Sequencing data analysis
Workshop – part 1 / main principles and data formats



                       Outline

                     Introduction

                   Sequencing flow

        Main data formats throughout this flow




                   Maté Ongenaert
Introduction
Sequencing technology

The real cost of sequencing
Introduction
                                    Sequencing technology

                  The real cost of sequencing

                            Question:

     - What is the fraction of the cost of a NGS study of:
       (1) Sample collection and experimental design
                    (2) Sequencing itself
            (3) Data reduction and management
                  (4) Downstream analysis

Is this a surrealistic question? Not at all, think of you writing a
grant proposal and propose a NGS ChIP-seq experiment of 24
                              samples.

 You would need 3 HiSeq 2000 lanes that cost you        8000 €
 Sample preperation cost                                1000€
 Others                                                 1000 €
Do you ever include analysis costs?? Personel, infrastructure,…
Introduction
               Sequencing technology
The real cost of sequencing
Introduction
Sequencing technology
Introduction
Sequencing technology
Introduction
Sequencing technology
Introduction
Sequencing technology
Introduction
Sequencing technology
Sequencing data analysis
Workshop – part 1 / main principles and data formats



                       Outline

                     Introduction

                  Sequencing flow

        Main data formats throughout this flow




                   Maté Ongenaert
Sequencing flow
Steps in sequencing experiments

                         Data analysis

              Raw machine reads… What’s next?

             Preprocessing (machine/technology)
              - adaptors, indexes, conversions,…
              - machine/technology dependent

           Reads with associated qualities (universal)
                           - FASTQ
                         - QC check

         Depending on application (general applicable)
     - ‘de novo’ assembly of genome (bacterial genomes,…)
      - Mapping to a reference genome  mapped reads
                       - SAM/BAM/…

          High-level analysis (specific for application)
                         - SNP calling
                        - Peak calling
Sequencing flow
Steps in sequencing experiments
Sequencing data analysis
Workshop – part 1 / main principles and data formats



                       Outline

                     Introduction

                   Sequencing flow

        Main data formats throughout this flow




                   Maté Ongenaert
Sequencing flow
                         Steps in sequencing experiments




                                    Main data formats:
                                       - Raw reads
                                     - Mapped reads
- Application dependent: ChIP-seq peaks, SNPs: their location and their characteristics
 > Intended for: visualization / further analysis (by humans or computers) / reduction ??
Sequencing data formats
                                                                    Raw reads

                                                            Raw sequence reads:

- Represent the sequence ~ FASTA
     >SEQUENCE_IDENTIFIER
     GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT


- Extension: represent the quality, per base ~ FASTQ – Q for quality
     @SEQUENCE_IDENTIFIER
     GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
     +
     !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65



- OK, the strange signs at the last line indicate the quality at the corresponding base…
  But what’s the decoding scheme? (Nerd alert ahead !!)
- We want to represent quality scores ~ Phred scores
- Q= -10 log P (with P being the chance of a base called in error)
Phred quality scores are logarithmically linked to error probabilities
                                 Probability of incorrect
     Phred Quality Score                                            Base call accuracy
                                       base call
20                            1 in 100                       99 %
30                            1 in 1000                      99.9 %
40                            1 in 10000                     99.99 %
Sequencing data formats
                                       Raw reads

- Phred scores thus typically have 2 digits – you want one digit to allow correspondance
  in the file… What would a nerd do? Use ASCII as lookup-table of course!  one
  character ~ one decimal number
Sequencing data formats
                                             Raw reads
@SEQUENCE_IDENTIFIER
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

 - Ok, thus 5 actually is 53… But the real charachters only start at 33… So 5 is actually 53 -
   33 = 20 phred quality…
Sequencing data formats
                                              Raw reads
@SEQUENCE_IDENTIFIER
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Example of the identifier line for Illumina data (non-multiplexed):

