his study investigated the microbial community in a full scale anaerobic baffled reactor and sequencing batch reactor system for oil-produced water treatment in summer and winter. The community structures of fungi and bacteria were analyzed through polymerase chain reaction–denaturing gradient gel electrophoresis and Illumina high-throughput sequencing, respectively. Chemical oxygen demand effluent concentration achieved lower than 50 mg/L level after the system in both summer and winter, however, chemical oxygen demand removal rates after anaerobic baffled reactor treatment system were significant higher in summer than that in winter, which conformed to the microbial community diversity. Saccharomycotina, Fusarium, and Aspergillus were detected in both anaerobic baffled reactor and sequencing batch reactor during summer and winter. The fungal communities in anaerobic baffled reactor and sequencing batch reactor were shaped by seasons and treatment units, while there was no correlation between abundance of fungi and chemical oxygen demand removal rates. Compared to summer, the total amount of the dominant hydrocarbon degrading bacteria decreased by 10.2% in anaerobic baffled reactor, resulting in only around 23% of chemical oxygen demand was removed in winter. Although microbial community significantly varied in the three parallel sulfide reducing bacteria, the performance of these bioreactors had no significant difference between summer and winter.
Research Inventy : International Journal of Engineering and Science is published by the group of young academic and industrial researchers with 12 Issues per year. It is an online as well as print version open access journal that provides rapid publication (monthly) of articles in all areas of the subject such as: civil, mechanical, chemical, electronic and computer engineering as well as production and information technology. The Journal welcomes the submission of manuscripts that meet the general criteria of significance and scientific excellence. Papers will be published by rapid process within 20 days after acceptance and peer review process takes only 7 days. All articles published in Research Inventy will be peer-reviewed.
2017 - Analysis of nitrifying microbial communities by FISH and 16S rRNA ampl...WALEBUBLÉ
Nitrification, the sequential oxidation of ammonia via nitrite to nitrate, is an important process for nitrogen removal from municipal wastewater. This process is catalysed by ammonia-oxidizing bacteria (AOB) and nitrite-oxidizing bacteria (NOB), two different groups of slow-growing microorganisms whose cooperation is needed to achieve complete nitrification. High efficiency and stability of this process is required for wastewater treatment plants (WWTPs) operational optimization due to
nitrification is often subjected to recurring collapse in many WWTPs. Therefore, a better understanding of the microbial ecology of nitrifying bacteria in WWTPs could
potentially improve the nitrification stability. Novel high-throughput molecular methods, as next generation sequencing (NGS), are nowadays providing detailed knowledge on the microorganisms governing wastewater treatment systems. This
methods in conjunction with the environmental ordination of the relationships between biological variables (nitrifying bacterial community) and physicochemical variables (nitrogen compounds and environmental conditions) provide a powerful
tool to elucidate how selection pressures imposed by operational and environmental conditions affect community diversity and dynamics within activated sludge systems.
Characterization of organic compounds from biosolids of Buenos Aires City, Silvana Torri
Como citar este trabajo
Torri S.I., C. Alberti. 2012. Characterization of organic compounds from biosolids of Buenos Aires City, Journal of Soil Science and Plant Nutrition, 12 (1), 143-152
Application of rapid bioassay method for assessing its water purification by ...inventionjournals
Integral toxicity of four water samples taken from various sources, urban and rural environment was evaluated, and some of the properties of potassium ferrate K2FeO4 as the reagent for chemical purification of water were explored. These data allow to suggest bacterial luminescence based test system for practical use. Thetest system is suitable for rapid evaluation of toxicity of the used for water purification chemical agents, as well as for selection of their effective concentrations and for optimization of treatment time.
2017 - Comparison of nitrifying microbial communities of two full-scale membr...WALEBUBLÉ
Barbarroja, P., Moreno-Mesonero, L., Zornoza, A., Fernández-Navarro, J., Alonso, J.L., Muñagorri, F., García, C., Álvarez, C. (2017) Comparison of nitrifying microbial communities of two full-scale membrane bioreactors treating wastewaters from municipal solid wastes using 16S rDNA gene amplicon sequencing. 7th congress of European microbiologists FEMS 2017, Valencia, Spain, 9-13 July 2017.
2017 - Environmental Ordination of Filamentous Bacteria in Activated SludgeWALEBUBLÉ
Reference:
Zornoza, A., Serrano, S. and Alonso, J.L. (2017) Environmental Ordination of Filamentous Bacteria in Activated Sludge. In: Abstracts of the 7th congress of European microbiologists FEMS 2017, Valencia, Spain, 9-13 July 2017.
2017 - Plausible Bioindicators of Biological Nitrogen Removal Process in WWTPsWALEBUBLÉ
Reference:
Zornoza, A., Alonso, J.L. and Serrano, S. (2017) Plausible Bioindicators of Biological Nitrogen Removal Process in WWTPs. In: Abstracts of the 7th congress of European microbiologists FEMS 2017, Valencia, Spain, 9-13 July 2017.
2017 - Environmental ordination of nitrifying bacterial community dynamics in...WALEBUBLÉ
Biological nitrification-denitrification is commonly used for nitrogen removal in Wastewater Treatment Plants (WWTPs). Nitrification, is the sequential oxidation of ammonia via nitrite to nitrate. This process is catalysed by ammonia-oxidizing bacteria and archaea (AOB and AOA) and nitrite-oxidizing bacteria (NOB), whose cooperation is needed to achieve complete nitrification. They are a phylogenetically diverse guild with pronounced ecological niche specialization and they differ from each other in fundamental physiological and molecular traits. Although the nitrification process in WWTPs has been investigated in depth, the response of microbial
communities are still a focus of considerable interest due to their high sensitivity to inhibitory compounds and environmental factors, that results in repeated breakdowns of nitrification performance. Most of studies have been mainly descriptive and/or exploratory and environmental interpretation has not been addressed. In this study, we focus on the environmental ordination of the relationships between biological variables (nitrifying bacterial community) and physicochemical variables (nitrogen compounds and environmental conditions), to propose new strategies to improve the performance of the nitrogen removal process in WWTPs.
