The document summarizes novel computational approaches to investigate microbial diversity using metagenomic sequencing data. It discusses challenges with traditional assembly-based and mapping-based approaches for diversity analysis due to short read lengths and high diversity. It then introduces the concept of informative genomic segments (IGS) as a new unit to represent genomes and perform diversity analysis without the need for assembly or references. The document outlines using k-mer counting and abundance profiles across samples to estimate sequencing coverage and size of genomic regions represented by IGSs from raw reads. It proposes replacing traditional species-sample abundance tables with IGS-sample tables for scalable metagenomic diversity analysis.
C. Titus Brown is an assistant professor of microbiology and computer science at Michigan State University who focuses on analyzing and generating hypotheses from sequencing data. He gave a lecture on metagenome assembly. He discussed challenges with annotating individual short reads from environmental samples and emphasized the importance of assembly. He provided examples of successful metagenome assemblies including the genome reconstruction of symbionts from Osedax worms and tracking bacterial strains and phages in an infant gut microbiome over time. He outlined a "Grand Challenge" soil metagenomics project that aims to understand ecosystem functions and responses to perturbations through deep sequencing and assembly.
The document discusses challenges in analyzing non-model organism transcriptomics data due to lack of reference genomes and presents two solutions: digital normalization to reduce massive amounts of sequencing data while retaining important information, and partitioning transcripts into "transcript families" to collapse isoforms without a reference genome. It then provides examples of applying these approaches to lamprey and tunicate transcriptome data.
2015. Patrik Schnable. Trait associated SNPs provide insights into heterosis...FOODCROPS
1) Trait-associated SNPs provide insights into the genetic basis of heterosis or hybrid vigor in maize. GWAS identified over 1,000 associations between SNPs and seven yield-related traits.
2) Including dominance effects in models explains more of the observed heterosis and genetic variation than additive effects alone. The ratio of SNPs exhibiting positive versus negative dominance is correlated with heterosis for a given trait.
3) Field-based phenotyping using sensors on robots and UAVs can study dynamic traits influenced by environment and GxE interactions, overcoming limitations of endpoint traits in controlled conditions. This will improve predictive models for plant breeding and variety recommendations.
This document provides an overview of genomics and metagenomics. It begins with an introduction to genomics, describing genome assembly, validation, and metabolic reconstruction. It then covers metagenomics, discussing its history, pitfalls, and potentials. Key points include that genomics analyzes the parts list of a single genome, while metagenomics analyzes the collective genomes of an entire microbial community. Metagenomics has been used to explore novel sequences from various environments, perform comparative analyses between ecosystems, and extract genomes from low-abundance species.
Introduction:
Proposed by Meuwissen et al. (2001)
GS is a specialized form of MAS, in which information from genotype data on marker alleles covering the entire genome forms the basis of selection.
The effects associated with all the marker loci, irrespective of whether the effects are significant or not, covering the entire genome are estimated.
The marker effect estimates are used to calculate the genomic estimated breeding values (GEBVs) of different individuals/lines, which form the basis of selection.
Why to go for genomic selection:
Marker-assisted selection (MAS) is well-suited for handling oligogenes and quantitative trait loci (QTLs) with large effects but not for minor QTLs.
MARS attempts to take into account small effect QTLs by combining trait phenotype data with marker genotype data into a combined selection index.
Based on markers showing significant association with the trait(s) and for this reason has been criticized as inefficient
The genomic selection (GS) scheme was to rectify the deficiency of MAS and MARS schemes. The GS scheme utilizes information from genome-wide marker data whether or not their associations with the concerned trait(s) are significant.
GEBV: GenomicEstimated Breeding Values-
The sum total of effects associated with all the marker alleles present in the individual and included in the GS model applied to the population under selection
Calculated on a single individual basis
Gene-assisted genomic selection:
A GS model that uses information about prior known QTLs, the targeted QTLs were accumulated in much higher frequencies than when the standard ridge regression was used
The sum total of effects associated with all the marker alleles present in the individual and included in the GS model applied to the population under selection
Calculated on a single individual basis
Population used:
Training population: used for training of the GS model and for obtaining estimates of the marker-associated effects needed for estimation of GEBVs of individuals/lines in the breeding population.
Breeding population: the population subjected to GS for achieving the desired improvement and isolation of superior lines for use as new varieties/parents of new improved hybrids.
Training population-
large enough: must be representative of the breeding population: max. trait variance with marker : by cluster analysis
should have either equal or comparable LD, LD decay rates with breeding populations
Updated by including individuals/lines from the breeding population
Training more than one generation
Low colinearity between markers is needed since high colinearity tends to reduce prediction accuracy of certain GS models. (colinearity disturbed by recombination)
Potential for genomic selection in indigenous cattle breeds and results of GWAS in Gir dairy cattle of Gujrat by Dr.Pravin Kandhani and Dr. Vijay Trivedi KAMDHENU UNIVERSITY GANDHINAGAR
Microbiome research is undergoing a crisis due to issues like the correlation-causation fallacy in studies and poor experimental design. The document discusses challenges with studying the microbiome, including biases and errors introduced from DNA extraction methods, sample storage conditions, and contamination from extraction kits. It emphasizes that every step in microbiome research, from sample collection to analysis, needs careful consideration to draw accurate conclusions.
C. Titus Brown is an assistant professor of microbiology and computer science at Michigan State University who focuses on analyzing and generating hypotheses from sequencing data. He gave a lecture on metagenome assembly. He discussed challenges with annotating individual short reads from environmental samples and emphasized the importance of assembly. He provided examples of successful metagenome assemblies including the genome reconstruction of symbionts from Osedax worms and tracking bacterial strains and phages in an infant gut microbiome over time. He outlined a "Grand Challenge" soil metagenomics project that aims to understand ecosystem functions and responses to perturbations through deep sequencing and assembly.
The document discusses challenges in analyzing non-model organism transcriptomics data due to lack of reference genomes and presents two solutions: digital normalization to reduce massive amounts of sequencing data while retaining important information, and partitioning transcripts into "transcript families" to collapse isoforms without a reference genome. It then provides examples of applying these approaches to lamprey and tunicate transcriptome data.
2015. Patrik Schnable. Trait associated SNPs provide insights into heterosis...FOODCROPS
1) Trait-associated SNPs provide insights into the genetic basis of heterosis or hybrid vigor in maize. GWAS identified over 1,000 associations between SNPs and seven yield-related traits.
2) Including dominance effects in models explains more of the observed heterosis and genetic variation than additive effects alone. The ratio of SNPs exhibiting positive versus negative dominance is correlated with heterosis for a given trait.
3) Field-based phenotyping using sensors on robots and UAVs can study dynamic traits influenced by environment and GxE interactions, overcoming limitations of endpoint traits in controlled conditions. This will improve predictive models for plant breeding and variety recommendations.
This document provides an overview of genomics and metagenomics. It begins with an introduction to genomics, describing genome assembly, validation, and metabolic reconstruction. It then covers metagenomics, discussing its history, pitfalls, and potentials. Key points include that genomics analyzes the parts list of a single genome, while metagenomics analyzes the collective genomes of an entire microbial community. Metagenomics has been used to explore novel sequences from various environments, perform comparative analyses between ecosystems, and extract genomes from low-abundance species.
Introduction:
Proposed by Meuwissen et al. (2001)
GS is a specialized form of MAS, in which information from genotype data on marker alleles covering the entire genome forms the basis of selection.
The effects associated with all the marker loci, irrespective of whether the effects are significant or not, covering the entire genome are estimated.
The marker effect estimates are used to calculate the genomic estimated breeding values (GEBVs) of different individuals/lines, which form the basis of selection.
Why to go for genomic selection:
Marker-assisted selection (MAS) is well-suited for handling oligogenes and quantitative trait loci (QTLs) with large effects but not for minor QTLs.
MARS attempts to take into account small effect QTLs by combining trait phenotype data with marker genotype data into a combined selection index.
Based on markers showing significant association with the trait(s) and for this reason has been criticized as inefficient
The genomic selection (GS) scheme was to rectify the deficiency of MAS and MARS schemes. The GS scheme utilizes information from genome-wide marker data whether or not their associations with the concerned trait(s) are significant.
GEBV: GenomicEstimated Breeding Values-
The sum total of effects associated with all the marker alleles present in the individual and included in the GS model applied to the population under selection
Calculated on a single individual basis
Gene-assisted genomic selection:
A GS model that uses information about prior known QTLs, the targeted QTLs were accumulated in much higher frequencies than when the standard ridge regression was used
The sum total of effects associated with all the marker alleles present in the individual and included in the GS model applied to the population under selection
Calculated on a single individual basis
Population used:
Training population: used for training of the GS model and for obtaining estimates of the marker-associated effects needed for estimation of GEBVs of individuals/lines in the breeding population.
Breeding population: the population subjected to GS for achieving the desired improvement and isolation of superior lines for use as new varieties/parents of new improved hybrids.
