Ti PLASMID AS A VECTOR
By
KAUSHAL KUMAR SAHU
Assistant Professor (Ad Hoc)
Department of Biotechnology
Govt. Digvijay Autonomous P. G. College
Raj-Nandgaon ( C. G. )
 Introduction
 Ti plasmid
 Agrobacterium tumefaciens
 Ti plasmid structure
 Overview of infection process
 Ti plasmid derived vector systems
 Cointegrate vectors
 Binary vectors
 Agrobacterium mediated transformation of explants
 Conclusions
 References
INTRODUCTION
WHAT ARE PLASMIDS ?
PLASMIDS are double stranded, closed circular DNA molecules, which
exist in the cell as extra chromosomal units.
PLASMIDS carry genes that may benefit survival of the organism (e.g.
antibiotic resistance), and can frequently be transmitted from one
bacterium to another (even of another species) via horizontal gene
transfer.
Plasmids are considered replicons, capable of replicating autonomously
within a suitable host.
Engineered plasmids are widely used as vectors in molecular cloning
Ti plasmid
Ti plasmid is a tumor-inducing plasmid or tumor induction plasmid.
It is the plasmid of Agrobacterium tumefaciens bacteria, the cells of virulent
strains of A. tumefaciens contain, besides the chromosomal DNA, a small circular
non-chromosomal DNA called Ti-plasmid, which carries ancillary genes such as
those affecting pathogenicity and metabolism of opines.
Agrobacterium tumefaciens
A. tumefaciens is a gram-negative soil bacterium
which naturally transforms plant cells, resulting in
crown gall (cancer) tumors.
Tumor formation is the result of the transfer,
integration and expression of genes on a specific
segment of A. tumefaciens plasmid DNA called the
T-DNA (transferred DNA).
The T-DNA resides on a large plasmid called the
Ti (tumor inducing) plasmid found in A. tumefaciens.
Ti plasmid structure
Conjugative
transfer
T-DNA STRUCTURE
LB RB
SHOOTY LOCUS ROOTY LOCUS
ONC REGION
tms2 tms1 tmr
ocs
GGCAGGATATATTCAATTGTAA GGCAGGATATATACCGTTGTAAT
VIR GENES
Vir genes Functions
Vir A, Vir G Sense phenolic compounds from wounded plant cells
and induce expression
of other virulence genes
Vir D2 Endonuclease; cuts T-DNA at right border to initiate T-
strand synthesis, also guides the T-DNA complex
through the nuclear pores
Vir E2 Binds to T-strand protecting it from nuclease attack, and
intercalates
with lipids to form channels in the plant membranes
through which the T-complex passes
Vir B, Vir D4 Required for Export of the T-complex and Vir E2 into the
plant cell.
Overview of the Infection Process
Phenolics
Produced by
Wounded
Plant cell
PLANT CELL
AGROBACTERIUM
VirA VirG
Phenolics
detected by the
VirA/VirG two
component
sensor system.
Vir Gene
expression
induced
T-DNA
Vir D1 & D2 cut
T-DNA at right
and left borders.
VirD2 attaches to
exposed 5I end
VIP1 associates with
the complex to target
it to the nucleus
VIP2 associates the
complex to
transcriptionally
active DNAT-DNA integrates into plant DNA
and gall production is initiated.
Gall Formation!
Formation of T-complex
Bacterial
Plasmid
Formation of T-Pilus
Contd….
The plant cells in the tumor acquire two new properties:-
 They show phytohormone independent growth.
 They contain one or more of unusual amino acid derivatives known as opines.
 Ti plasmids can be classified according to the opines produced :-
Nopaline plasmids : carry gene for synthesizing neopaline in the plant and for
utilization (catabolism) in the bacteria.
Octopine plasmids : carry genes to synthesize octopine in the plant and
catabolism in the bacteria.
Agropine plasmids : carry genes for agropine synthesis and catabolism.