ABSTRACT- This study is an attempt to analyze the water quality of river Ganga in Patna district. Water samples
were collected from 16 different Ghats during March-May 2017. Due to heavy discharge of municipal waste and
anthropogenic activities in the river the biological, chemical and physical characteristics of water have changed to a
considerable extent. The objectives of this study were to find out the changes in physicochemical nature as well as
biological health of river Ganga. Samples were analyzed on various physicochemical parameter i.e. Total Hardness, pH,
B.O.D., and D.O. by using the standard methods and procedures. The result shown that the average pH -7.95, average,
D.O.-2.91 mg/L, average B.O.D. -2.41 mg/L, average total hardness -114.72 mg/L. Microbial analysis was also
conducted in terms of Most Probable Number [MPN] of total coliforms in the water sample and it shown the highest
value for all samples. The presence and absence of the gas bubble in each tube were used to calculate an index known as
the Most Probable Number.
Key-words- Ganga, Patna, Physicochemical, Microbial, Coliforms, MPN, D.O., B.O.D., Hardness, pH
Research Inventy : International Journal of Engineering and Science is published by the group of young academic and industrial researchers with 12 Issues per year. It is an online as well as print version open access journal that provides rapid publication (monthly) of articles in all areas of the subject such as: civil, mechanical, chemical, electronic and computer engineering as well as production and information technology. The Journal welcomes the submission of manuscripts that meet the general criteria of significance and scientific excellence. Papers will be published by rapid process within 20 days after acceptance and peer review process takes only 7 days. All articles published in Research Inventy will be peer-reviewed.
2017 - Analysis of nitrifying microbial communities by FISH and 16S rRNA ampl...WALEBUBLÉ
Nitrification, the sequential oxidation of ammonia via nitrite to nitrate, is an important process for nitrogen removal from municipal wastewater. This process is catalysed by ammonia-oxidizing bacteria (AOB) and nitrite-oxidizing bacteria (NOB), two different groups of slow-growing microorganisms whose cooperation is needed to achieve complete nitrification. High efficiency and stability of this process is required for wastewater treatment plants (WWTPs) operational optimization due to
nitrification is often subjected to recurring collapse in many WWTPs. Therefore, a better understanding of the microbial ecology of nitrifying bacteria in WWTPs could
potentially improve the nitrification stability. Novel high-throughput molecular methods, as next generation sequencing (NGS), are nowadays providing detailed knowledge on the microorganisms governing wastewater treatment systems. This
methods in conjunction with the environmental ordination of the relationships between biological variables (nitrifying bacterial community) and physicochemical variables (nitrogen compounds and environmental conditions) provide a powerful
tool to elucidate how selection pressures imposed by operational and environmental conditions affect community diversity and dynamics within activated sludge systems.
Characterization of organic compounds from biosolids of Buenos Aires City, Silvana Torri
Como citar este trabajo
Torri S.I., C. Alberti. 2012. Characterization of organic compounds from biosolids of Buenos Aires City, Journal of Soil Science and Plant Nutrition, 12 (1), 143-152
Application of rapid bioassay method for assessing its water purification by ...inventionjournals
Integral toxicity of four water samples taken from various sources, urban and rural environment was evaluated, and some of the properties of potassium ferrate K2FeO4 as the reagent for chemical purification of water were explored. These data allow to suggest bacterial luminescence based test system for practical use. Thetest system is suitable for rapid evaluation of toxicity of the used for water purification chemical agents, as well as for selection of their effective concentrations and for optimization of treatment time.
2017 - Comparison of nitrifying microbial communities of two full-scale membr...WALEBUBLÉ
Barbarroja, P., Moreno-Mesonero, L., Zornoza, A., Fernández-Navarro, J., Alonso, J.L., Muñagorri, F., García, C., Álvarez, C. (2017) Comparison of nitrifying microbial communities of two full-scale membrane bioreactors treating wastewaters from municipal solid wastes using 16S rDNA gene amplicon sequencing. 7th congress of European microbiologists FEMS 2017, Valencia, Spain, 9-13 July 2017.
2017 - Environmental Ordination of Filamentous Bacteria in Activated SludgeWALEBUBLÉ
Reference:
Zornoza, A., Serrano, S. and Alonso, J.L. (2017) Environmental Ordination of Filamentous Bacteria in Activated Sludge. In: Abstracts of the 7th congress of European microbiologists FEMS 2017, Valencia, Spain, 9-13 July 2017.
2017 - Plausible Bioindicators of Biological Nitrogen Removal Process in WWTPsWALEBUBLÉ
Reference:
Zornoza, A., Alonso, J.L. and Serrano, S. (2017) Plausible Bioindicators of Biological Nitrogen Removal Process in WWTPs. In: Abstracts of the 7th congress of European microbiologists FEMS 2017, Valencia, Spain, 9-13 July 2017.
2017 - Environmental ordination of nitrifying bacterial community dynamics in...WALEBUBLÉ
Biological nitrification-denitrification is commonly used for nitrogen removal in Wastewater Treatment Plants (WWTPs). Nitrification, is the sequential oxidation of ammonia via nitrite to nitrate. This process is catalysed by ammonia-oxidizing bacteria and archaea (AOB and AOA) and nitrite-oxidizing bacteria (NOB), whose cooperation is needed to achieve complete nitrification. They are a phylogenetically diverse guild with pronounced ecological niche specialization and they differ from each other in fundamental physiological and molecular traits. Although the nitrification process in WWTPs has been investigated in depth, the response of microbial
communities are still a focus of considerable interest due to their high sensitivity to inhibitory compounds and environmental factors, that results in repeated breakdowns of nitrification performance. Most of studies have been mainly descriptive and/or exploratory and environmental interpretation has not been addressed. In this study, we focus on the environmental ordination of the relationships between biological variables (nitrifying bacterial community) and physicochemical variables (nitrogen compounds and environmental conditions), to propose new strategies to improve the performance of the nitrogen removal process in WWTPs.