Training population-
large enough: must be representative of the breeding population: max. trait variance with marker : by cluster analysis
should have either equal or comparable LD, LD decay rates with breeding populations
Updated by including individuals/lines from the breeding population
Training more than one generation
Low colinearity between markers is needed since high colinearity tends to reduce prediction accuracy of certain GS models. (colinearity disturbed by recombination)
Potential for genomic selection in indigenous cattle breeds and results of GWAS in Gir dairy cattle of Gujrat by Dr.Pravin Kandhani and Dr. Vijay Trivedi KAMDHENU UNIVERSITY GANDHINAGAR
Microbiome research is undergoing a crisis due to issues like the correlation-causation fallacy in studies and poor experimental design. The document discusses challenges with studying the microbiome, including biases and errors introduced from DNA extraction methods, sample storage conditions, and contamination from extraction kits. It emphasizes that every step in microbiome research, from sample collection to analysis, needs careful consideration to draw accurate conclusions.
This document discusses the field of metagenomics, which involves directly extracting and sequencing genetic material from environmental samples without culturing individual microbial species. It provides a brief history of metagenomics from early microbiologists in the 17th century to recent large-scale sequencing projects. Methods of metagenomic analysis like sequence-driven and function-driven approaches are described. Applications to studying uncultured symbiotic microbes, extreme environments, and the human gut microbiome are also summarized.
The document discusses how range shifts of species under climate change can impact genetic diversity through founder effects and local adaptation. Three key points are made:
1) Range shifts can cause maladaptation if specialist genotypes are shifted outside their optimal habitat.
2) Increased dispersal observed at range edges may be partly driven by founder effects from the range shift rather than solely by selection.
3) Founder effects during range shifts can lead to long-term genetic impoverishment if habitat becomes fragmented, potentially threatening species survival. Prioritizing collection of populations predicted to go extinct could help conserve genetic diversity.
This document provides an overview of biotechnology principles and applications. It defines biotechnology as the application of technology to modify biological organisms by adding genes from other organisms. The document discusses how genes are identified, isolated, and manipulated to introduce desired traits. It describes techniques such as homology cloning, complementary genetics, and map-based cloning used to isolate genes. The document explains how genes are introduced into plants using transformation methods like Agrobacterium and biolistics. It provides examples of transgenic crops and their applications in agriculture.
Comparative genomic analysis in Zingiberales: what can we learn from banana to enable Ensete and Boesenbergia to reach their potential?
Talk for Plant and Animal Genomics XXV 25 - San Diego January 2017
Trude Schwarzacher, Jennifer A. Harikrishna and Pat Heslop-Harrison, University of Leicester and University of Malaya
phh(a)molcyt.com
Within the Zingiberales there are many orphan crops that are grown in Africa and Asia where recently started genomic efforts will have an impact for the future understanding and breeding of these crops. Advanced genomics and genome knowledge of the taxonomically closely related genus Musa will help identify genes and their function. We will discuss relevant recent work with Musa and results from DNA sequencing, examinations of diversity and studies of genome structure, gene expression and epigenetic control in Boesenbergia and ensete. Ensete is an important starch staple food in Ethiopia. It is harvested just as the monocarpic plant starts to flower, a few years after planting, and the stored starch extracted from the pseudo-stem and corm. A genome sequence has been published, but there is little genomics. Characterization of the diversity in the species and understanding of the differences to Musa will enable selection and breeding for crop improvement to meet the requirements of increasing populations, climate change and environmental sustainability. Boesenbergia rotunda is widely used in traditional medicine in Asia and has been shown to produce secondary metabolites with antiviral activity. For high throughput propagation and metabolite production in vitro culture is employed; embryogenic calli of B. rotunda in vitro are able to regenerate into plants but lose this ability after prolonged periods in cell suspension media. Epigenetic factors, including histone modifications and DNA methylation are likely to play crucial roles in the regulation of genes involved in totipotency and plant regeneration. These findings are also relevant to other crops within the Zingiberales. Further details will be given at www.molcyt.com
This document discusses challenges and approaches for assembling large metagenomic and genomic datasets using short read sequencing data. Three main challenges are discussed: 1) Assembling the parasitic nematode H. contortus genome due to high polymorphism and repeats. Digital normalization helped enable assembly by reducing redundancy and errors. 2) Assembling the lamprey transcriptome with no reference and too much data. Digital normalization reduced the data volume and enabled assembly. 3) Assembling large soil metagenomic datasets, which are difficult due to their scale and complexity. Data partitioning separates reads into bins to enable "divide and conquer" assembly approaches. While progress has been made, challenges around strain variation, scaffolding, and connecting
Accelerating crop genetic gains with genomic selectionViolinaBharali
This document discusses genomic selection (GS), a plant and animal breeding technique that uses genome-wide molecular markers to predict and select for an individual's genetic merit or breeding value. GS can accelerate genetic gain compared to traditional breeding by increasing selection intensity and accuracy. Key points covered include: how GS works, factors affecting its accuracy, challenges like genotype-environment interaction, and examples of its successful application in maize and wheat breeding programs.
The present study was conducted with the aim of reducing the cost of implementing Genomic Selection(GS) by using Genotype imputation methodology in Gir cattle. Application of GS mainly depends upon the cost of genotyping and reduce its cost, imputation approaches have been used. Imputation strategies and GS have been comprehensively studied in several taurine dairy cattle populations but very limited information is available on indigenous populations. Factors that affect the efficiency of imputation and GS are population structure, linkage disequilibrium between markers and differing marker density between indigenous and taurine breeds. The objective of the study was to evaluate the performance of INDUSCHIP-1, a customized Illumina bovine microarray chip for indigenous cattle breeds, designed by National Dairy Development Board, Anand and design one (7-15K) LD panel, and evaluate the performance of two panels of INDUSCHIP-1, and a 13K subset of the same for its imputation accuracy to HD (777K or INDUSCHIP-1 level). Thus, the study was planned with the aim to design LD panel for genotype imputation to INDUSCHIP-1 level with the strategy to maximize the accuracy of imputation in Gir cattle.
This document discusses food authenticity testing and the issues with current testing methods. It introduces next generation sequencing (NGS) as a new method for food authenticity testing. NGS allows for the simultaneous detection of thousands of potential food contaminants in a single test, overcoming limitations of current polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) methods. NGS involves amplifying DNA from all species in a mixed sample, sequencing the amplified products, and comparing the sequences to a reference database to identify contaminants. While a major improvement, NGS also has limitations, such as an inability to currently quantify contamination levels.
Genomic selection changing Breeding programe around the world, talk consist of concept of Breeding, breeding value, Genomic breeding value, Genotype imputation, male calf procurement on basis of GEBV under SAG PT Project and 1000 bull genome project.
1) Evolutionary genetics examines how genetic changes in populations lead to evolution over time through processes like mutation, genetic drift, and natural selection.
2) Early work in evolutionary genetics integrated Mendelian genetics with Darwin's theory of evolution through natural selection to form the modern synthesis of the early 20th century.
3) Neutral theory proposed that many genetic mutations are neutral or nearly neutral and do not significantly impact fitness, explaining much molecular evolution.
4) Phylogenetic trees reconstructed from genetic data provide evidence for relationships between species and models of molecular evolution.
5) Horizontal gene transfer and archaic human interbreeding have introduced genetic variation influencing traits like placental invasiveness and immunity.
This presents a number of case studies on the application on high-throughput sequencing (HTS), next generation sequencing (NGS), to biological problems ranging from human genome sequencing, identification of disease mutations, metagenomics, virus discovery, epidemic, transmission chains and viral populations. Presented at the University of Glasgow on Friday 26th June 2015.
This presentation discusses novel technologies to study the resistome, which is the collection of antibiotic resistance genes found in an environment. It describes culture-based and culture-independent methods to analyze the resistome, including metagenomic shotgun sequencing, functional metagenomics, and high-throughput quantitative PCR. The presentation also details a study that used these methods to analyze the gut resistome of ICU patients receiving intensive antibiotic therapy and found a rich diversity of resistance genes that increased during their hospital stay. Long-read nanopore sequencing is also presented as an upcoming method to map resistomes by linking resistance genes to mobile genetic elements.
Mini core collection - an international public goodICRISAT
The document discusses the development and use of mini core collections of plant genetic resources by ICRISAT. It notes that ICRISAT has developed mini core collections for several crops including chickpea, groundnut, pigeonpea, sorghum, and pearl millet containing 1-2% of the total germplasm collection. The mini core collections have been extensively evaluated for traits like resistance to biotic and abiotic stresses. Several accessions with resistance to drought, salinity, and high temperatures were identified. The mini core collections are being provided to researchers to facilitate crop improvement while ensuring conservation of genetic diversity.