#@machine_id:lane:tile:x:y:multiplex:pair
@HWUSI-EAS100R:6:73:941:1973#0/1



 -   Phred + 33  Sanger
 -   Illumina 1.3 +  Phred +64
 -   Illumina 1.5 +  Phred +64
 -   Illumina 1.8 +  Phred +33
 -   Solid  Sanger

 Check your instument + version  FastQC will give you a hint which scoring scheme is
 probably used

 Extensions: FASTQ / FQ
Sequencing data formats
                                        Raw reads




- Special: SRA files from NCBI/EBI Sequence Read Archive
- Contains raw sequence data from (GEO) studies for all kinds of instruments and
  platforms
- Exercice: we have submitted NGS (MBD-seq) for 8 NB cell lines into GEO and the raw
  data in SRA, find the SRA files. How would you obtain our originally submitted FASTQ
  files? (HINT: SRA Toolkit)
- Exercice (caution: nerd alert): working in the terminal… Retrieve the FASTQ file from
  the SRA file and perform FastQC analysis
Linux… for human beings?
         The terminal

    What they show in ‘The matrix’ is a real Linux-terminal and
    real commands…
Linux… for human beings?
       The terminal
Linux… for human beings?
       The terminal

                       Server: ***********
                       Port: *****

                       Login: *********
                       Pasw: *********
                       You will not see that you
                       are typing something…
Linux… for human beings?
                                       The terminal

                                                      You are interactively
                                                      logged in now! Meaning
                                                      everything you type is sent
                                                      to the server and executed

                                                      + Fast, no eye-candy
                                                      + Easy to develop a
                                                      command-line interface

                                                      - Not so intuitive
                                                      - Steep learning curve
                                                      - High nerd-level


You may have to type bash to see a line that
starts with student@mellfire:/home/student

Where are you?
/ is root
/home is the folder with user documents
Linux… for human beings?
                                           The terminal

cd
Change directory - cd .. (go to higher level) – cd ../../..

mkdir
Make directory (is a folder)

cp
Copy

mv
Move

ls (-ahl)
List all contents of a folder (DOS: dir)

rm
Remove (DOS: del)

man
Manual (Q to quit man)
Linux… for human beings?
                                             The terminal

vi
Text editor (:q! to exit from vi)

head and tail
See first lines / last lines of a textfile

top
Table of processes

who and whoami
Lists of users logged in and useful command for people with schizophrenia
Linux… for human beings?
       The terminal
Sequencing data formats
                                                                       Mapped reads

- Mapping: ‘align’ these raw reads to a reference genome
- Single-end or paired-end data?
- How would you align a short read to the reference?

- Old-school: Smith-Watherman, BLAST, BLAT,…
- Now: mapping tools for short reads that use intelligent indexing and allow mismatches

                                                             Algorithm
                                                                                                                                   Other features
                               Hash table                       Suffix tree                  Merge sorting
                            Hash        Hash                        Enhanced
    Program   Reference                          Suffix tree                      FM-index   Merge sorting   Colorspace   454   Quality   Paired end   Long reads   Bisulfite
                          reference     reads                      suffix array
     SOAP       [51]         X                                                                                                    X           X            X
     MAQ        [54]                     X                                                                       X                X           X                        X
    Mosaik                   X                                                                                   X                X           X            X
     Eland                               X                                                                                        X
   SSAHA2       [61]         X                                                                                                                X            X
    Bowtie      [67]                                                                 X                           X                X           X
     BWA        [69]                                                                 X                           X                            X            X
   BWA-SW       [69]                                                                 X                           X        X                   X            X
    SOAP2       [70]                                                                 X                           X                X           X            X
Sequencing data formats
                                      Mapped reads

- Most commonly used worldwide and in our lab as well: BWA and Bowtie, both using
  Burrows-Wheeler transformations and FM indexes
- Optimized for short NGS reads (from about 30 bp to +- 200 bp)
- Versions exist for longer reads (such as 454): Bowtie2 and BWA-SW