ABSTRACT- This study is an attempt to analyze the water quality of river Ganga in Patna district. Water samples
were collected from 16 different Ghats during March-May 2017. Due to heavy discharge of municipal waste and
anthropogenic activities in the river the biological, chemical and physical characteristics of water have changed to a
considerable extent. The objectives of this study were to find out the changes in physicochemical nature as well as
biological health of river Ganga. Samples were analyzed on various physicochemical parameter i.e. Total Hardness, pH,
B.O.D., and D.O. by using the standard methods and procedures. The result shown that the average pH -7.95, average,
D.O.-2.91 mg/L, average B.O.D. -2.41 mg/L, average total hardness -114.72 mg/L. Microbial analysis was also
conducted in terms of Most Probable Number [MPN] of total coliforms in the water sample and it shown the highest
value for all samples. The presence and absence of the gas bubble in each tube were used to calculate an index known as
the Most Probable Number.
Key-words- Ganga, Patna, Physicochemical, Microbial, Coliforms, MPN, D.O., B.O.D., Hardness, pH
La accesibilidad universal permite a todas las personas vivir con dignidad sus aspiraciones y retos personales, sean cuales sean sus necesidades y formas de funcionamiento en su entorno.
Monitoring Sebaran dan Tutupan Komponen Dasar Terumbu Karang Serta Identifikasi Batas Wilayah pada DPL (Daerah Perlindungan Laut) Desa Patikarya di Wilayah Kerja COREMAP II
Kabupaten Selayar
In recent decades, necessity to protect environment has been a serious concern for all people and international communities. In appropriate development of human economic activities, subsistence dependence of the growing world population on nature decreases the natural diversity of ecosystems and habitats day by day and provides additional constraints for life and survival of wildlife. As a result, implementation of programs to protect species and ecosystems is of great importance. The current study was carried out to implement a comprehensive strategic environmental management plan in the Mond protected area in southern Iran. Accordingly, the protected area was zoned using multi criteria decision method. According to the numerical models, fifteen data layer were obtained on a scale of 1:50,000. The results revealed that 28.35% out of the entire study area belongs to nature conservation zone. In the following step, in order to offer the strategic planning using strength, weaknesses, opportunities and threats method, a total number of 154 questionnaires were prepared and filled by the relevant experts. For this purpose, after identifying the internal and external factors, they were weighted in the form of matrices as; internal factor evaluation and external factor evaluation. Analytical hierarchy process and expert choice software were applied to weight the factors. At the end, by considering the socioeconomic and environmental issues, the strategy of using protective strategies in line with international standards as well as a strong support of governmental national execution with a score of 6.05 was chosen as the final approach.
ABSTRACT- The development of human civilization throughout history has led to growing disruption of the natural
balance and the occurrence of different types of pollution. Environmental pollution with petroleum and petrochemical
products has been recognized as significant and serious problem. Diesel engine oil, which is one of the major products of
crude oil, constitutes a major source of pollution in our environment. Therefore diesel engine oil can enter into the
environment through wrecks of oil tankers carrying diesel oil, cleaning of diesel tanks by merchants, war ships carrying
diesel oil and motor mechanics. In present study the microorganisms utilising petrol and diesel oil as carbon source were
isolated and investigation of their characteristics towards the production of polyhydroxyalkanoates (PHA), which is now a
days well known as biodegradable polymer.
Key Words- Petrol and Diesel oil contamination, Bioremediation, Biodegradable bacterial polymer, Sudan
Black B staining, 16sr RNA sequencing
The International Journal of Engineering and Science (The IJES)theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
— Municipal Solid Waste (MSW), mainly Kitchen Waste
(K) with Cow Dung (C) and Fungi Culture (F) can be used to
generate energy which could save on the fossil fuels conventionally
used as source of energy. In this study, the possibility was
explored to mix Cow Dung with Fungi Culture for anaerobic
digestion, so that energy can be generated as biogas and at the
same time digested sludge can be used as fertilizer for agricultural
applications. Pre-treatment of Kitchen Waste was done by alkali
method. Anaerobic digestion (AD) was carried out in mesophilic
temperature range of 30°C to 37°C with different fermentation
slurries of 8 % total solids. Digestion was carried for a retention
period of 60 days. The gas produced was collected by the
downward displacement of water and was subsequently measured
and analyzed. The overall results showed that blending of Kitchen
waste with cow dung and fungi culture (Aspergillus flavus) had
significant improvement on the biogas yield.
High Rate of Water Biodenitrification Using Anthracite as Hyphomicrobium Deni...theijes
Pure culture of Hyphomicrobium denitrificans DSM 1869 was immobilized on anthracite and utilized for biological denitrification in 50-ml flasks employing methanol and acetic acid as carbon source. The results demonstrate that acetic acid was a suitable carbon source for H. denitrificans to remove high nitrate concentrations. The maximum denitrification rate was 233.1 mg NO3-N/g MLSS.h and the highest NO3-N removal efficiency was obtained when using C/N ratio of 4.0 and acetic acid as the carbon source. C/N ratio can significantly affect denitrification in different operational conditions. The low C/N ratios did not allow the denitrification process to be completed in case of high NO3-Nconcentrations. High C/N ratio increased the rate of nitrate conversion when using acetic acid as a carbon source; but added a pollutant to denitrified water when using methanol as a carbon source. The results demonstrated that H. denitrificans was a suitable bacterium for denitrifying high NO3-N concentrations.
Determination of volatile organic compounds in surface water and sediment usi...IOSR Journals
This research presents the development of a methodology for analysing volatile organic compounds in selected zones of Asa River, Kwara State. The liquid-liquid extraction procedure of two organic solvent (Hexane : Dichloromethane) (1:1 v/v) was employed to remove volatile organic compounds from river and sediment samples, for further identification and quantification showed very good recovery and repeatability. The mean recovery percentage range was between 96.7±1.5 - 104.0±1.0 for river samples while 97.3±2.2 - 104.0±1.0 for sediment samples at a fortification level of 0.01 μg/l. In addition, volatile organic compounds were determined by Gas chromatography – mass spectrometry. The limit of quantification was 0.05 μg/l which was below the maximum level allowed by the European council directives for volatile organic compounds (0.5 μg/l).