Ti Plasmid-Derived Vector Systems
 Using Ti plasmid as a vector it is possible to insert a desired DNA sequence
(gene) into the T DNA region of Ti plasmid.
 There are several limitations to use Ti plasmids directly as cloning vectors :-
 LARGE SIZE.
 TUMOR INDUCTION PROPERTY.
 ABSENCE OF UNIQUE RESTRICTION SITES.
Contd…
Agrobacterium plasmids are disarmed by deleting naturally occurring T-
DNA encoded oncogenes and replacing them with foreign genes of interest.
 The right border sequence of T-DNA which is required for T-DNA
integration.
 A multiple cloning site.
 An origin of replication
 A selectable marker gene
TWO TYPES OF Ti plasmid derived vectors are used for genetic
transformation of plants :-
COINTEGRATE VECTORS
BINARY VECTORS
COINTEGRATE VECTORS
Cointegrate vector is produced by integrating the modified E.coli plasmid
into a disarmed pTi.
Cointegration is achieved within Agrobacterium by homologous
recombination.
The E.coli plasmid pGV1103 and the disarmed pTi must have some
sequences common in both for recombination to occur.
pTi is disarmed by replacing its oncogenes with sequences from E.coli
plasmid.
The pGV1103 is modified to produce an intermediate vector.
Origin of replication in E.coli.
Selectable markers e.g. neo gene for selection of transformed plant cells.
Kanamycin resistance for selection of Cointegrate vector in
Agrobacterium.
COINTEGRATE VECTORSE
pRK 2013
pTi
E.coli
E.coli
Agrobacterium
conjugation
BINARY VECTORS
A binary vector consists of a pair of plasmids of which one plasmid
contains disarmed T-DNA sequences, while the other contains the Vir region
and lacks the entire T-DNA including borders.
Plasmid containing disarmed T-DNA is called mini-Ti e.g. Bin19.
Plasmid containing only Vir genes is called a helper plasmid.
The DNA insert is integrated within the T-region of mini-Ti ,and is
cloned in E.coli.
Pal4404 helper Ti plasmid is derived from the wild type pTiAch5 by
deletion of entire T-region.
The recombinant mini Ti Bin 19 is introduced into Agrobacterium by
conjugation.
The Vir genes present in helper Pal4404 induce transfer of T-DNA into
plant cells.
Agrobacterium mediated transformation
Agrobacterium mediated plant transformation techniques are extensively
utilized to generate transgenic plants.
The important requirements for Agrobacterium-mediated gene transfer in
higher plants are as follows:-
 The plant explants must produce acetosyringone for activation of Vir
genes.
 The induced Agrobacterium should have access to cells that are
competent for transformation.
 Transformation competent cells should be able to regenerate into
whole plants.
Explants include cotyledon, leaf, thin tissue layer, peduncle, hypocotyls,
stem, microspores has been used to obtain transgenic plants by this method.
Explants
(cotyledon, hypocotyls, microspore)
Co-cultivation to allow infection
Transformed and non-transformed tissue
Transformed tissue/callus
Transformed shoots
Rooted shoots
Adult plants
Antibiotics to kill bacteria
(carbenicillin, cefotaxime)
Selective media to kill non transformed
tissues (addition of Kanamycin
AGROBACTERIUM MEDIATED TRANSFORMATION OF
EXPLANTS
Wounding
Agrobacterium
CONCLUSIONS
 Agrobacterium tumefaciens is a natural tool for plant transformation .
 Agrobacterium is capable of infecting intact plant cells tissues and organs. As a
result tissue culture limitations are much less of a problem. Transformed plants can be
regenerated more rapidly.
 Agrobacterium is capable of transferring large fragments of DNA very efficiently
without substantial rearrangements.
 The stability of gene transferred is excellent.
REFERENCES
 http://arabidopsis.info/students/agrobacterium/mechanism.html
 H.S.Chawala Introduction to Plant Biotechnology - 2nd edition
 B.D.Singh Biotechnology Expanding Horizon - 3rd edition
 S.S.Bhojwani M.K.Razdan Plant Tissue Culture – reprint 2004

Ti plasmid as a vector,

  • 1.