-   What would a file contain, describing mapped reads?
-   Position: chr / start / stop
-   Sequence: read / references
-   Mismatches / indels / vs. the reference
-   Quality informations

- Few years ago, each tool had its own output format  Bowtie,…
- Now moving to a common file format  SAM / BAM (Sequence Alignment/Map)
Sequencing data formats
                                 Mapped reads

- Now moving to a common file format  SAM / BAM (Sequence Alignment/Map)
DESCRIPTION OF THE 11 FIELDS IN THE ALIGNMENT SECTION

# QNAME: template name
#FLAG
#RNAME: reference name
# POS: mapping position
#MAPQ: mapping quality
#CIGAR: CIGAR string
#RNEXT: reference name of the mate/next fragment
#PNEXT: position of the mate/next fragment
#TLEN: observed template length
#SEQ: fragment sequence
#QUAL: ASCII of Phred-scale base quality+33

#Headers
@HD VN:1.3 SO:coordinate
@SQ SN:ref LN:45

#Alignment block
r001 163 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r002 0 ref 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA * NM:i:1
r004 0 ref 16 30 6M14N5M * 0 0 ATAGCTTCAGC *
Sequencing data formats
                                     Mapped reads

- BAM: binary version of SAM: not human readable but indexed for fast access for other
  tools / visualisation / …

- Exercise: view a BAM file in IGV
Sequencing data formats
                                            Other formats

- BED files (location / annotation / scores): Browser Extensible Data
Used for mapping / annotation / peak locations / - extension: bigBED (binary)
FIELDS USED:
# chr
# start
# end
# name
# score
# strand

track   name=pairedReads description="Clone Paired Reads" useScore=1
#chr    start end name score strand
chr22   1000 5000 cloneA 960 +
chr22   2000 6000 cloneB 900 –


- BEDGraph files (location, combined with score)
Used to represent peak scores
track type=bedGraph name="BedGraph Format" description="BedGraph format"
visibility=full color=200,100,0 altColor=0,100,200 priority=20
#chr start    end      score
chr19 59302000 59302300 -1.0
chr19 59302300 59302600 -0.75
chr19 59302600 59302900 -0.50
Sequencing data formats
                                           Other formats

- WIG files (location / annotation / scores): wiggle
Used for visulization or summarize data, in most cases count data or normalized count
data (RPKM) – extension: BigWig – binary versions (often used in GEO for ChIP-seq peaks)




browser position chr19:59304200-59310700
browser hide all

#150 base wide bar graph at arbitrarily spaced positions,
#threshold line drawn at y=11.76
#autoScale off viewing range set to [0:25]
#priority = 10 positions this as the first graph

track type=wiggle_0 name="variableStep" description="variableStep format"
visibility=full autoScale=off viewLimits=0.0:25.0 color=50,150,255
yLineMark=11.76 yLineOnOff=on priority=10
variableStep chrom=chr19 span=150
59304701 10.0
59304901 12.5
59305401 15.0
59305601 17.5
59305901 20.0
59306081 17.5
Sequencing data formats
                                      Other formats

- GFF format (General Feature Format)
Used for annotation of genetic / genomic features – such as all coding genes in Ensembl
Often used in downstream analysis to assign annotation to regions / peaks / …
FIELDS USED:

# seqname (the name of the sequence)
# source (the program that generated this feature)
# feature (the name of this type of feature – for example: exon)
# start (the starting position of the feature in the sequence)
# end (the ending position of the feature)
# score (a score between 0 and 1000)
# strand (valid entries include '+', '-', or '.')
# frame (if the feature is a coding exon, frame should be a number between
0-2 that represents the reading frame of the first base. If the feature is
not a coding exon, the value should be '.'.)
# group (all lines with the same group are linked together into a single
item)

track name=regulatory description="TeleGene(tm)    Regulatory Regions"
#chr   source   feature   start    end   scores    tr fr group
chr22 TeleGene enhancer 1000000 1001000 500        + . touch1
chr22 TeleGene promoter 1010000 1010100 900        + . touch1
chr22 TeleGene promoter 1020000 1020000 800        - . touch2
Sequencing data formats
                                     Other formats