This document summarizes approaches, resources and tools for gene discovery and breeding in rice. It discusses the use of introgressions from wild rice species, like Oryza glaberrima, to discover genes of importance for traits like yield, abiotic stress tolerance and disease resistance. It describes the development and use of nested association mapping (NAM) populations, chromosome segment substitution lines (CSSLs), and interspecific "iBridge" lines to overcome reproductive barriers for wider use of wild species diversity in rice breeding. Software, genetic maps, and populations involving multiple institutions are also summarized for integrating genetic and genomic approaches to gene discovery.
MAGIC population and its application in crop improvementSanghaviBoddu
The document discusses MAGIC (Multi-parent Advanced Generation Inter-Cross) populations, which are a new resource for plant genetics that allow for more precise mapping of quantitative trait loci (QTLs). MAGIC populations are developed by intercrossing multiple diverse founder lines over multiple generations, increasing recombination and genetic diversity. This allows for both coarse and fine mapping of QTLs contributing to complex traits. The document provides details on the development of MAGIC populations, including founder selection, mixing, advanced intercrossing, and inbreeding. It also discusses applications in breeding programs and case studies mapping traits like disease resistance in rice MAGIC populations.
Metagenomics is the study of metagenomes, genetic material recovered directly from environmental samples. The broad field was referred to as environmental genomics, ecogenomics or community genomics. Recent studies use "shotgun" Sanger sequencing or next generation sequencing (NGS) to get largely unbiased samples of all genes from all the members of the sampled communities.
Talk by J. Eisen for NZ Computational Genomics meetingJonathan Eisen
This document discusses phylogeny-driven approaches to studying microbial diversity using ribosomal RNA gene sequences. It provides background on how advances in sequencing technology and appreciation of microbial diversity have enabled microbiome research. The document outlines several uses of phylogeny in microbiome studies, including constructing species phylogenies using rRNA sequences and assigning taxonomy to environmental sequences via rRNA phylotyping. It describes challenges with analyzing large rRNA datasets and introduces an automated pipeline called STAP that generates high-quality multiple sequence alignments and phylogenetic trees to classify sequences and analyze species diversity in a manner that scales to large datasets.
Managing environmental- molecular- and associated meta-data: The Micro B3 Inf...Renzo Kottmann
A 5 minutes lightning talk about the approach the Micro B3 Information System takes to deliver integrated environmental and molecular data with associated metadata. Presented at Biodiversity Informatics Horizon 2013 conference (see http://conference.lifewatch.unisalento.it/index.php/EBIC/BIH2013)
This document discusses the field of metagenomics, which involves directly extracting and sequencing genetic material from environmental samples without culturing individual microbial species. It provides a brief history of metagenomics from early microbiologists in the 17th century to recent large-scale sequencing projects. Methods of metagenomic analysis like sequence-driven and function-driven approaches are described. Applications to studying uncultured symbiotic microbes, extreme environments, and the human gut microbiome are also summarized.
The document discusses how range shifts of species under climate change can impact genetic diversity through founder effects and local adaptation. Three key points are made:
1) Range shifts can cause maladaptation if specialist genotypes are shifted outside their optimal habitat.
2) Increased dispersal observed at range edges may be partly driven by founder effects from the range shift rather than solely by selection.
3) Founder effects during range shifts can lead to long-term genetic impoverishment if habitat becomes fragmented, potentially threatening species survival. Prioritizing collection of populations predicted to go extinct could help conserve genetic diversity.
This document provides an overview of biotechnology principles and applications. It defines biotechnology as the application of technology to modify biological organisms by adding genes from other organisms. The document discusses how genes are identified, isolated, and manipulated to introduce desired traits. It describes techniques such as homology cloning, complementary genetics, and map-based cloning used to isolate genes. The document explains how genes are introduced into plants using transformation methods like Agrobacterium and biolistics. It provides examples of transgenic crops and their applications in agriculture.
Comparative genomic analysis in Zingiberales: what can we learn from banana to enable Ensete and Boesenbergia to reach their potential?
Talk for Plant and Animal Genomics XXV 25 - San Diego January 2017
Trude Schwarzacher, Jennifer A. Harikrishna and Pat Heslop-Harrison, University of Leicester and University of Malaya
phh(a)molcyt.com
Within the Zingiberales there are many orphan crops that are grown in Africa and Asia where recently started genomic efforts will have an impact for the future understanding and breeding of these crops. Advanced genomics and genome knowledge of the taxonomically closely related genus Musa will help identify genes and their function. We will discuss relevant recent work with Musa and results from DNA sequencing, examinations of diversity and studies of genome structure, gene expression and epigenetic control in Boesenbergia and ensete. Ensete is an important starch staple food in Ethiopia. It is harvested just as the monocarpic plant starts to flower, a few years after planting, and the stored starch extracted from the pseudo-stem and corm. A genome sequence has been published, but there is little genomics. Characterization of the diversity in the species and understanding of the differences to Musa will enable selection and breeding for crop improvement to meet the requirements of increasing populations, climate change and environmental sustainability. Boesenbergia rotunda is widely used in traditional medicine in Asia and has been shown to produce secondary metabolites with antiviral activity. For high throughput propagation and metabolite production in vitro culture is employed; embryogenic calli of B. rotunda in vitro are able to regenerate into plants but lose this ability after prolonged periods in cell suspension media. Epigenetic factors, including histone modifications and DNA methylation are likely to play crucial roles in the regulation of genes involved in totipotency and plant regeneration. These findings are also relevant to other crops within the Zingiberales. Further details will be given at www.molcyt.com
This document discusses challenges and approaches for assembling large metagenomic and genomic datasets using short read sequencing data. Three main challenges are discussed: 1) Assembling the parasitic nematode H. contortus genome due to high polymorphism and repeats. Digital normalization helped enable assembly by reducing redundancy and errors. 2) Assembling the lamprey transcriptome with no reference and too much data. Digital normalization reduced the data volume and enabled assembly. 3) Assembling large soil metagenomic datasets, which are difficult due to their scale and complexity. Data partitioning separates reads into bins to enable "divide and conquer" assembly approaches. While progress has been made, challenges around strain variation, scaffolding, and connecting
Accelerating crop genetic gains with genomic selectionViolinaBharali
This document discusses genomic selection (GS), a plant and animal breeding technique that uses genome-wide molecular markers to predict and select for an individual's genetic merit or breeding value. GS can accelerate genetic gain compared to traditional breeding by increasing selection intensity and accuracy. Key points covered include: how GS works, factors affecting its accuracy, challenges like genotype-environment interaction, and examples of its successful application in maize and wheat breeding programs.
The present study was conducted with the aim of reducing the cost of implementing Genomic Selection(GS) by using Genotype imputation methodology in Gir cattle. Application of GS mainly depends upon the cost of genotyping and reduce its cost, imputation approaches have been used. Imputation strategies and GS have been comprehensively studied in several taurine dairy cattle populations but very limited information is available on indigenous populations. Factors that affect the efficiency of imputation and GS are population structure, linkage disequilibrium between markers and differing marker density between indigenous and taurine breeds. The objective of the study was to evaluate the performance of INDUSCHIP-1, a customized Illumina bovine microarray chip for indigenous cattle breeds, designed by National Dairy Development Board, Anand and design one (7-15K) LD panel, and evaluate the performance of two panels of INDUSCHIP-1, and a 13K subset of the same for its imputation accuracy to HD (777K or INDUSCHIP-1 level). Thus, the study was planned with the aim to design LD panel for genotype imputation to INDUSCHIP-1 level with the strategy to maximize the accuracy of imputation in Gir cattle.
This document discusses food authenticity testing and the issues with current testing methods. It introduces next generation sequencing (NGS) as a new method for food authenticity testing. NGS allows for the simultaneous detection of thousands of potential food contaminants in a single test, overcoming limitations of current polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) methods. NGS involves amplifying DNA from all species in a mixed sample, sequencing the amplified products, and comparing the sequences to a reference database to identify contaminants. While a major improvement, NGS also has limitations, such as an inability to currently quantify contamination levels.
Genomic selection changing Breeding programe around the world, talk consist of concept of Breeding, breeding value, Genomic breeding value, Genotype imputation, male calf procurement on basis of GEBV under SAG PT Project and 1000 bull genome project.
1) Evolutionary genetics examines how genetic changes in populations lead to evolution over time through processes like mutation, genetic drift, and natural selection.
2) Early work in evolutionary genetics integrated Mendelian genetics with Darwin's theory of evolution through natural selection to form the modern synthesis of the early 20th century.
3) Neutral theory proposed that many genetic mutations are neutral or nearly neutral and do not significantly impact fitness, explaining much molecular evolution.
4) Phylogenetic trees reconstructed from genetic data provide evidence for relationships between species and models of molecular evolution.
5) Horizontal gene transfer and archaic human interbreeding have introduced genetic variation influencing traits like placental invasiveness and immunity.