    Ti PLASMID ASA VECTOR By KAUSHAL KUMAR SAHU Assistant Professor (Ad Hoc) Department of Biotechnology Govt. Digvijay Autonomous P. G. College Raj-Nandgaon ( C. G. )
  • 2.
     Introduction  Tiplasmid  Agrobacterium tumefaciens  Ti plasmid structure  Overview of infection process  Ti plasmid derived vector systems  Cointegrate vectors  Binary vectors  Agrobacterium mediated transformation of explants  Conclusions  References
  • 3.
    INTRODUCTION WHAT ARE PLASMIDS? PLASMIDS are double stranded, closed circular DNA molecules, which exist in the cell as extra chromosomal units. PLASMIDS carry genes that may benefit survival of the organism (e.g. antibiotic resistance), and can frequently be transmitted from one bacterium to another (even of another species) via horizontal gene transfer. Plasmids are considered replicons, capable of replicating autonomously within a suitable host. Engineered plasmids are widely used as vectors in molecular cloning
  • 4.
    Ti plasmid Ti plasmidis a tumor-inducing plasmid or tumor induction plasmid. It is the plasmid of Agrobacterium tumefaciens bacteria, the cells of virulent strains of A. tumefaciens contain, besides the chromosomal DNA, a small circular non-chromosomal DNA called Ti-plasmid, which carries ancillary genes such as those affecting pathogenicity and metabolism of opines.
  • 5.
    Agrobacterium tumefaciens A. tumefaciensis a gram-negative soil bacterium which naturally transforms plant cells, resulting in crown gall (cancer) tumors. Tumor formation is the result of the transfer, integration and expression of genes on a specific segment of A. tumefaciens plasmid DNA called the T-DNA (transferred DNA). The T-DNA resides on a large plasmid called the Ti (tumor inducing) plasmid found in A. tumefaciens.
  • 6.
  • 7.
    T-DNA STRUCTURE LB RB SHOOTYLOCUS ROOTY LOCUS ONC REGION tms2 tms1 tmr ocs GGCAGGATATATTCAATTGTAA GGCAGGATATATACCGTTGTAAT
  • 8.
    VIR GENES Vir genesFunctions Vir A, Vir G Sense phenolic compounds from wounded plant cells and induce expression of other virulence genes Vir D2 Endonuclease; cuts T-DNA at right border to initiate T- strand synthesis, also guides the T-DNA complex through the nuclear pores Vir E2 Binds to T-strand protecting it from nuclease attack, and intercalates with lipids to form channels in the plant membranes through which the T-complex passes Vir B, Vir D4 Required for Export of the T-complex and Vir E2 into the plant cell.
  • 9.
    Overview of theInfection Process Phenolics Produced by Wounded Plant cell PLANT CELL AGROBACTERIUM VirA VirG Phenolics detected by the VirA/VirG two component sensor system. Vir Gene expression induced T-DNA Vir D1 & D2 cut T-DNA at right and left borders. VirD2 attaches to exposed 5I end VIP1 associates with the complex to target it to the nucleus VIP2 associates the complex to transcriptionally active DNAT-DNA integrates into plant DNA and gall production is initiated. Gall Formation! Formation of T-complex Bacterial Plasmid Formation of T-Pilus
  • 10.
    Contd…. The plant cellsin the tumor acquire two new properties:-  They show phytohormone independent growth.  They contain one or more of unusual amino acid derivatives known as opines.  Ti plasmids can be classified according to the opines produced :- Nopaline plasmids : carry gene for synthesizing neopaline in the plant and for utilization (catabolism) in the bacteria. Octopine plasmids : carry genes to synthesize octopine in the plant and catabolism in the bacteria. Agropine plasmids : carry genes for agropine synthesis and catabolism.
  • 11.