International Journal of Engineering and Science Invention (IJESI) inventionjournals
International Journal of Engineering and Science Invention (IJESI) is an international journal intended for professionals and researchers in all fields of computer science and electronics. IJESI publishes research articles and reviews within the whole field Engineering Science and Technology, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online
Anaerobic Digestion of Vinasse cane alcohol: The influence of OLR by a UASB ...IJMER
An Anaerobic Sludge Blanket (UASB) reactor was used to study the treatment of distillery
effluent. Vinasse was used to feed the reactor, although its Chemical Oxygen Demand (COD)
concentration varied during the experiment, the volume utilized to feed the reactor was adjusted to
maintain constant Organic Load Rate (OLR). The UASB reactor was operated with OLR 1, 2, 4 and 6
gCOD/Ld. Removal efficiencies of 76,64,63 and 51% respectively were observed. The reactor responded
with progressive decreases of efficiency with each increase of OLR, the total mass removed increased.
An average biogas production of 1.400, 1.872, 2.17 and 2.172 L to each OLR of 1, 2, 4 and 6 gCOD/Ld,
respectively was observed. The methane content in biogas was 63, 68, 86 and 89% each OLR tested.
Methane production is also followed with values of .892 L to OLR 1 gCOD/Ld, 1.264 L to OLR 2
gCOD/Ld, 1.876 L to OLR 4 gCOD/Ld and 2.900 L to OLR 6 gCOD/Ld.
The UASB reactor operating in continuous mode, it was necessary to evaluate the best conditions for
this type of waste. The treatment of distillery effluents using a UASB reactor is feasible and is an
alternative to treat these wastes in the alcohol industries
Low Cost Anaerobic Treatment of Municipal Solid Waste Leachateiosrjce
IOSR Journal of Environmental Science, Toxicology and Food Technology (IOSR-JESTFT) multidisciplinary peer-reviewed Journal with reputable academics and experts as board member. IOSR-JESTFT is designed for the prompt publication of peer-reviewed articles in all areas of subject. The journal articles will be accessed freely online
Fertilizer plant waste carbon slurry has been investigated after some processing as an adsorbent for the removal of dyes and phenols using columns. The results show that the carbonaceous adsorbent prepared from carbon slurry being porous and having appreciable surface area (380 m2/g) can remove dyes both cationic (meldola blue, methylene blue, chrysoidine G, crystal violet) as well as anionic (ethyl orange, metanil yellow, acid blue 113), and phenols (phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol) fruitfully from water. The column type continuous flow operations were used to obtain the breakthrough curves. The breakthrough capacity, exhaustion capacity and degree of column utilization were evaluated from the plots. The results shows that the degree of column utilization for dyes lies in the range 60 to 76% while for phenols was in the range 53-58%. The exhaustion capacities were quite high as compared to the breakthrough capacities and were found to be 217, 211, 104, 126, 233, 248, 267 mg/g for meldola blue, crystal violet, chrysoidine G, methylene blue, ethyl orange, metanil yellow, acid blue 113, respectively and 25.6, 72.2, 82.2 and 197.3 mg/g for phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol, respectively
Reforestation is one of the Philippines’ government efforts to restore and rehabilitate degraded mangrove ecosystems. Although there is recovery of the ecosystem in terms of vegetation, the recovery of closely-linked faunal species in terms of community structure is still understudied. This research investigates the community structure of mangrove crabs under two different management schemes: protected mangroves and reforested mangroves. The transect-plot method was employed in each management scheme to quantify the vegetation, crab assemblages and environmental variables. Community composition of crabs and mangrove trees were compared between protected and reforested mangroves using non-metric multi-dimensional scaling and analysis of similarity in PRIMER 6. Chi-squared was used to test the variance of sex ration of the crabs. Canonical Correspondence Analysis was used to determine the relationship between crabs and environmental parameters. A total of twelve species of crabs belonging to six families were identified in protected mangroves while only four species were documented in reforested mangroves. Perisesarma indiarum and Baptozius vinosus were the most dominant species in protected and reforested mangrove, respectively. Univariate analysis of variance of crab assemblage data revealed significant differences in crab composition and abundance between protected mangroves and from reforested mangroves (P<0.05).><0.05).Environmental factors and human intervention had contributed to the difference in crab assemblages in mangrove ecosystems.
Estuaries are well known for their potential in removing metal from fresh water to provide micro-nutrients to aquatic life. In the present investigation, we have tried to bring out the metal removal potential of estuaries during accidental spills. For this purpose artificial river water containing high concentration of Mn, Cu, Zn, Ni and Pb were mixed with sea water at different salinity regimes. Water samples were taken from a station on the main branch of Tajan River that flows in to the Caspian Sea. For this purpose, solutions with a concentration of 5 mg/L of each studied metal (Mn,Cu, Zn, Pb) were prepared in Tajan River water. The salinity regimes include 3, 6, 8, 10 and 11 ppt. It was noted that metal concentration decreased by increasing salinity. Metals were flocculated at different rates: Cu (88%) > Ni (86%) > Pb (84%) > Mn (74%).Thus, as average about 80% of total elemental content flocculates. Hence, it was concluded that a large amount of micro nutrients is carried by the river and flocculated in the estuary where the river water mixes with the sea water which may play a vital role in supplying nutrients to the aquatic animals. Cluster analyses have shown that Mn and Ni are governed by EC, pH and salinity.