- VCF format (Variant Call Format)
For SNP representation
Sequencing data formats
                                    Other formats

- http://genome.ucsc.edu/FAQ/FAQformat.html

- UCSC brower data formats, including all most commonly used formats that are
  accepted and widely used

- In addition, ENCODE data formats (narrowPeak / broadPEAK)
Blok
de   Van…
       ETER

Workshop NGS data analysis - 1

  • 1.
    Sequencing data analysis Workshop– part 1 / main principles and data formats Outline Introduction Sequencing flow Main data formats throughout this flow Maté Ongenaert
  • 2.
  • 3.
    Introduction Sequencing technology The real cost of sequencing Question: - What is the fraction of the cost of a NGS study of: (1) Sample collection and experimental design (2) Sequencing itself (3) Data reduction and management (4) Downstream analysis Is this a surrealistic question? Not at all, think of you writing a grant proposal and propose a NGS ChIP-seq experiment of 24 samples. You would need 3 HiSeq 2000 lanes that cost you 8000 € Sample preperation cost 1000€ Others 1000 € Do you ever include analysis costs?? Personel, infrastructure,…
  • 4.
    Introduction Sequencing technology The real cost of sequencing
  • 5.
  • 6.
  • 7.
  • 8.
  • 9.
  • 10.
    Sequencing data analysis Workshop– part 1 / main principles and data formats Outline Introduction Sequencing flow Main data formats throughout this flow Maté Ongenaert
  • 11.
    Sequencing flow Steps insequencing experiments Data analysis Raw machine reads… What’s next? Preprocessing (machine/technology) - adaptors, indexes, conversions,… - machine/technology dependent Reads with associated qualities (universal) - FASTQ - QC check Depending on application (general applicable) - ‘de novo’ assembly of genome (bacterial genomes,…) - Mapping to a reference genome  mapped reads - SAM/BAM/… High-level analysis (specific for application) - SNP calling - Peak calling
  • 12.
    Sequencing flow Steps insequencing experiments
  • 13.
    Sequencing data analysis Workshop– part 1 / main principles and data formats Outline Introduction Sequencing flow Main data formats throughout this flow Maté Ongenaert
  • 14.
    Sequencing flow Steps in sequencing experiments Main data formats: - Raw reads - Mapped reads - Application dependent: ChIP-seq peaks, SNPs: their location and their characteristics > Intended for: visualization / further analysis (by humans or computers) / reduction ??
  • 15.
    Sequencing data formats Raw reads Raw sequence reads: - Represent the sequence ~ FASTA >SEQUENCE_IDENTIFIER GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT - Extension: represent the quality, per base ~ FASTQ – Q for quality @SEQUENCE_IDENTIFIER GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 - OK, the strange signs at the last line indicate the quality at the corresponding base… But what’s the decoding scheme? (Nerd alert ahead !!) - We want to represent quality scores ~ Phred scores - Q= -10 log P (with P being the chance of a base called in error) Phred quality scores are logarithmically linked to error probabilities Probability of incorrect Phred Quality Score Base call accuracy base call 20 1 in 100 99 % 30 1 in 1000 99.9 % 40 1 in 10000 99.99 %
  • 16.
    Sequencing data formats Raw reads - Phred scores thus typically have 2 digits – you want one digit to allow correspondance in the file… What would a nerd do? Use ASCII as lookup-table of course!  one character ~ one decimal number
  • 17.
    Sequencing data formats Raw reads @SEQUENCE_IDENTIFIER GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 - Ok, thus 5 actually is 53… But the real charachters only start at 33… So 5 is actually 53 - 33 = 20 phred quality…
  • 18.
