformers_multimodal_ehr.pdf
 
Webinar analyzing complex genomic variants in somatic cancer
Webinar  analyzing complex genomic variants in somatic cancer Webinar  analyzing complex genomic variants in somatic cancer
Webinar analyzing complex genomic variants in somatic cancer
 
Examining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencingExamining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencing
 
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
 
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
18F-FDG PET-CT Features of A Hemophagocytic Syndrome Secondary To A Metastati...
 
PET/MR imaging in neurodegenerative diseases
PET/MR imaging in neurodegenerative diseasesPET/MR imaging in neurodegenerative diseases
PET/MR imaging in neurodegenerative diseases
 
Brain PET imaging
Brain PET imagingBrain PET imaging
Brain PET imaging
 
Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020
Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020 Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020
Слайдсет о новом в лечении ВИЧ.Key Slides on What’s Hot in HIV Treatment.2020
 
2023 Mid-Year CPT/HCPCS Code Set Updates
2023 Mid-Year CPT/HCPCS Code Set Updates2023 Mid-Year CPT/HCPCS Code Set Updates
2023 Mid-Year CPT/HCPCS Code Set Updates
 
The Transforming Genetic Medicine Initiative (TGMI)
The Transforming Genetic Medicine Initiative (TGMI)The Transforming Genetic Medicine Initiative (TGMI)
The Transforming Genetic Medicine Initiative (TGMI)
 
Aug2015 analysis team 10 mason epigentics
Aug2015 analysis team 10 mason epigenticsAug2015 analysis team 10 mason epigentics
Aug2015 analysis team 10 mason epigentics
 
Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010
Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010
Dept of Neuro Surgery(JPNATC)-Head injuries audit 2010
 
Genomic Epidemiology: How High Throughput Sequencing changed our view on bac...
Genomic Epidemiology:  How High Throughput Sequencing changed our view on bac...Genomic Epidemiology:  How High Throughput Sequencing changed our view on bac...
Genomic Epidemiology: How High Throughput Sequencing changed our view on bac...
 
Lopez-Bigas talk at the EBI/EMBL Cancer Genomics Workshop
Lopez-Bigas talk at the EBI/EMBL Cancer Genomics WorkshopLopez-Bigas talk at the EBI/EMBL Cancer Genomics Workshop
Lopez-Bigas talk at the EBI/EMBL Cancer Genomics Workshop
 
Incorporating New ART Options Into First-line and Switch Strategies for HIV C...
Incorporating New ART Options Into First-line and Switch Strategies for HIV C...Incorporating New ART Options Into First-line and Switch Strategies for HIV C...
Incorporating New ART Options Into First-line and Switch Strategies for HIV C...
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
 
WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...
WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...
WEBINAR: Potential Role of Aspect Imaging’s Compact 1T Preclinical Scanner in...
 
Positron emission tomography wireless acquisition architecture
Positron emission tomography wireless acquisition architecturePositron emission tomography wireless acquisition architecture
Positron emission tomography wireless acquisition architecture
 

More from Maté Ongenaert

Unleash transcriptomics to gain insights in disease mechanisms: integration i...
Unleash transcriptomics to gain insights in disease mechanisms: integration i...Unleash transcriptomics to gain insights in disease mechanisms: integration i...
Unleash transcriptomics to gain insights in disease mechanisms: integration i...
Maté Ongenaert
 
Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...
Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...
Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...
Maté Ongenaert
 
Ecobouwers opendeur passiefhuis Lokeren
Ecobouwers opendeur passiefhuis LokerenEcobouwers opendeur passiefhuis Lokeren
Ecobouwers opendeur passiefhuis Lokeren
Maté Ongenaert
 
Workshop NGS data analysis - 3
Workshop NGS data analysis - 3Workshop NGS data analysis - 3
Workshop NGS data analysis - 3
Maté Ongenaert
 
ENCODE project: brief summary of main findings
ENCODE project: brief summary of main findingsENCODE project: brief summary of main findings
ENCODE project: brief summary of main findings
Maté Ongenaert
 
Workshop NGS data analysis - 2
Workshop NGS data analysis - 2Workshop NGS data analysis - 2
Workshop NGS data analysis - 2
Maté Ongenaert
 