The current investigation presents the role of gooseberry (Phyllanthus acidus) seeds as an effective biosorbent for remediating chromium (VI)), a toxic heavy metal pollutant commonly found in effluents from tanneries and relevant industries. Biosorption was affected by pH, temperature and initial metal concentration. Furthermore, there is a need to understand the holistic effect of all variables to ascertain the best possible conditions for adsorption, therefore, these factors were considered and a total of 17 trials were run according to the Box Behnken design. Quadratic model had maximum R2 value (0.9984) and larger F value (1109.92). From the Analysis Of Variance table and R2 value, quadratic model was predicted to be the significant model with the best fit to the generated experimental data. The optimal parameters obtained from the contour plot for the maximum removal of chromium(VI) were initial metal concentration of 60 mg/L, pH value of 2, and temperature of 27°C. Under these conditions, maximum removal of 92% was obtained. Thus this biosorbent substantially eliminates chromium(VI) under optimized conditions, enabling its use in larger scale.
The present work was carried out to evaluate the removal of p-nitrophenol by adsorption onto olive cake based activated carbon having a BET surface area of 672 m²/g. The batch adsorption experimental results indicated that the equilibrium time for nitrophenol adsorption by olive cake-based activated carbon was 120min. The adsorption data was modeled by equilibrium and kinetic models. The pseudo- first and second order as well as the Elovichkinetic models were applied to fit the experimental data and the intraparticle diffusion model was assessed for describing the mechanism of adsorption. The data were found to be best fitted to the pseudo-second order model with a correlation coefficient (R2=0.986). The intraparticle diffusion mechanism also showed a good fit to the experimental data, showing two distinct linear parts assuming that more than one step could be involved in the adsorption of nitrophenol by the activated carbon. The equilibrium study was performed using three models including Langmuir, Freundlich and Temkin. The results revealed that the Temkin equilibrium model is the best model fitting the experimental data (R2=0.944). The results of the present study proved the efficiency of using olive cake based activated carbon as a novel adsorbent for the removal of nitrophenol from aqueous solution.
The major aim of the present study was to investigate element (Fe, Ni, Pb, V, Zn) concentrations in sediment and different tissues of Phragmities australis and Typha latifolia in Hor al-Azim Wetland Southwest Iran. Sampling of sediments and aquatic plants was carried out during spring and summer 2014. Results showed that the mean concentrations of elements in Phragmities australis in root and stem-leaf were as follows: Iron:4448 mg/kg, Nickel: 28 mg/kg, Lead:8 mg/kg, Vanadium:10 mg/kg and Zinc 15.5 mg/kg in root and: Fe:645 mg/kg, Ni:15 mg/kg, Pb:4 mg/kg, V:4 mg/kg and Zinc 16 mg/kg respectively. Also, the mean concentrations of Fe, Ni, Pb, V and Zn in roots of Typha latifolia were 8696 mg/kg, 34 mg/kg, 5 mg/kg, 19 mg/kg and 27 mg/kg respectively. The mean concentrations of Fe, Ni, V, Pb, Zn in stem-leaves of Typha latifolia were as follows: 321 mg/kg, 3 mg/kg, 7 mg/kg, 2 mg/kg and 14 mg/kg respectively. The mean concentrations of Fe, Ni, V, Pb and zinc were as: 40991 mg/kg, 65 mg/kg, 60 mg/kg, 31 mg/kg, 60 mg/kg respectively in surface sediment of study area. Concentration pattern of elements in sediment were as: Fe>Ni>Zn>V>Pb. The highest concentration of elements in the plant was seen in the roots. Also, Typha latifolia can uptake more concentration of elements than Phragmities australis. Based on the enrichment factor, Ni in summer had the highest EF values among the elements studied and it has a moderate enrichment.
In recent years managing solid wastes has been one of the burning problems in front of state and local municipal authorities. This is mainly due to scarcity of lands for landfill sites. In this context experts suggest that conversion of solid waste to energy and useful component is the best approach to reduce space and public health related problems. The entire process has to be managed by technologies that prevent pollution and protect the environment and at the same time minimize the cost through recovery of energy. Energy recovery in the form of electricity, heat and fuel from the waste using different technologies is possible through a variety of processes, including incineration, gasification, pyrolysis and anaerobic digestion. These processes are often grouped under “Waste to Energy technologies”. The objective of the study is twofold. First authors assessed the current status of solid waste management practices in India. Secondly the leading barriers are identified and Interpretive structural modeling technique and MICMAC analysis is performed to identify the contextual interrelationships between leading barriers influencing the solid waste to energy programs in the country. Finally the conclusions are drawn which will assist policy makers in designing sustainable waste management programs.
Water is a unique natural resource among all sources available on earth. It plays an important role in economic development and the general well-being of the country. This study aimed at using the application of water quality index in evaluating the ground water quality innorth-east area of Jaipur in pre and post monsoon for public usage. Total eleven physico–chemical characteristics; total dissolved solids, total hardness,chloride, nitrate, electrical conductance, sodium, fluorideand potassium, pH, turbidity, temperature) were analyzed and observed values were compared with standard values recommended by Indian standard and World Health Organization. Most of parameter show higher value than permissible limit in pre and post monsoon. Water quality index study showed that drinking water in Amer (221.58,277.70), Lalawas (362.74,396.67), Jaisinghpura area (286.00,273.78) were found to be highly contaminated due to high value of total dissolved solids, electrical conductance, total hardness, chloride, nitrate and sodium.Saipura (122.52, 131.00), Naila (120.25, 239.86), Galta (160.9, 204.1) were found to be moderately contaminated for both monsoons. People dependent on this water may prone to health hazard. Therefore some effective measures are urgently required to enhance the quality of water in these areas.
Sub critical water as a green solvent for production of valuable materialsGJESM Publication
gricultural waste biomass generated from agricultural production and food processing industry are abundant, such as durian peel, mango peel, corn straw, rice bran, corn shell, potato peel and many more. Due to low commercial value, these wastes are disposed in landfill, which if not managed properly may cause environmental problems. Currently, environmental laws and regulations pertaining to the pollution from agricultural waste streams by regulatory agencies are stringent and hence the application of toxic solvents during processing has become public concern. Recent development in valuable materials extraction from the decomposition of agricultural waste by sub-critical water treatment from the published literature was review. Physico-chemical characteristic (reaction temperature, reaction time and solid to liquid ratio) of the sub-critical water affecting its yield were also reviewed. The utilization of biomass residue from agriculture, forest wood production and from food and feed processing industry may be an important alternative renewable energy supply. The paper also presents future research on sub-critical water.