    Sequencing data formats Raw reads @SEQUENCE_IDENTIFIER GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Example of the identifier line for Illumina data (non-multiplexed): #@machine_id:lane:tile:x:y:multiplex:pair @HWUSI-EAS100R:6:73:941:1973#0/1 - Phred + 33  Sanger - Illumina 1.3 +  Phred +64 - Illumina 1.5 +  Phred +64 - Illumina 1.8 +  Phred +33 - Solid  Sanger Check your instument + version  FastQC will give you a hint which scoring scheme is probably used Extensions: FASTQ / FQ
  • 19.
    Sequencing data formats Raw reads - Special: SRA files from NCBI/EBI Sequence Read Archive - Contains raw sequence data from (GEO) studies for all kinds of instruments and platforms - Exercice: we have submitted NGS (MBD-seq) for 8 NB cell lines into GEO and the raw data in SRA, find the SRA files. How would you obtain our originally submitted FASTQ files? (HINT: SRA Toolkit) - Exercice (caution: nerd alert): working in the terminal… Retrieve the FASTQ file from the SRA file and perform FastQC analysis
  • 20.
    Linux… for humanbeings? The terminal What they show in ‘The matrix’ is a real Linux-terminal and real commands…
  • 21.
    Linux… for humanbeings? The terminal
  • 22.
    Linux… for humanbeings? The terminal Server: *********** Port: ***** Login: ********* Pasw: ********* You will not see that you are typing something…
  • 23.
    Linux… for humanbeings? The terminal You are interactively logged in now! Meaning everything you type is sent to the server and executed + Fast, no eye-candy + Easy to develop a command-line interface - Not so intuitive - Steep learning curve - High nerd-level You may have to type bash to see a line that starts with student@mellfire:/home/student Where are you? / is root /home is the folder with user documents
  • 24.
    Linux… for humanbeings? The terminal cd Change directory - cd .. (go to higher level) – cd ../../.. mkdir Make directory (is a folder) cp Copy mv Move ls (-ahl) List all contents of a folder (DOS: dir) rm Remove (DOS: del) man Manual (Q to quit man)
  • 25.
    Linux… for humanbeings? The terminal vi Text editor (:q! to exit from vi) head and tail See first lines / last lines of a textfile top Table of processes who and whoami Lists of users logged in and useful command for people with schizophrenia
  • 26.
    Linux… for humanbeings? The terminal
  • 27.
    Sequencing data formats Mapped reads - Mapping: ‘align’ these raw reads to a reference genome - Single-end or paired-end data? - How would you align a short read to the reference? - Old-school: Smith-Watherman, BLAST, BLAT,… - Now: mapping tools for short reads that use intelligent indexing and allow mismatches Algorithm Other features Hash table Suffix tree Merge sorting Hash Hash Enhanced Program Reference Suffix tree FM-index Merge sorting Colorspace 454 Quality Paired end Long reads Bisulfite reference reads suffix array SOAP [51] X X X X MAQ [54] X X X X X Mosaik X X X X X Eland X X SSAHA2 [61] X X X Bowtie [67] X X X X BWA [69] X X X X BWA-SW [69] X X X X X SOAP2 [70] X X X X X
  • 28.
    Sequencing data formats Mapped reads - Most commonly used worldwide and in our lab as well: BWA and Bowtie, both using Burrows-Wheeler transformations and FM indexes - Optimized for short NGS reads (from about 30 bp to +- 200 bp) - Versions exist for longer reads (such as 454): Bowtie2 and BWA-SW - What would a file contain, describing mapped reads? - Position: chr / start / stop - Sequence: read / references - Mismatches / indels / vs. the reference - Quality informations - Few years ago, each tool had its own output format  Bowtie,… - Now moving to a common file format  SAM / BAM (Sequence Alignment/Map)
  • 29.