Workshop NGS data analysis - 1
Workshop NGS data analysis - 1Workshop NGS data analysis - 1
Workshop NGS data analysis - 1
Maté Ongenaert
 
Bots & spiders
Bots & spidersBots & spiders
Bots & spiders
Maté Ongenaert
 
Exploring the neuroblastoma epigenome: perspectives for improved prognosis
Exploring the neuroblastoma epigenome: perspectives for improved prognosisExploring the neuroblastoma epigenome: perspectives for improved prognosis
Exploring the neuroblastoma epigenome: perspectives for improved prognosis
Maté Ongenaert
 
High-throughput proteomics: from understanding data to predicting them
High-throughput proteomics: from understanding data to predicting themHigh-throughput proteomics: from understanding data to predicting them
High-throughput proteomics: from understanding data to predicting them
Maté Ongenaert
 
Microarray data and pathway analysis: example from the bench
Microarray data and pathway analysis: example from the benchMicroarray data and pathway analysis: example from the bench
Microarray data and pathway analysis: example from the bench
Maté Ongenaert
 
Large scale machine learning challenges for systems biology
Large scale machine learning challenges for systems biologyLarge scale machine learning challenges for systems biology
Large scale machine learning challenges for systems biology
Maté Ongenaert
 
Integrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functionsIntegrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functions
Maté Ongenaert
 
Race against the sequencing machine: processing of raw DNA sequence data at t...
Race against the sequencing machine: processing of raw DNA sequence data at t...Race against the sequencing machine: processing of raw DNA sequence data at t...
Race against the sequencing machine: processing of raw DNA sequence data at t...
Maté Ongenaert
 
Bringing the data back to the researchers
Bringing the data back to the researchersBringing the data back to the researchers
Bringing the data back to the researchers
Maté Ongenaert
 
Introduction
IntroductionIntroduction
Introduction
Maté Ongenaert
 
Literature managment training
Literature managment trainingLiterature managment training
Literature managment trainingMaté Ongenaert
 
Scientific literature managment - exercises
Scientific literature managment - exercisesScientific literature managment - exercises
Scientific literature managment - exercises
Maté Ongenaert
 

More from Maté Ongenaert (18)

Unleash transcriptomics to gain insights in disease mechanisms: integration i...
Unleash transcriptomics to gain insights in disease mechanisms: integration i...Unleash transcriptomics to gain insights in disease mechanisms: integration i...
Unleash transcriptomics to gain insights in disease mechanisms: integration i...
 
Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...
Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...
Strong reversal of the lung fibrosis disease signature by autotaxin inhibitor...
 
Ecobouwers opendeur passiefhuis Lokeren
Ecobouwers opendeur passiefhuis LokerenEcobouwers opendeur passiefhuis Lokeren
Ecobouwers opendeur passiefhuis Lokeren
 
Workshop NGS data analysis - 3
Workshop NGS data analysis - 3Workshop NGS data analysis - 3
Workshop NGS data analysis - 3
 
ENCODE project: brief summary of main findings
ENCODE project: brief summary of main findingsENCODE project: brief summary of main findings
ENCODE project: brief summary of main findings
 
Workshop NGS data analysis - 2
Workshop NGS data analysis - 2Workshop NGS data analysis - 2
Workshop NGS data analysis - 2
 
Workshop NGS data analysis - 1
Workshop NGS data analysis - 1Workshop NGS data analysis - 1
Workshop NGS data analysis - 1
 
Bots & spiders
Bots & spidersBots & spiders
Bots & spiders
 
Exploring the neuroblastoma epigenome: perspectives for improved prognosis
Exploring the neuroblastoma epigenome: perspectives for improved prognosisExploring the neuroblastoma epigenome: perspectives for improved prognosis
Exploring the neuroblastoma epigenome: perspectives for improved prognosis
 
High-throughput proteomics: from understanding data to predicting them
High-throughput proteomics: from understanding data to predicting themHigh-throughput proteomics: from understanding data to predicting them
High-throughput proteomics: from understanding data to predicting them
 
Microarray data and pathway analysis: example from the bench
Microarray data and pathway analysis: example from the benchMicroarray data and pathway analysis: example from the bench
Microarray data and pathway analysis: example from the bench
 
Large scale machine learning challenges for systems biology
Large scale machine learning challenges for systems biologyLarge scale machine learning challenges for systems biology
Large scale machine learning challenges for systems biology
 
Integrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functionsIntegrative transcriptomics to study non-coding RNA functions
Integrative transcriptomics to study non-coding RNA functions
 
Race against the sequencing machine: processing of raw DNA sequence data at t...
Race against the sequencing machine: processing of raw DNA sequence data at t...Race against the sequencing machine: processing of raw DNA sequence data at t...
Race against the sequencing machine: processing of raw DNA sequence data at t...
 