Sub critical water as a green solvent for production of valuable materialsGJESM Publication
Agricultural waste biomass generated from agricultural production and food processing industry are abundant, such as durian peel, mango peel, corn straw, rice bran, corn shell, potato peel and many more. Due to low commercial value, these wastes are disposed in landfill, which if not managed properly may cause environmental problems. Currently, environmental laws and regulations pertaining to the pollution from agricultural waste streams by regulatory agencies are stringent and hence the application of toxic solvents during processing has become public concern. Recent development in valuable materials extraction from the decomposition of agricultural waste by sub-critical water treatment from the published literature was review. Physico-chemical characteristic (reaction temperature, reaction time and solid to liquid ratio) of the sub-critical water affecting its yield were also reviewed. The utilization of biomass residue from agriculture, forest wood production and from food and feed processing industry may be an important alternative renewable energy supply. The paper also presents future research on sub-critical water.
Priming of prosopis cineraria (l.) druce and acacia tortilis (forssk) seedsGJESM Publication
Composting of waste plant materials and its use in agriculture and landscape sites is an environmental friendly way of reducing waste material and conserving the environment. In this perspectives a survey has been performed at the Dubai based International Center for Biosaline Agriculture to compost the plants based waste material (lawn cuttings-grass) to compost. The material was inoculated with a consortium of microbes leading to form stable and mature compost with high organic matter (38%). In order to conduct seed germination tests, Fulvic acid was extracted from the compost. A pot experiment was conducted over a period of 30 days in the green house to study the effect of Fulvic acid on the seed germination, and plant growth of Prosopis cineraria (L.) Druce (Ghaff) and Acacia tortilis (Forssk.) Hayne. Seeds of both trees were treated with Fulvic acid at 0.5% and 1% and water treatment was used as control. Generally seed germination and biomass were increased at both rates of fulvic acid. However, a pronounced increase was found in seed germination when fulvic acid was used at 1.0% (Prosopis cineraria 27%; Acacia tortilis 20% increase over control). Similarly biomass (shoot and root) of A. tortilis and P. cineraria was increase 34% and 94% respectively.
Methylene blue is widely used in various industrial branches. Due to insufficient treatment, its occurrence in wastewater is frequently detected, which may result in serious environment problems to aquatic organisms. Hydroponic experiments were conducted with rice seedlings (Oryza sativa L. cv. XZX 45) exposed to methylene blue to determine the effective concentration using relative growth rate and water use efficiency as response endpoints. Results showed that acute toxicity of methylene blue to rice seedlings was evident. Although a linear decrease in relative growth rate and water use efficiency was observed in rice seedlings with increasing methylene blue concentrations, relative growth rate of rice seedlings was more sensitive to change of methylene blue than water use efficiency. Using non-linear regression, EC-48 h values for 10%, 20% and 50% inhibition of the relative growth rate were estimated to be 1.54, 3.22 and 10.13 mg MB/L for rice seedlings exposed to methylene blue, respectively, while smaller EC were obtained for 96 h exposure. In conclusion, the toxic response of young rice seedlings to methylene blue is obvious and inhibitory effects are highly dependent on response endpoints and the duration of exposure period.
Equilibrium and kinetic study on chromium (vi) removal from simulatedGJESM Publication
Gooseberry seed (Phyllanthus acidus) was used as an adsorbent to determine its feasibility for the removal of Cr(VI). Various parameters such as pH, temperature, contact time, initial metal concentration and adsorbent dosage were investigated to determine the biosorption performance. Equilibrium was attained within 60 minutes and maximum removal of 96% was achieved under the optimum conditions at pH 2. The adsorption phenomenon demonstrated here was monolayer represented by Langmuir isotherm with R2 value of 0.992 and the Langmuir constants k and q0 was found to be 0.0061 (L/mg) and 19.23 (mg/g). The adsorption system obeyed Pseudo second order kinetics with R2 value of 0.999. The results of the present study indicated that gooseberry seed powder can be employed as adsorbent for the effective removal of hexavalent chromium economically.
Effect of the chemical nature of fixed bed reactor support materials onGJESM Publication
This study investigated the effect, on reactor performance and biomass retention inside the bed, of the material used to make the supports of anaerobic fixed-bed reactors. Three inert supports of similar shape but made of three different materials polyvinyl chloride, polypropylene, high-density polyethylene were manufactured and used. All three supports had the same specific surface area but different relative densities. Three identical 10 L lab-scale upflow anaerobic fixed-bed reactors were filled (80% of the working volume) each respectively with polyvinyl chloride, polypropylene and polyethylene support, and fed with vinasse (44 g total COD/L) for 140 days at 35 °C. The organic loading rates were increased from 0.5 g/L.d to the maximum acceptable by each reactor. Fairly similar maximum organic loading rates were reached for each type of support, with values above 20 g of COD/L.d and more than 80 % soluble chemical oxygen demand removal efficiency. A very large amount of biomass was entrapped and attached in all the supports and represented more than 95% of the total biomass inside the reactors. In terms of performance and biomass accumulation, this study demonstrated quite similar behavior for anaerobic fixed-bed reactors with supports made of different materials, which suggests that the nature of the material used to make the supports has no major influence. The chemical nature of the support material clearly has negligible effect and thus the size, shape, and porosity of the support must be more influential.