    Ti Plasmid-Derived VectorSystems  Using Ti plasmid as a vector it is possible to insert a desired DNA sequence (gene) into the T DNA region of Ti plasmid.  There are several limitations to use Ti plasmids directly as cloning vectors :-  LARGE SIZE.  TUMOR INDUCTION PROPERTY.  ABSENCE OF UNIQUE RESTRICTION SITES.
  • 12.
    Contd… Agrobacterium plasmids aredisarmed by deleting naturally occurring T- DNA encoded oncogenes and replacing them with foreign genes of interest.  The right border sequence of T-DNA which is required for T-DNA integration.  A multiple cloning site.  An origin of replication  A selectable marker gene TWO TYPES OF Ti plasmid derived vectors are used for genetic transformation of plants :- COINTEGRATE VECTORS BINARY VECTORS
  • 13.
    COINTEGRATE VECTORS Cointegrate vectoris produced by integrating the modified E.coli plasmid into a disarmed pTi. Cointegration is achieved within Agrobacterium by homologous recombination. The E.coli plasmid pGV1103 and the disarmed pTi must have some sequences common in both for recombination to occur. pTi is disarmed by replacing its oncogenes with sequences from E.coli plasmid. The pGV1103 is modified to produce an intermediate vector. Origin of replication in E.coli. Selectable markers e.g. neo gene for selection of transformed plant cells. Kanamycin resistance for selection of Cointegrate vector in Agrobacterium.
  • 14.
  • 15.
    BINARY VECTORS A binaryvector consists of a pair of plasmids of which one plasmid contains disarmed T-DNA sequences, while the other contains the Vir region and lacks the entire T-DNA including borders. Plasmid containing disarmed T-DNA is called mini-Ti e.g. Bin19. Plasmid containing only Vir genes is called a helper plasmid. The DNA insert is integrated within the T-region of mini-Ti ,and is cloned in E.coli. Pal4404 helper Ti plasmid is derived from the wild type pTiAch5 by deletion of entire T-region. The recombinant mini Ti Bin 19 is introduced into Agrobacterium by conjugation. The Vir genes present in helper Pal4404 induce transfer of T-DNA into plant cells.
  • 17.
    Agrobacterium mediated transformation Agrobacteriummediated plant transformation techniques are extensively utilized to generate transgenic plants. The important requirements for Agrobacterium-mediated gene transfer in higher plants are as follows:-  The plant explants must produce acetosyringone for activation of Vir genes.  The induced Agrobacterium should have access to cells that are competent for transformation.  Transformation competent cells should be able to regenerate into whole plants. Explants include cotyledon, leaf, thin tissue layer, peduncle, hypocotyls, stem, microspores has been used to obtain transgenic plants by this method.
  • 18.
    Explants (cotyledon, hypocotyls, microspore) Co-cultivationto allow infection Transformed and non-transformed tissue Transformed tissue/callus Transformed shoots Rooted shoots Adult plants Antibiotics to kill bacteria (carbenicillin, cefotaxime) Selective media to kill non transformed tissues (addition of Kanamycin AGROBACTERIUM MEDIATED TRANSFORMATION OF EXPLANTS Wounding Agrobacterium
  • 19.
    CONCLUSIONS  Agrobacterium tumefaciensis a natural tool for plant transformation .  Agrobacterium is capable of infecting intact plant cells tissues and organs. As a result tissue culture limitations are much less of a problem. Transformed plants can be regenerated more rapidly.  Agrobacterium is capable of transferring large fragments of DNA very efficiently without substantial rearrangements.  The stability of gene transferred is excellent.
  • 20.
    REFERENCES  http://arabidopsis.info/students/agrobacterium/mechanism.html  H.S.ChawalaIntroduction to Plant Biotechnology - 2nd edition  B.D.Singh Biotechnology Expanding Horizon - 3rd edition  S.S.Bhojwani M.K.Razdan Plant Tissue Culture – reprint 2004