This presents a number of case studies on the application on high-throughput sequencing (HTS), next generation sequencing (NGS), to biological problems ranging from human genome sequencing, identification of disease mutations, metagenomics, virus discovery, epidemic, transmission chains and viral populations. Presented at the University of Glasgow on Friday 26th June 2015.
This presentation discusses novel technologies to study the resistome, which is the collection of antibiotic resistance genes found in an environment. It describes culture-based and culture-independent methods to analyze the resistome, including metagenomic shotgun sequencing, functional metagenomics, and high-throughput quantitative PCR. The presentation also details a study that used these methods to analyze the gut resistome of ICU patients receiving intensive antibiotic therapy and found a rich diversity of resistance genes that increased during their hospital stay. Long-read nanopore sequencing is also presented as an upcoming method to map resistomes by linking resistance genes to mobile genetic elements.
Mini core collection - an international public goodICRISAT
The document discusses the development and use of mini core collections of plant genetic resources by ICRISAT. It notes that ICRISAT has developed mini core collections for several crops including chickpea, groundnut, pigeonpea, sorghum, and pearl millet containing 1-2% of the total germplasm collection. The mini core collections have been extensively evaluated for traits like resistance to biotic and abiotic stresses. Several accessions with resistance to drought, salinity, and high temperatures were identified. The mini core collections are being provided to researchers to facilitate crop improvement while ensuring conservation of genetic diversity.
This document summarizes approaches, resources and tools for gene discovery and breeding in rice. It discusses the use of introgressions from wild rice species, like Oryza glaberrima, to discover genes of importance for traits like yield, abiotic stress tolerance and disease resistance. It describes the development and use of nested association mapping (NAM) populations, chromosome segment substitution lines (CSSLs), and interspecific "iBridge" lines to overcome reproductive barriers for wider use of wild species diversity in rice breeding. Software, genetic maps, and populations involving multiple institutions are also summarized for integrating genetic and genomic approaches to gene discovery.
MAGIC population and its application in crop improvementSanghaviBoddu
The document discusses MAGIC (Multi-parent Advanced Generation Inter-Cross) populations, which are a new resource for plant genetics that allow for more precise mapping of quantitative trait loci (QTLs). MAGIC populations are developed by intercrossing multiple diverse founder lines over multiple generations, increasing recombination and genetic diversity. This allows for both coarse and fine mapping of QTLs contributing to complex traits. The document provides details on the development of MAGIC populations, including founder selection, mixing, advanced intercrossing, and inbreeding. It also discusses applications in breeding programs and case studies mapping traits like disease resistance in rice MAGIC populations.
Metagenomics is the study of metagenomes, genetic material recovered directly from environmental samples. The broad field was referred to as environmental genomics, ecogenomics or community genomics. Recent studies use "shotgun" Sanger sequencing or next generation sequencing (NGS) to get largely unbiased samples of all genes from all the members of the sampled communities.
Talk by J. Eisen for NZ Computational Genomics meetingJonathan Eisen
This document discusses phylogeny-driven approaches to studying microbial diversity using ribosomal RNA gene sequences. It provides background on how advances in sequencing technology and appreciation of microbial diversity have enabled microbiome research. The document outlines several uses of phylogeny in microbiome studies, including constructing species phylogenies using rRNA sequences and assigning taxonomy to environmental sequences via rRNA phylotyping. It describes challenges with analyzing large rRNA datasets and introduces an automated pipeline called STAP that generates high-quality multiple sequence alignments and phylogenetic trees to classify sequences and analyze species diversity in a manner that scales to large datasets.
Managing environmental- molecular- and associated meta-data: The Micro B3 Inf...Renzo Kottmann
A 5 minutes lightning talk about the approach the Micro B3 Information System takes to deliver integrated environmental and molecular data with associated metadata. Presented at Biodiversity Informatics Horizon 2013 conference (see http://conference.lifewatch.unisalento.it/index.php/EBIC/BIH2013)
The Ocean Sampling Day's Metagenome Analysis: Standards, Pipelines and First ...Renzo Kottmann
Overview on Ocean Sampling Day and status of metagenomic analysis. Presentation was delivered at final BioMedBridges Symposium http://www.biomedbridges.eu/news/symposium-open-bridges-life-science-data
Metagenomics Session: http://www.biomedbridges.eu/news/workshop-metagenomics-bridging-between-environment-and-life
This study demonstrates the utility of using Next Generation Sequencing (NGS) technology and DNA analysis to identify and analyze closely related insect species and populations. The researchers sequenced DNA from two mitochondrial genes and a nuclear gene from individuals of two closely related fly species, Bactrocera philippinensis and B. occipitalis. They obtained overlapping sequences from these genes that could be assembled into full gene sequences. Their goal is to ultimately sequence the entire genome of multiple individuals to better characterize populations and species through comparative genomic analysis. DNA-based methods provide advantages over traditional taxonomy by requiring less material and being consistent across life stages.
[2013.12.02] Mads Albertsen: Extracting Genomes from MetagenomesMads Albertsen
This document summarizes the process of extracting genomes from metagenomes. It discusses how metagenomics involves sequencing the collective DNA from an environmental sample to determine the community composition and functional potential. Full genomes cannot typically be assembled from metagenomic data due to high microbial diversity within samples and limitations in separating individual genomes (binning). Methods described to improve binning include reducing diversity through short-term enrichments and using multiple related samples. Validation of binned genomes involves checking for essential single copy genes and confirming bins with in situ techniques like fluorescence in situ hybridization.
The diversity of microbial species in a metagenomic study is commonly assessed using 16S rRNA gene sequencing. With the rapid developments in genome sequencing technologies, the focus has shifted towards the sequencing of hypervariable regions of 16S rRNA gene instead of full length gene sequencing. Therefore, 16S Classifier is developed using a machine learning method, Random Forest, for faster and accurate taxonomic classification of short hypervariable regions of 16S rRNA sequence. It displayed precision values of up to 0.91 on training datasets and the precision values of up to 0.98 on the test dataset. On real metagenomic datasets, it showed up to 99.7% accuracy at the phylum level and up to 99.0% accuracy at the genus level. 16S Classifier is available freely at http://metagenomics.iiserb.ac.in/16Sclassifier and http://metabiosys.iiserb.ac.in/16Sclassifier.
This document discusses the use of 16S ribosomal RNA (rRNA) gene sequencing for bacterial identification and phylogenetic analysis. It explains that the 16S rRNA gene is highly conserved, making it useful for comparing distantly related organisms. The document outlines the process of 16S rRNA gene sequencing, including PCR amplification using conserved primer regions and sequencing of variable regions. It also discusses various methods that have been developed using 16S rRNA, such as TRFLP profiling and ribotyping, to study microbial communities.
New Generation Sequencing Technologies: an overviewPaolo Dametto
The document provides a history of DNA sequencing technologies. It begins with the discovery of DNA's structure in 1953 and the development of recombinant DNA technology in the 1970s. First generation Sanger sequencing produced short reads over 1,000 years to sequence the human genome. Next generation sequencing (NGS) platforms since 2005 have dramatically reduced costs while increasing throughput. NGS methods like Roche/454 pyrosequencing, Illumina/Solexa sequencing by synthesis, SOLiD ligation sequencing, and single-molecule real-time sequencing by Pacific Biosciences now enable large-scale genome and transcriptome analysis.
This document discusses the evolution of metagenomics from culturing microorganisms to direct high-throughput sequencing using next-generation sequencing (NGS) technologies. It describes how early metagenomics relied on cloning environmental DNA into libraries for Sanger sequencing, but NGS allows direct sequencing without cloning. NGS produces large volumes of sequence data at low cost, enabling assembly of large DNA fragments and reliable annotation of genes and pathways. The future of metagenomics involves comprehensively cataloging human and environmental microbiomes using NGS and exploiting microbial diversity for biotechnology applications like enzymes, antibiotics, and probiotics.
The document evaluates the Follett Destiny automation system. It provides a brief history of Follett Corporation, which began in 1873 as a used bookstore and is now the world's largest provider of books and resources to libraries and schools. The summary outlines some of Follett Destiny's strengths such as easy access across devices and powerful management features. It also mentions some weaknesses like dated interfaces and additional costs for add-ons. Overall, the evaluation recommends Follett Destiny due to its widespread use in K-12 schools, access to print and digital resources, and partnerships to expand content.
Most respondents to the survey were female and between 16-18 years old, likely because the survey was shared on social media. The results surprised the surveyor, as action was overwhelmingly the preferred genre over comedy or romance. This indicates that an action trailer would attract a larger local audience than a romance trailer. Respondents also favored audio quality and a wide range of shot types in a trailer over character or style. While romance was not the top genre, it was a popular sub-genre choice, showing that some romantic elements can enhance a film or trailer even if it's not the central theme.
This document provides an overview of Investment Technology Group, Inc. (ITG) for investors. Key points include:
- ITG has opportunities for growth internationally, especially in Europe, Canada, and Asia Pacific where electronic trading is increasing.