Deposition of carbon nanotubes in commonly used sample filter mediaGJESM Publication
There is no single standard technique or methodology to characterize the size, structure, number, and chemical composition of airborne carbon nanotubes. Existing analytical instruments and analytical techniques for evaluating nanoparticle concentrations cannot simultaneously provide morphology, state of agglomeration, surface area, mass, size distribution and chemical composition data critical to making occupational health assessments. This research utilized scanning electron microscopy and thermogravimetric analysis to assess the morphology and mass of carbon nanotubes collected using various commercial sample filters. It illustrated carbon nanotube agglomeration, deposition and distribution in commonly used sample filter media. It also illustrated that a sufficient mass for carbon nanotube analysis by thermogravimetric analysis is uncommon under most current research and production uses of carbon nanotubes. Individual carbon nanotubes were found to readily agglomerate with diameters ranging from 1 – 63 µm. They were collected at the face of or within the filter. They were not evenly distributed across the face of the filters.
Comparative potential of black tea leaves waste to granular activated carbonGJESM Publication
The adsorption properties and mechanics of selected endocrine disrupting compounds; 17 β-estradiol, 17 α – ethinylestradiol and bisphenol A on locally available black tea leaves waste and granular activated carbon were investigated. The results obtained indicated that the kinetics of adsorption were pH, adsorbent dose, contact time and temperature dependent with equilibrium being reached at 20 to 40 minutes for tea leaves waste and 40 to 60 minutes for granular activated compound. Maximum adsorption capacities of 3.46, 2.44 and 18.35 mg/g were achieved for tea leaves waste compared to granular activated compound capacities of 4.01, 2.97 and 16.26 mg/g for 17 β- estradiol, 17 α-ethinylestradiol and bisphenol A respectively. Tea leaves waste adsorption followed pseudo-first order kinetics while granular activated compound fitted better to the pseudo-second order kinetic model. The experimental isotherm data for both tea leaves waste and granular activated compound showed a good fit to the Langmuir, Freundlich and Temkin isotherm models with the Langmuir model showing the best fit. The thermodynamic and kinetic data for the adsorption indicated that the adsorption process for tea leaves waste was predominantly by physical adsorption while the granular activated compound adsorption was more chemical in nature. The results have demonstrated the potential of waste tea leaves for the adsorptive removal of endocrine disrupting compounds from water.
Keywords
Biochar impact on physiological and biochemical attributes of spinachGJESM Publication
Disastrous effect of nickel on spinach was discussed by number of authors but the effect of amendments like biochar with nickel on Spinacea oleraceaL. is not still discussed by any author of the world because biochar was used as soil amendments which play a vital role in reducing mobilization and uptake of nickel by spinach plants. As nickel contaminated plants are very harmful for the consumption by living organisms. Nickel can be gathered in agronomic soils by anthropogenic actions such as Ni-Cd batteries. In this study, the growth, physiological, photosynthetic and biochemical responses of Spinacia oleracea grown in Ni-spiked soil (0, 25, 50 and 100 mg Ni/Kg soil) at three levels of cotton-sticks-derived biochar “CSB” (0, 3 and 5 %) were evaluated. The results exposed significant decrease in growth, photosynthetic, physiological, and biochemical traits of S. oleracea when grown in Ni-polluted soil. However, this decrease was less pronounced in CSB amended soil. A steady rise in the MDA (0.66 µg/g to 2.08 µg g-1), ascorbic acid (1.24 mg/g to 1.57 mg/g)and sugar concentrations (1.73 mg/g to 2.16 mg/g)was observed with increased concentration of Ni. The increasing percentages of CSB from 3 % to 5 % decreased Ni concentrations in root and shoot of experimental plant. Higher production of chlorophyll, amino acids and protein with CSB amendment looked like alleviation in Ni toxicity. Therefore, it is concluded that, Ni toxicity and availability to the plants can be reduced by CSB amendments.
Particulate matter effect on biometric and biochemical attributes of fruiting...GJESM Publication
Dust accumulation capacity of Ficus carica L. and Psidium guajava L. was investigated from eight
different sites of Multan, Pakistan. Leaves of both plants were used for analyzing biometric (leaf area, fresh and dry
weights) and biochemical attributes (chlorophyll contents, carotenoids and ascorbic acid). Maximum dust accumulation was occurred in the plants growing near road sites, while, minimum dust accumulation occurred in the plants of Bahauddin Zakariya University. Most of the biometric and biochemical attributes of F. carica showed significant response towards dust but it had not significant influence on some attributes of P. guajava. Biochemical traits of P. guajava appeared to be more prone than foliage ones. A positive correlation was found between dust accumulation and foliage attributes in F. carica. On the other hand, in P. guajava opposite was observed, however, the reverse was true for leaf biomass. Biochemical contents had shown an inconsistency as chlorophylls (a, b & total), carotenoid contents declined but ascorbic acid increased with an increase in dust accumulation in both species.
Plankton diversity and aquatic ecology of a freshwater lake (L3) at Bharti Is...GJESM Publication
The Larsemann Hills range is an ice-free oasis on the Ingrid Christensen Coast of Princess Elizabeth
Land, East Antarctica, which includes Bharti Island, Fisher Island, McLeod Island, Broknes Peninsula, Stornes
Peninsula, and several other islands, promontories, and nunataks. The Larsemann Hills is an ice-free area of
approximately 50 km2, located halfway between the Vestfold Hills and the Amery Ice Shelf on the south-eastern
coast of Prydz Bay, Princess Elizabeth Land, East Antarctica. The ice-free area consists of two major peninsulas (Stornes and Broknes), four minor peninsulas, and approximately 130 near shore islands. The Larsemann Hills area contains more than 150 lakes at different Islands and peninsulas. Bharti Island of Larsemann Hills in east Antarctica was selected as a sampling site for the present study. Water sample was collected from a freshwater lake during XXXth Indian Scientific Expedition to Antarctica (ISEA) and analyzed for the physico-chemical parameters, major elements, trace metals and major plankton diversity in surface lake water by following standard methodology. The concentrations of metals Cu, Pb, Cd, Zn and Cr were measured using Inductively Coupled Plasma Optical Emission Spectroscopy (ICP-OES). Phytoplankton and zooplankton were also assessed in the aquatic ecosystem of Lake L3 at Bharti Island, Larsemann Hills over east Antarctica. Psychrophillic bacteria were found 71 cfu in lake water, while total bacterial count was found to be 5.4 × 102cfu.