Bringing the data back to the researchers
Bringing the data back to the researchersBringing the data back to the researchers
Bringing the data back to the researchers
 
Introduction
IntroductionIntroduction
Introduction
 
Literature managment training
Literature managment trainingLiterature managment training
Literature managment training
 
Scientific literature managment - exercises
Scientific literature managment - exercisesScientific literature managment - exercises
Scientific literature managment - exercises
 

Recently uploaded

From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
Product School
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
ThousandEyes
 
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdfFIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Tobias Schneck
 
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMsTo Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
Paul Groth
 
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
Product School
 
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdfFIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance
 
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
Sri Ambati
 
Key Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdfKey Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdf
Cheryl Hung
 
Elevating Tactical DDD Patterns Through Object Calisthenics
Elevating Tactical DDD Patterns Through Object CalisthenicsElevating Tactical DDD Patterns Through Object Calisthenics
Elevating Tactical DDD Patterns Through Object Calisthenics
Dorra BARTAGUIZ
 
Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........
Alison B. Lowndes
 
Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*
Frank van Harmelen
 
Designing Great Products: The Power of Design and Leadership by Chief Designe...
Designing Great Products: The Power of Design and Leadership by Chief Designe...Designing Great Products: The Power of Design and Leadership by Chief Designe...
Designing Great Products: The Power of Design and Leadership by Chief Designe...
Product School
 
UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4
DianaGray10
 
UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3
DianaGray10
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
KatiaHIMEUR1
 
Leading Change strategies and insights for effective change management pdf 1.pdf
Leading Change strategies and insights for effective change management pdf 1.pdfLeading Change strategies and insights for effective change management pdf 1.pdf
Leading Change strategies and insights for effective change management pdf 1.pdf
OnBoard
 
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdfFIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Product School
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
ControlCase
 

Recently uploaded (20)

From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
 
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdfFIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdf
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
 
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMsTo Graph or Not to Graph Knowledge Graph Architectures and LLMs
To Graph or Not to Graph Knowledge Graph Architectures and LLMs
 
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
 
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdfFIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
 
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
GenAISummit 2024 May 28 Sri Ambati Keynote: AGI Belongs to The Community in O...
 
Key Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdfKey Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdf
 
Elevating Tactical DDD Patterns Through Object Calisthenics
Elevating Tactical DDD Patterns Through Object CalisthenicsElevating Tactical DDD Patterns Through Object Calisthenics
Elevating Tactical DDD Patterns Through Object Calisthenics
 
Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........
 
Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*Neuro-symbolic is not enough, we need neuro-*semantic*
Neuro-symbolic is not enough, we need neuro-*semantic*
 
Designing Great Products: The Power of Design and Leadership by Chief Designe...
Designing Great Products: The Power of Design and Leadership by Chief Designe...Designing Great Products: The Power of Design and Leadership by Chief Designe...
Designing Great Products: The Power of Design and Leadership by Chief Designe...
 
UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4UiPath Test Automation using UiPath Test Suite series, part 4
UiPath Test Automation using UiPath Test Suite series, part 4
 
UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3UiPath Test Automation using UiPath Test Suite series, part 3
UiPath Test Automation using UiPath Test Suite series, part 3
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
 
Leading Change strategies and insights for effective change management pdf 1.pdf
Leading Change strategies and insights for effective change management pdf 1.pdfLeading Change strategies and insights for effective change management pdf 1.pdf
Leading Change strategies and insights for effective change management pdf 1.pdf
 
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdfFIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
 