- ITG has a robust balance sheet with $331 million in cash/equivalents and only $13 million in long-term debt.
- ITG has competitive platforms and tools for execution, liquidity, analytics, and research that provide opportunities for increased profitability and operating leverage.
This document summarizes the results of a freelancer survey conducted in Belgium and the Netherlands in 2015 with 319 respondents. Some key findings include:
- It was somewhat easier for 27% of freelancers to obtain assignments compared to previous years.
- Freelancers were generally satisfied with their work, with three-quarters giving it a satisfaction rating of 8/10 or higher.
- The majority expect their fees and number of assignments to remain stable or increase in the coming year.
- Most freelancers obtain assignments through their own network and service providers rather than online channels.
The document discusses leveraging cloud technology to streamline content strategy. It describes current challenges with managing multilingual content across different systems and vendors, which leads to slow localization, high costs, and inconsistent messaging. The document then introduces Cloudwords as a customer-centric localization platform that connects to various content management, marketing automation, and translation systems in the cloud. It provides workflow automation and collaboration tools as well as translation memory and terminology databases to help deliver market impact more quickly.
This document summarizes a proposed research project to develop a novel method for measuring microbial diversity in extremely large and complex metagenomic samples using k-mer counting. The method aims to be binning-free, assembly-free, annotation-free and reference-free. Preliminary results show the method can efficiently measure diversity within and compare diversity between samples using k-mer frequencies. The proposed work is to validate the method on test datasets and apply it to extremely large soil metagenomic datasets exceeding terabases in size from cultivated and uncultivated Iowa prairie soils.
This document discusses scalable computational approaches for exploring microbial diversity using metagenomic sequencing data. It describes a "digital normalization" algorithm that uses a streaming computational approach to lossy compression of sequencing data in a memory- and time-efficient way. This allows assembly and analysis of very large soil metagenomic datasets totaling over 1.8 terabases. Comparison of Iowa prairie and corn field samples showed 51% nucleotide overlap, suggesting similar genomic content between these environments.
This document discusses the challenges of analyzing large datasets from metagenomic shotgun sequencing experiments. It notes that while sequencing costs have decreased significantly, the computational analysis of the massive amounts of data generated still poses major challenges. It introduces the concept of "digital normalization" as an approach to reduce dataset sizes while retaining most of the biological information by removing redundant reads. The document advocates for making analysis tools and datasets openly accessible to help advance understanding of microbial communities from metagenomics studies.
Shotgun metagenomics involves collecting environmental samples, extracting DNA from the samples, sequencing the DNA using shotgun sequencing, and then analyzing the sequence data computationally. Key steps include assembling reads into longer contigs to aid analysis and annotation. While assembly works well for some datasets, challenges include repeats, low coverage of low-abundance species, and strain variation. High coverage, often 10x or more per genome, is critical for robust assembly. The amount of sequencing needed can be substantial, such as terabases of data to deeply sample microbial communities.
TILLING (Targeting Induced Local Lesions IN Genomes) is a reverse genetics technique that uses chemical mutagenesis and screening to identify point mutations in genes of interest. It involves mutagenizing an organism's genome with chemicals like EMS, pooling DNA from mutagenized individuals, amplifying target genes via PCR, treating products with enzymes like CEL1 to detect mutations, and analyzing cleavage products on gels to find mutations. TILLING has been used to identify mutations in many crops to determine gene function and discover traits like disease resistance. It provides an efficient way to study gene function without transgenic approaches.
Genomics refers to the study of the structure and function of an organism's entire genome. It deals with mapping genes on chromosomes and sequencing genes. Genomics uses tools from molecular biology, robotics, and computing to analyze large amounts of genomic data. The term was first used in 1986 to describe mapping, sequencing, and characterizing genomes. Genome mapping has been completed for many prokaryotes and eukaryotes, including bacteria, yeast, fruit flies, humans, and some crop plants like rice and Arabidopsis thaliana. Genomics is useful for crop improvement as it allows determining genome size and gene number, mapping and sequencing genes, tracing crop evolution, and identifying DNA markers for applications like marker-assisted selection and transgenic
2014 talk at NYU CUSP: "Biology Caught the Bus: Now what? Sequencing, Big Dat...c.titus.brown
This document summarizes a presentation on analyzing soil microbial communities through shotgun metagenomics. It begins with an analogy that sequencing environmental DNA is like shredding books and trying to reconstruct their contents computationally. It describes challenges like errors, rare sequences, and analyzing huge datasets. It outlines goals of understanding soil microbes' roles and responding to perturbations. It discusses using large datasets like the Great Prairie Grand Challenge to reconstruct metagenomes and answer ecological questions. It proposes two solutions: 1) partitioning data by binning reads, and 2) discarding redundant data through digital normalization to reduce memory needs and allow assembly of massive datasets.
Course: Bioinformatics for Biomedical Research (2014).
Session: 2.1.2- Next Generation Sequencing. Technologies and Applications. Part II: NGS Applications I.
Statistics and Bioinformatisc Unit (UEB) & High Technology Unit (UAT) from Vall d'Hebron Research Institute (www.vhir.org), Barcelona.
Digital normalization is a new technique for pre-filtering sequencing reads that helps address computational challenges in assembling genomes, transcriptomes, and metagenomes from non-model organisms. It works by discarding redundant reads to smooth coverage and eliminate the majority of errors. Three case studies showed its effectiveness: 1) Assembling the parasitic nematode H. contortus genome, 2) Assembling the lamprey transcriptome without a reference, and 3) Assembling two large soil metagenomes. Digital normalization enabled efficient assemblies and new biological insights in these difficult "weird" samples.
This document summarizes research on quantifying genetic variation in two cytological aspects of maize endosperm development: endosperm cell number and the extent of endoreduplication. The researchers studied multiple mapping populations to identify quantitative trait loci (QTL) associated with each trait using flow cytometry and genetic mapping techniques. They identified several QTL for each trait, explaining varying percentages of phenotypic variance. The research provides insights into genetic control of these traits and directions for future studies of endosperm development regulation.
This document discusses improved techniques for de novo genome, transcriptome, and metagenome assembly using digital normalization. Digital normalization is a computational technique that discards redundant sequencing reads, smoothing coverage and eliminating most errors. This allows assemblies to scale efficiently with genome size. Examples presented include assembling the parasitic nematode H. contortus genome and the lamprey transcriptome. Digital normalization also enabled assembly of large soil metagenomes that were previously intractable.
The presentation includes preliminary information about the big data mainly metagenomic data and discussions related to the hurdles in analyzing using conventional approaches. In the later part, brief introduction about machine learning approaches using biological example for each. In the last, work done with special focus on implementation of a machine learning approach Random Forest for the functional annotation and taxonomic classification of metagenomic data.
Genomics refers to the study of the entire genome of an organism. It deals with mapping genes on chromosomes and sequencing entire genomes. While work on genomics began with prokaryotes like bacteria, research has now been conducted on crop plants like rice and Arabidopsis thaliana. Genomics is an interdisciplinary field that uses tools from molecular biology, robotics, and computing to study genomes. It provides information on genome size, gene number, gene function, and evolution. Genomics has applications in crop improvement through gene mapping, marker-assisted selection, and transgenic breeding. However, genomic research also faces limitations due to high costs, technical challenges, and complexity of traits.
This document provides an overview of next generation sequencing (NGS) for cancer genomics. It discusses how NGS allows sequencing of whole genomes or targeted regions to identify genetic changes between normal and tumor DNA. Analysis involves aligning DNA reads to reference genomes, detecting mutations, and categorizing them as silent, non-silent, oncogenic drivers, or signatures of mutational processes. RNA sequencing can also profile gene expression and detect fusion genes. The data requires specialized bioinformatics analysis to interpret genetic changes driving cancer.
This document provides an overview of metagenome assembly from a lecture given by C. Titus Brown. It begins with introductions and definitions related to bioinformatics and metagenomics. It then discusses challenges with annotating individual short reads from metagenomes and why assembly is preferable. An example study assembling 454 shotgun reads from soil metagenomes to analyze the impact of land management on microbial communities is described. Finally, challenges with assembling human-associated and high-complexity soil metagenomes are discussed.
GRC Workshop at Churchill College on Sep 21, 2014. This is Michael Schatz's talk on the theory and practice of representing population data in graph structures.
This document discusses next generation sequencing technologies and their applications and limitations compared to Sanger sequencing. Next generation sequencing can sequence thousands of human genomes or more per run, with read lengths up to 40 kilobases and accuracy between 85-99%, at a lower cost of $2,000 per gigabase compared to $200,000 for Sanger. However, next generation sequencing produces large amounts of sequence data that requires bioinformatics approaches to analyze, and platforms and software are constantly changing. Some applications of next generation sequencing discussed include de novo genome assembly, metagenomics to characterize microbial communities, population genomics to identify adaptive regions without a reference genome, and transcriptomics to quantify genome-wide gene expression without a reference.