    Sequencing data formats Mapped reads - Now moving to a common file format  SAM / BAM (Sequence Alignment/Map) DESCRIPTION OF THE 11 FIELDS IN THE ALIGNMENT SECTION # QNAME: template name #FLAG #RNAME: reference name # POS: mapping position #MAPQ: mapping quality #CIGAR: CIGAR string #RNEXT: reference name of the mate/next fragment #PNEXT: position of the mate/next fragment #TLEN: observed template length #SEQ: fragment sequence #QUAL: ASCII of Phred-scale base quality+33 #Headers @HD VN:1.3 SO:coordinate @SQ SN:ref LN:45 #Alignment block r001 163 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG * r002 0 ref 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * NM:i:1 r004 0 ref 16 30 6M14N5M * 0 0 ATAGCTTCAGC *
  • 30.
    Sequencing data formats Mapped reads - BAM: binary version of SAM: not human readable but indexed for fast access for other tools / visualisation / … - Exercise: view a BAM file in IGV
  • 31.
    Sequencing data formats Other formats - BED files (location / annotation / scores): Browser Extensible Data Used for mapping / annotation / peak locations / - extension: bigBED (binary) FIELDS USED: # chr # start # end # name # score # strand track name=pairedReads description="Clone Paired Reads" useScore=1 #chr start end name score strand chr22 1000 5000 cloneA 960 + chr22 2000 6000 cloneB 900 – - BEDGraph files (location, combined with score) Used to represent peak scores track type=bedGraph name="BedGraph Format" description="BedGraph format" visibility=full color=200,100,0 altColor=0,100,200 priority=20 #chr start end score chr19 59302000 59302300 -1.0 chr19 59302300 59302600 -0.75 chr19 59302600 59302900 -0.50
  • 32.
    Sequencing data formats Other formats - WIG files (location / annotation / scores): wiggle Used for visulization or summarize data, in most cases count data or normalized count data (RPKM) – extension: BigWig – binary versions (often used in GEO for ChIP-seq peaks) browser position chr19:59304200-59310700 browser hide all #150 base wide bar graph at arbitrarily spaced positions, #threshold line drawn at y=11.76 #autoScale off viewing range set to [0:25] #priority = 10 positions this as the first graph track type=wiggle_0 name="variableStep" description="variableStep format" visibility=full autoScale=off viewLimits=0.0:25.0 color=50,150,255 yLineMark=11.76 yLineOnOff=on priority=10 variableStep chrom=chr19 span=150 59304701 10.0 59304901 12.5 59305401 15.0 59305601 17.5 59305901 20.0 59306081 17.5
  • 33.
    Sequencing data formats Other formats - GFF format (General Feature Format) Used for annotation of genetic / genomic features – such as all coding genes in Ensembl Often used in downstream analysis to assign annotation to regions / peaks / … FIELDS USED: # seqname (the name of the sequence) # source (the program that generated this feature) # feature (the name of this type of feature – for example: exon) # start (the starting position of the feature in the sequence) # end (the ending position of the feature) # score (a score between 0 and 1000) # strand (valid entries include '+', '-', or '.') # frame (if the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'.) # group (all lines with the same group are linked together into a single item) track name=regulatory description="TeleGene(tm) Regulatory Regions" #chr source feature start end scores tr fr group chr22 TeleGene enhancer 1000000 1001000 500 + . touch1 chr22 TeleGene promoter 1010000 1010100 900 + . touch1 chr22 TeleGene promoter 1020000 1020000 800 - . touch2
  • 34.
    Sequencing data formats Other formats - VCF format (Variant Call Format) For SNP representation
  • 35.
    Sequencing data formats Other formats - http://genome.ucsc.edu/FAQ/FAQformat.html - UCSC brower data formats, including all most commonly used formats that are accepted and widely used - In addition, ENCODE data formats (narrowPeak / broadPEAK)
  • 36.
    Blok de Van… ETER