The post-genomic era: epigenetic sequencing applications and data integration

  • 1. The post-genomic era Epigenetic sequencing applications and data integration WOUD mini-symposium28/09/2011 Maté Ongenaert Center for Medical Genetics Ghent University Hospital, Belgium
  • 2.
  • 3. Epigenetics > Introduction -genetics Heritable changes to the DNA or histones without affecting the DNA sequence A whole range of changes are described DNA-methylation Histonetailmodifications Methylation Acetylation Phosphorylation …. Epigenetic changes are interconnected
  • 5. Epigenetics > Introduction DNA-methylation Histone tail modifications
  • 6. Epigenetics > DNA-methylation DNA-methylationandcancer Global hypomethylation Localhypermethylation
  • 7. Epigenetics > Interplay Interplaybetween DNA-methylationandhistonemodifications
  • 8. Epigenetics > Detection / Prognosis / Prediction (Early) detection– diagnostic Diagnostic: who Screening programs
  • 9. Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment
  • 10. Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment
  • 11. Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment Biomarker
  • 12. Epigenetics > Detection / Prognosis / Prediction Prediction Predictive: what Treatment
  • 13. Epigenetics > Detection / Prognosis / Prediction Prediction Chemotherapy respons (MGMT in brain cancer - temozolomide)
  • 14.
  • 15.
  • 16. Sequencing the epigenome Shearing of DNA (Covaris) Sequencing Control of fragment sizeswith high sensitivity DNA chips Concentration determination of the fragmented DNA with Fluostar Optima plate reader MBD2 immunoprecipitation reaction (MethylCollector Kit)
  • 17. Sequencing the epigenome Sequencing data analysis
  • 19. Sequencing the epigenome Mapping @HWUSI-EAS100R:6:73:941:1973#0/1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTT +HWUSI-EAS100R:6:73:941:1973#0/1 !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC6 Identifier (Illumina machine name, lane, tile etc.) Sequence Sequencing quality
  • 20. Sequencing the epigenome Mapping bowtie -q -n --fr --phred64-quals -x 250 -t -p 4 hg19-1 qseq_2_MID5_W.fastq -2 qseq_2_MID5_C.fastq IMR32.bowtie Input FASTQ files (two: paired end) Mapping parameters: - q: quality aware (--phred64-quals: Iluminaquality scores instead of Phred)--fr: map on forward and reverse strand of the reference genome- x: map paired-end reads maximum 250 bp apart - p 4: use 4 processes to map (parallelization) - hg19: reference genome
  • 21. Sequencing the epigenome Mapping HWUSI-EAS509:4:34:13795:1029#0/1 + chr16 57608607 GTCAG… IIIII… 0 HWUSI-EAS509:4:34:13795:1029#0/3/2 - chr16 57608757 GTCCT… IIIII… 0 HWUSI-EAS509:4:34:6016:1041#0/3/2 + chr10 94410976 GTTTC… IIIII… 0 HWUSI-EAS509:4:34:6016:1041#0/1 - chr10 94411127 TGTTT… IIIHH… 0 HWUSI-EAS509:4:34:7281:1043#0/1 + chr4 54043731 GTCTA… IIIII… 0 Chromosomal location (strand, chromosome, pos) Quality of the mapping
  • 22. Sequencing the epigenome Mapping macs14 -t IMR32.bowtie -f BOWTIE -g hs -n IMR32 -w --single-wig Input: mapped “treatment” reads and format of mapping (you can also provide a control sample) Parameters:-g hs: human reference genome (for size estimation)- n: name of output files - w: create wig-files for visualisation (counts)
  • 23. Sequencing the epigenome Mapping Chrstart end length summit tags score fold_enrichment Chr1 14862 15572 711 227 17 86.37 13.55 Chr1 135001 135399 399 197 12 83.27 15.43 Chr1 229428 229950 523 329 10 62.41 14.03
  • 25. Sequencing the epigenome PCDHB-cluster (neuroblastoma CLs)
  • 26. Sequencing the epigenome PCDHB-cluster in neuroblastoma
  • 27. Sequencing the epigenome Integrating data sources… H3K27 me3 H3K36 me3 H3K4 me3 RNA-seq Promoter region Gene Body Active gene
  • 29. Conclusions Sequencingepigenomesreveals a wealth of information There is no suchthing as the epigenome Methylome Hydroxymethylome Different histonemodifications Don’tforget the interplayand the dynamics… Start exploring the data byyourselfas youknow the application the best
  • 30.