Microbiome Profiling with the Microbial Genomics Pro SuiteQIAGEN
In this slide deck, we introduce the scientist-friendly Microbial Genomics Pro Suite offering workflows optimized for microbiome profiling, microbial typing and outbreak analysis. The workflows and tools for microbial genomics introduced with this software package are further extending the comprehensive set of genomics, transcriptomics and epigenomics analysis solutions that researchers know from CLC Genomics Workbench.
VenmoPlus.com is a service that allows users to explore their Venmo network through additional features like fuzzy username searching, labeling relationships between payers and receivers, friend recommendations, searching transactions within a friend circle, and listing friends. It uses Redis to store the graph structure and Elasticsearch to store all other data. Algorithms like breadth-first search and bidirectional search are used to find distances between nodes in the dynamic graph in real time. The system is optimized through the use of two databases, algorithm design, and query optimizations to support features like searching relationships and transactions within a user's friend circle.
This document introduces VenmoPlus.com, a service that allows users to explore their Venmo network. It provides features such as fuzzy username searching, labeling relationships between payers and receivers, friend recommendations, searching transactions within a friend circle, and listing friends. It uses Redis to store the graph structure and Elasticsearch to store all other data. Algorithms like breadth-first search and bidirectional search are used to find the distance between nodes in the dynamic graph in real time. The system employs a two database approach with Redis and Elasticsearch to support these features efficiently.
This document describes VenmoPlus.com, a service that builds on top of Venmo transaction and social network data. It features functions like searching usernames, labeling relationships between users, friend recommendations, searching transactions within a user's friend circle, and listing friends. The system uses Redis to store the social graph and Elasticsearch for all other data. Algorithms like breadth-first search and bidirectional search are used to find distances between users in the dynamic graph. Query optimizations improve performance, such as removing unnecessary data from Elasticsearch.
VenmoPlus.com is a service that allows users to explore their Venmo network through additional features like fuzzy username searching, labeling relationships between payers and receivers, friend recommendations, searching transactions within a friend circle, and listing friends. It uses Redis to store the graph structure and Elasticsearch to store all other data. Algorithms like bidirectional breadth-first search and optimizations are used to enable real-time queries of the dynamic graph. The service is built using a pipeline of raw Venmo data processed in a distributed manner across multiple databases and cloud resources.
Introducing VenmoPlus.com, a service that allows users to explore their Venmo network and query transaction histories and relationships between users in real time. It uses Redis to store the graph structure defining relationships between users and ElasticSearch to store all other data for querying. Algorithms and optimizations were developed to quickly calculate distances in the large and dynamic graph in real time using a combination of Redis and ElasticSearch.
Introducing VenmoPlus.com, a service that allows users to explore their Venmo network in more depth. The document discusses the challenges of calculating and querying the graph distance between users in real-time as the graph is constantly changing. It describes how the service uses two databases - a real-time database to track new transactions and a historical database to store older transaction data. It also discusses algorithms and optimizations used to query distances and recommend connections between users efficiently.
This document introduces VenmoPlus.com, a service that allows users to explore their Venmo payment network. It discusses some of the challenges in building the system, including calculating graph distances and querying connections in real time for a network with 5 million users and over 88 million payment transactions. The solution uses two databases - Redis to store the graph data for fast updates and traversal, and Elasticsearch for storing transaction data and full-text search capabilities. Spark is used to distribute the ETL processing between these databases.
Qingpeng Zhang developed a bottom-up computational approach called khmer to investigate microbial diversity through k-mer counting and analysis of metagenomic sequencing data. He contributed algorithms, code and analysis methods to khmer from 2008-present. His work involved digital normalization, diversity analysis of k-mers and reads, and genome assembly and binning of symbionts. Future work will apply these methods to datasets like MetaHIT, HMP and GPGC to refine pipelines and statistical methods for informative genomic segment analysis of diversity.
State of Artificial intelligence Report 2023kuntobimo2016
Artificial intelligence (AI) is a multidisciplinary field of science and engineering whose goal is to create intelligent machines.
We believe that AI will be a force multiplier on technological progress in our increasingly digital, data-driven world. This is because everything around us today, ranging from culture to consumer products, is a product of intelligence.
The State of AI Report is now in its sixth year. Consider this report as a compilation of the most interesting things we’ve seen with a goal of triggering an informed conversation about the state of AI and its implication for the future.
We consider the following key dimensions in our report:
Research: Technology breakthroughs and their capabilities.
Industry: Areas of commercial application for AI and its business impact.
Politics: Regulation of AI, its economic implications and the evolving geopolitics of AI.
Safety: Identifying and mitigating catastrophic risks that highly-capable future AI systems could pose to us.
Predictions: What we believe will happen in the next 12 months and a 2022 performance review to keep us honest.
Learn SQL from basic queries to Advance queriesmanishkhaire30
Dive into the world of data analysis with our comprehensive guide on mastering SQL! This presentation offers a practical approach to learning SQL, focusing on real-world applications and hands-on practice. Whether you're a beginner or looking to sharpen your skills, this guide provides the tools you need to extract, analyze, and interpret data effectively.
Key Highlights:
Foundations of SQL: Understand the basics of SQL, including data retrieval, filtering, and aggregation.
Advanced Queries: Learn to craft complex queries to uncover deep insights from your data.
Data Trends and Patterns: Discover how to identify and interpret trends and patterns in your datasets.
Practical Examples: Follow step-by-step examples to apply SQL techniques in real-world scenarios.
Actionable Insights: Gain the skills to derive actionable insights that drive informed decision-making.
Join us on this journey to enhance your data analysis capabilities and unlock the full potential of SQL. Perfect for data enthusiasts, analysts, and anyone eager to harness the power of data!
#DataAnalysis #SQL #LearningSQL #DataInsights #DataScience #Analytics
ViewShift: Hassle-free Dynamic Policy Enforcement for Every Data LakeWalaa Eldin Moustafa
Dynamic policy enforcement is becoming an increasingly important topic in today’s world where data privacy and compliance is a top priority for companies, individuals, and regulators alike. In these slides, we discuss how LinkedIn implements a powerful dynamic policy enforcement engine, called ViewShift, and integrates it within its data lake. We show the query engine architecture and how catalog implementations can automatically route table resolutions to compliance-enforcing SQL views. Such views have a set of very interesting properties: (1) They are auto-generated from declarative data annotations. (2) They respect user-level consent and preferences (3) They are context-aware, encoding a different set of transformations for different use cases (4) They are portable; while the SQL logic is only implemented in one SQL dialect, it is accessible in all engines.
#SQL #Views #Privacy #Compliance #DataLake
Global Situational Awareness of A.I. and where its headedvikram sood
You can see the future first in San Francisco.
Over the past year, the talk of the town has shifted from $10 billion compute clusters to $100 billion clusters to trillion-dollar clusters. Every six months another zero is added to the boardroom plans. Behind the scenes, there’s a fierce scramble to secure every power contract still available for the rest of the decade, every voltage transformer that can possibly be procured. American big business is gearing up to pour trillions of dollars into a long-unseen mobilization of American industrial might. By the end of the decade, American electricity production will have grown tens of percent; from the shale fields of Pennsylvania to the solar farms of Nevada, hundreds of millions of GPUs will hum.
The AGI race has begun. We are building machines that can think and reason. By 2025/26, these machines will outpace college graduates. By the end of the decade, they will be smarter than you or I; we will have superintelligence, in the true sense of the word. Along the way, national security forces not seen in half a century will be un-leashed, and before long, The Project will be on. If we’re lucky, we’ll be in an all-out race with the CCP; if we’re unlucky, an all-out war.
Everyone is now talking about AI, but few have the faintest glimmer of what is about to hit them. Nvidia analysts still think 2024 might be close to the peak. Mainstream pundits are stuck on the wilful blindness of “it’s just predicting the next word”. They see only hype and business-as-usual; at most they entertain another internet-scale technological change.
Before long, the world will wake up. But right now, there are perhaps a few hundred people, most of them in San Francisco and the AI labs, that have situational awareness. Through whatever peculiar forces of fate, I have found myself amongst them. A few years ago, these people were derided as crazy—but they trusted the trendlines, which allowed them to correctly predict the AI advances of the past few years. Whether these people are also right about the next few years remains to be seen. But these are very smart people—the smartest people I have ever met—and they are the ones building this technology. Perhaps they will be an odd footnote in history, or perhaps they will go down in history like Szilard and Oppenheimer and Teller. If they are seeing the future even close to correctly, we are in for a wild ride.
Let me tell you what we see.
Predictably Improve Your B2B Tech Company's Performance by Leveraging DataKiwi Creative
Harness the power of AI-backed reports, benchmarking and data analysis to predict trends and detect anomalies in your marketing efforts.
Peter Caputa, CEO at Databox, reveals how you can discover the strategies and tools to increase your growth rate (and margins!).
From metrics to track to data habits to pick up, enhance your reporting for powerful insights to improve your B2B tech company's marketing.
- - -
This is the webinar recording from the June 2024 HubSpot User Group (HUG) for B2B Technology USA.
Watch the video recording at https://youtu.be/5vjwGfPN9lw
Sign up for future HUG events at https://events.hubspot.com/b2b-technology-usa/
Beyond the Basics of A/B Tests: Highly Innovative Experimentation Tactics You...Aggregage
This webinar will explore cutting-edge, less familiar but powerful experimentation methodologies which address well-known limitations of standard A/B Testing. Designed for data and product leaders, this session aims to inspire the embrace of innovative approaches and provide insights into the frontiers of experimentation!
Analysis insight about a Flyball dog competition team's performanceroli9797
Insight of my analysis about a Flyball dog competition team's last year performance. Find more: https://github.com/rolandnagy-ds/flyball_race_analysis/tree/main
A presentation that explain the Power BI Licensing
Novel Computational Approaches to Investigate Microbial Diversity
1. Novel Computational Approaches to
Investigate Microbial Diversity
Qingpeng Zhang
Department of Computer Science and Engineering
Michigan State University
Advisor: Dr. Titus Brown
1
2. Outline
• Background and motivation
• An efficient k-mer counting approach
• Novel method to investigate microbial
diversity
– Concept of IGS (informative genomic segment)
– Testing IGS method on simulated data sets
– Testing IGS method on real metagenome data
• Summary
2
Background and motivation
3. Microbial diversity: Sorcerer II Global Ocean
Sampling Expedition
How many different species in a sea water sample? What is their
abundance distribution? (alpha-diversity) [Hint: ~10,000 different types
of microorganisms]
Are samples from tropical area and temperate area different?(beta-
diversity) [Hint: Yes, but how different?]
4. ”...functional analysis of the collective genomes of
soil microflora, which we term the metagenome of
the soil.”
- J. Handelsman et al., 1998
Most of the microorganisms can not be
cultured and isolated and sequenced in
way.
In a gram of soil, there are approximately a billion microbial cells,
containing an estimated 4 petabase pairs of DNA (Jack A. Gilbert,2013)
+
Improvement of next generation sequencing = data deluge
+
Decreasing cost of sequencing 4
Metagenomics and
“big data”
5. ”...functional analysis of the collective genomes
of soil microflora, which we term the
metagenome of the soil.”
- J. Handelsman et al., 1998
most of the microorganisms can not be
cultured and isolated and sequenced in
traditional way.
In a gram of soil, there are approximately a billion microbial cells,
containing an estimated 4 petabase pairs of DNA (Jack A. Gilbert,2013)
+
Improvement of next generation sequencing = data deluge
+
Decreasing cost of sequencing 5
Metagenomics and
“big data”
6. ”...functional analysis of the collective genomes
of soil microflora, which we term the
metagenome of the soil.”
- J. Handelsman et al., 1998
most of the microorganisms can not be
cultured and isolated and sequenced in
traditional way.
In a gram of soil, there are approximately a billion microbial cells,
containing an estimated 4 petabase pairs of DNA (Jack A. Gilbert,2013)
+
Improvement of next generation sequencing = data deluge
+
Decreasing cost of sequencing
http://www.e-janco.com/
6
Metagenomics and
“big data”
7. 7
Bacterial genome size: 139,000 bps to 13,000,000 bps
Human genome size: 3,000,000,000 bps
Metagenomics and
“big data”
Tools friendly to big data are required.
8. Sorcerer II Global Ocean Sampling Expedition
How many different species in a sea water sample? What is their
abundance distribution? (alpha-diversity) [Hint: ~10,000 different types
of microorganisms, 10 million viruses, one million bacteria in a drop.]
Are samples from tropical area and temperate area different?(beta-
diversity) [Hint: Yes, but how different?]
12. Which library has more titles?
With only shredded pieces of pages
with (partial) sentences on it to read.
13. How similar are the libraries by their collection?
With only shredded pieces of pages
with (partial) sentences on it to read.
14. Sequencing
AssemblyReads Contigs
1000+ bp
Abundance
Mapping
3x
1x
1x
2x
Species A
Species B
Species C
Species D
BinningSpecies
Sample1
Sample2
Sample3
Sample4
Sample5
Sample1 Sample2 Sample3 Sample4 Sample5
Species A 3 3 4 4 0
Species B 1 3 0 2 2
Species C 1 2 2 2 3
Species D 2 1 2 1 1
A typical pipeline of metagenome diversity analysis
Loosely based on slide by Mads Albertsen
100-150 bp
14
16. Sequencing
AssemblyReads Contigs
1000+ bp
Abundance
Mapping
3x
1x
1x
2x
Species A
Species B
Species C
Species D
BinningSpecies
Sample1
Challenges:
• Assembly? - difficult (eg. Only small portions of reads can be
assembled)
• Binning? – difficult (eg. may need reference genomes, computationally
expensive)
• Mapping? – difficult (eg. accuracy, computationally expensive)
• 4 petabase pairs of DNA in a gram of soil(Jack A. Gilbert,2013)
A typical pipeline of metagenome diversity analysis
100-150 bp
Samples by species table
16
18. Reads -> k-mers
18
K-mer : DNA segment with length of k.
>24288227
TTTGCCTGTTGAAAACCTGTAAACGGGATGTTTCCGGGGTTTTCCGCCCCGGTAGGGTTGAGAC
GTGCCCCGCGGTCGCGAACAGCTCGCCGCTTACCGGCGTAAGAGCGATCCGCAACACACCCCG
GAGCCTCTACCCCCCCCTCACGC
TTTGCCTGTT
TTGCCTGTTG
TTTCCGGGGT
TTCCGGGGTT
TTCCGGGGTT
ATCCGCGGTT
TTCCGGGGTT
TTCCGGGGTT
TTCCGGCCGTT
GGTTTTTCCG
19. Reads – sample A K-mers – sample A
Reads – sample B K-mers – sample B
19
Counting (unique) k-mers to evaluate diversity
20. Reads – sample A K-mers – sample A
Reads – sample B K-mers – sample B
20
Counting (unique) words to evaluate diversity
21. • handle large number of k-mers. (simple hash table will not
work)
• retrieve count of k-mer randomly (in-memory).
– To check the occurrence of a k-mer in multiple samples to find shared
k-mers
21
Challenges in counting k-mers
Soil metagenome
sample
Number of reads Number of k-mers
k=29
Number of
unique k-mers
IOHH.2301.7.1859 273,021,397 32,762,567,744 22,333,571,795
22. Outline
• Background and motivation
• An efficient k-mer counting approach
• Novel method to investigate microbial
diversity
– Concept of IGS (informative genomic segment)
– Testing IGS method on simulated data sets
– Testing IGS method on real metagenome data
• Summary
22
An efficient k-mer counting approach
23. o The Count-min Sketch consists of one or more hash
tables of different size
o Each entry in the hash tables is a counter representing
the number of k-mers that hash to that location
o To retrieve the count for a given k-mer we select the
minimum count across all of the hash entries.
Highly scalable: Constant memory consuming,
independent of k and dataset size
Probabilistic properties well suited to next generation
sequencing datasets
Memory usage is fixed and low, with certain
counting false positive rate as tradeoff because
of collision
The one-sided counting error is low and
predictable.
Khmer - An efficient k-mer counting approach
23
24. • My contributions:
• algorithm design/analysis, exploring the mathematics behind, the choice of optimal parameters
• contributing codes, including unique k-mers counting, overlap k-mer counting, optimal
parameter choice, others related to my specific research project.
• benchmarking, testing
• exploration of applications like error trimming, filter low abundance reads, digital normalization,
etc. suggestion on features
• work on the khmer manuscript 24
An efficient k-mer counting approach
27. Outline
• Background and motivation
• An efficient k-mer counting approach
• Novel method to investigate microbial
diversity
– Concept of IGS (informative
– Testing IGS method on simulated data sets
– Testing IGS method on real metagenome data
• Summary
27
Concept of IGS (informative genomic segment)
29. • IGS (informative genomic segment)
– can represent the novel information of a genome
– can be used as a new unit to do diversity analysis to replace species
– Assembly-free
– Reference-free
– Efficient and scalable
Replace
samples-by-species table
with
samples-by-IGSs table
IGSs
(Informative Genomic Segment)
Reads
Genome
29
30. 1. We can use median k-mer abundance to estimate the
sequencing coverage of a read without a reference assembly.
2. We can retrieve the coverage of a read across different
samples.
3. If a read has a coverage as C, there will be approximately
other C-1 reads with the same coverage covering the same
DNA region.
4. We can estimate the size of covered genomic region by the
number of reads and the corresponding coverage.
Four tricks!
From reads to IGSs
30
31. Reads – sample A K-mers – sample A
The abundance of the k-mers in a read tends to be
similar, which is close to the coverage of the read.
Coverage of a read and how to get it without a
reference assembly
31
Coverage of read: the sequencing depth of the DNA region that read
originates from
35. 35
Trick 1: We can use median k-mer
abundance to estimate the sequencing
coverage of a read without a reference
assembly.
median k-mer abundance to represent
the sequencing coverage of the read
36. Reads – sample A K-mers – sample B
36
Trick 2: We can estimate the sequencing
coverage of a read across different
samples
Trick 1: We can use median k-mer
abundance to estimate the sequencing
coverage of a read without a reference
assembly.
37. Coverage = 4
Sample A
Sample B
Sample C
Read Coverage Profile:
Coverage = 6
Coverage = 2 37
41. 41
What is the size of genomic region covered by the reads in each bin?
What we know:
C: coverage of the read in the sample in the bin
N: number of reads in the bin
42. Reads – sample A K-mers – sample A
42
Trick 3: If a read has a coverage as C,
there will be approximately other C-1
reads with the same coverage covering
the same DNA region.
43. 43
Reads – sample A
Trick 4: We can estimate the size of
covered genomic region by the number
of reads(N) and the corresponding
coverage(C).
44. 44
Reads – sample A
N ~= 7, C ~= 7
N ~= 30, C ~= 10
Trick 4: We can estimate the size of
covered genomic region by the number
of reads(N) and the corresponding
coverage(C).
45. Reads – sample A
45
N ~= 7, C ~= 7
N ~= 30, C ~= 10
Size of covered
DNA region
N/C = 30/10 = 3 N/C = 7/7= 1
Trick 4: We can estimate the size of
covered genomic region by the number
of reads(N) and the corresponding
coverage(C).
46. Reads – sample A
46
Trick 4: We can estimate the size of
covered genomic region by the number
of reads(N) and the corresponding
coverage(C).
N ~= 7, C ~= 7
N ~= 30, C ~= 10
Size of covered
DNA region
N/C = 30/10 = 3 N/C = 7/7= 1
Unit of size of covered DNA region:
IGS - IGS(informative genomic segment)
47. 47
Do the reads in each bin cover the same size of genomic region?
6 reads with coverage of 3 in the sample where they are from
2 reads with coverage of 2 in the sample where they are from
VS
6/3 = 2 4/2 = 2 2/2 = 1
49. Sequencing
AssemblyReads Contigs
1000+ bp
Abundance
Mapping
3x
1x
1x
2x
Species A
Species B
Species C
Species D
BinningSpecies
Sample1
Challenges:
• Assembly? - difficult (eg. Only small portions of reads can be
assembled)
• Binning? – difficult (eg. may need reference genomes, computationally
expensive)
• Mapping? – difficult (eg. accuracy, computationally expensive)
• 4 petabase pairs of DNA in a gram of soil(Jack A. Gilbert,2013)
Species-by-sample table
A typical pipeline of metagenome diversity analysis
100-150 bp
49
50. IGS(informative genomic segment) can
represent the novel information of a genome
• The more IGSs there are in a sample, the higher diversity , higher richness the sample has.
• The more IGSs two samples share, the more similar the two samples are.
IGS (informative genomic segment):
genomic segments that do not share genomic content with the same length of read
50
(meta)Genome size = number of IGSs x IGS length (read length)
51. Outline
• Background and motivation
• An efficient k-mer counting approach
• Novel method to investigate microbial
diversity
– Concept of IGS (informative genomic segment)
– Testing IGS method on simulated data sets
– Testing IGS method on real metagenome data
• Summary
51
Testing IGS method on simulated data sets
52. Simulated data sets with different species composition
52
1. Estimated (meta)genome size matches real size perfectly.
2. Evenness metric can represent species distribution correctly
No sequencing error is introduced in this simulated data
55. Influence of error rate and coverage to
alpha diversity analysis
Metagenome size is more accurate with increasing coverage
and lower error rate
55
56. 56
Beta diversity is less prone to error rate and low coverage
Influence of error rate and coverage to
beta diversity analysis
57. Outline
• Background and motivation
• An efficient k-mer counting approach
• Novel method to investigate microbial
diversity
– Concept of IGS (informative genomic segment)
– Testing IGS method on simulated data sets
– Testing IGS method on real metagenome data
• Summary
57
Testing IGS method on real metagenome data
58. Sorcerer II Global Ocean Sampling Expedition
It has been calculated that microbes in ocean
account for about half of the biomass on Earth.
In a drop (one millilitre) of seawater, one can
find 10 million viruses, one million bacteria
59. Tropical - Galapogas
Tropical – Open Ocean
Sargasso
Temperate - North
Temperate - South
Estuary
Samples can be separated by
locations using IGS-based method –
as good as the result in original
research based on alignment-based
method or better.
TemperateTropicalandSargasso
60. Estuary
Temperate - North
Temperate -South
Tropical - Open Ocean
Tropical - Galapogas
Sargasso
Alpha diversity analysis shows
samples from tropical area have
higher richness.
Temperate
Tropical and Sargasso
61. ARMO (Amazon Rain Forest Microbial Observatory) project
Soil metagenome
sample
Number of reads Number of k-mers
k=29
Number of
unique k-mers
IOHH.2301.7.1859 273,021,397 32,762,567,744 22,333,571,795
21 samples, 1T size of data, 5 billion reads.
62. 62
Blue: Prairie
Red: Forest
1. Conversion (forest -> pasture) affects
composition
2. Prairie samples more similar in space
3. Subsamples with 8M reads are used.
64. 64
Using subsamples can get decent
result of beta diversity.
Blue: Prairie
Red: Forest
Mantel correlation to
similarity matrix calculated
from subsample with 8M
reads
65. Alpha diversity analysis shows
samples from prairie area have
higher richness than forest area.
Blue: Prairie
Red: Forest
66. Outline
• Background and motivation
• An efficient k-mer counting approach
• Novel method to investigate microbial
diversity
– Concept of IGS (informative genomic segment)
– Testing IGS method on simulated data sets
– Testing IGS method on real metagenome data
• Summary
66
Summary
67. 67
• A whole framework with potentials:
• Take all information into account, rare species
• Alpha diversity ( richness, evenness) (Chao1, ACE
estimators, etc.)
• Beta diversity ( abundance-based, incidence-based)
• Integrate with existing packages (khmer, mothur, QIIME,
scikit-bio,etc.)
• Scalable, efficient:
• Based on efficient k-mer counting
• Using subsamples may be enough for specific task
Summary
68. • Extend applications beyond diversity analysis
– Extracts interesting reads by coverage profile
– Reads binning/classification based on reads coverage
profile
– Genome size estimation/sequencing effort evaluation
• Refine pipeline, optimize performance
– Adjust IGS resolution
– Improve methods to handle large number of IGSs
more efficiently
– Iterative beta diversity analysis
68
What’s next
69. Publications
• Using the concept of informative genomic segment to investigate
microbial diversity of metagenomic sample (in preparation)
• [stream Crossing the streams: a framework for streaming analysis of
short DNA sequencing reads. Qingpeng Zhang, Sharon Awad, C. Titus Brown.
(submitted) https://peerj.com/preprints/890/
• [khmer] These are not the k-mers you are looking for: efficient online k-mer
counting using a probabilistic data structure. Qingpeng Zhang, Jason Pell,
Rosangela Canino-Koning, Adina Chuang Howe, C. Titus Brown. PLOS ONE, July 25,
2014, DOI: 10.1371/journal.pone.0101271
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0101271
• [diginorm] A Reference-Free Algorithm for Computational
Normalization of Shotgun Sequencing Data. C. Titus Brown, Adina Howe,
Qingpeng Zhang, Alexis B. Pyrkosz, Timothy H. Brom. Submitted.
http://arxiv.org/abs/1203.4802
• [Osedax] Genomic versatility and functional variation between two
dominant heterotrophic symbionts of deep-sea Osedax worms. Shana K Goffredi,
Hana Yi, Qingpeng Zhang, Jane E Klann,Isabelle A Struve, Robert C Vrijenhoek and
C Titus Brown. The ISME Journal doi:10.1038/ismej.2013.201
IGS method
seaworm symbiont
digital normalization
khmer
error analysis
69
70. Dr. Titus Brown
Lab members of GED
Dr. Sherine Awad
Michael Crusoe
Jiarong Guo
Luiz Irber
Camille Scott
Collaborators
Dr. James Tiedje
Dr. Joan Ross
Dr. Shana K Goffredi
Yiseul KIm
Acknowledgement
Committee members
Jaimes Cole
Richard Enbody
Yanni Sun
Eric Torng
Former members of GED
Dr. Adina Howe
Eric McDonald
Dr. Jason Pell
Dr. Likit Preeyanon
Dr. Elijah Lowe
khmer developers