Removal of ammonium ions from wastewater A short review in development of eff...GJESM Publication
Ammonium ions wastewater pollution has become one of the most serious environmental problems
today. The treatment of ammonium ions is a special concern due to their recalcitrance and persistence in the environment. In recent years, various methods for ammonium ion removal from wastewater have been extensively studied. This paper reviews the current methods that have been used to treat ammonium ion wastewater and evaluates these techniques. These technologies include ion exchange, adsorption, biosorption, wet air oxidation, biofiltration, diffused
aeration, nitrification and denitrification methods. About 75 published studies (1979-2015) are reviewed in this paper.
It is evident from the literature survey articles that ion exchange, adsorption and biological technology are the most frequently studied for the treatment of ammonium ion wastewater.
UNDERSTANDING WHAT GREEN WASHING IS!.pdfJulietMogola
Many companies today use green washing to lure the public into thinking they are conserving the environment but in real sense they are doing more harm. There have been such several cases from very big companies here in Kenya and also globally. This ranges from various sectors from manufacturing and goes to consumer products. Educating people on greenwashing will enable people to make better choices based on their analysis and not on what they see on marketing sites.
"Understanding the Carbon Cycle: Processes, Human Impacts, and Strategies for...MMariSelvam4
The carbon cycle is a critical component of Earth's environmental system, governing the movement and transformation of carbon through various reservoirs, including the atmosphere, oceans, soil, and living organisms. This complex cycle involves several key processes such as photosynthesis, respiration, decomposition, and carbon sequestration, each contributing to the regulation of carbon levels on the planet.
Human activities, particularly fossil fuel combustion and deforestation, have significantly altered the natural carbon cycle, leading to increased atmospheric carbon dioxide concentrations and driving climate change. Understanding the intricacies of the carbon cycle is essential for assessing the impacts of these changes and developing effective mitigation strategies.
By studying the carbon cycle, scientists can identify carbon sources and sinks, measure carbon fluxes, and predict future trends. This knowledge is crucial for crafting policies aimed at reducing carbon emissions, enhancing carbon storage, and promoting sustainable practices. The carbon cycle's interplay with climate systems, ecosystems, and human activities underscores its importance in maintaining a stable and healthy planet.
In-depth exploration of the carbon cycle reveals the delicate balance required to sustain life and the urgent need to address anthropogenic influences. Through research, education, and policy, we can work towards restoring equilibrium in the carbon cycle and ensuring a sustainable future for generations to come.
Micro RNA genes and their likely influence in rice (Oryza sativa L.) dynamic ...Open Access Research Paper
Micro RNAs (miRNAs) are small non-coding RNAs molecules having approximately 18-25 nucleotides, they are present in both plants and animals genomes. MiRNAs have diverse spatial expression patterns and regulate various developmental metabolisms, stress responses and other physiological processes. The dynamic gene expression playing major roles in phenotypic differences in organisms are believed to be controlled by miRNAs. Mutations in regions of regulatory factors, such as miRNA genes or transcription factors (TF) necessitated by dynamic environmental factors or pathogen infections, have tremendous effects on structure and expression of genes. The resultant novel gene products presents potential explanations for constant evolving desirable traits that have long been bred using conventional means, biotechnology or genetic engineering. Rice grain quality, yield, disease tolerance, climate-resilience and palatability properties are not exceptional to miRN Asmutations effects. There are new insights courtesy of high-throughput sequencing and improved proteomic techniques that organisms’ complexity and adaptations are highly contributed by miRNAs containing regulatory networks. This article aims to expound on how rice miRNAs could be driving evolution of traits and highlight the latest miRNA research progress. Moreover, the review accentuates miRNAs grey areas to be addressed and gives recommendations for further studies.
Artificial Reefs by Kuddle Life Foundation - May 2024punit537210
Situated in Pondicherry, India, Kuddle Life Foundation is a charitable, non-profit and non-governmental organization (NGO) dedicated to improving the living standards of coastal communities and simultaneously placing a strong emphasis on the protection of marine ecosystems.
One of the key areas we work in is Artificial Reefs. This presentation captures our journey so far and our learnings. We hope you get as excited about marine conservation and artificial reefs as we are.
Please visit our website: https://kuddlelife.org
Our Instagram channel:
@kuddlelifefoundation
Our Linkedin Page:
https://www.linkedin.com/company/kuddlelifefoundation/
and write to us if you have any questions:
info@kuddlelife.org
Willie Nelson Net Worth: A Journey Through Music, Movies, and Business Venturesgreendigital
Willie Nelson is a name that resonates within the world of music and entertainment. Known for his unique voice, and masterful guitar skills. and an extraordinary career spanning several decades. Nelson has become a legend in the country music scene. But, his influence extends far beyond the realm of music. with ventures in acting, writing, activism, and business. This comprehensive article delves into Willie Nelson net worth. exploring the various facets of his career that have contributed to his large fortune.
Follow us on: Pinterest
Introduction
Willie Nelson net worth is a testament to his enduring influence and success in many fields. Born on April 29, 1933, in Abbott, Texas. Nelson's journey from a humble beginning to becoming one of the most iconic figures in American music is nothing short of inspirational. His net worth, which estimated to be around $25 million as of 2024. reflects a career that is as diverse as it is prolific.
Early Life and Musical Beginnings
Humble Origins
Willie Hugh Nelson was born during the Great Depression. a time of significant economic hardship in the United States. Raised by his grandparents. Nelson found solace and inspiration in music from an early age. His grandmother taught him to play the guitar. setting the stage for what would become an illustrious career.
First Steps in Music
Nelson's initial foray into the music industry was fraught with challenges. He moved to Nashville, Tennessee, to pursue his dreams, but success did not come . Working as a songwriter, Nelson penned hits for other artists. which helped him gain a foothold in the competitive music scene. His songwriting skills contributed to his early earnings. laying the foundation for his net worth.
Rise to Stardom
Breakthrough Albums
The 1970s marked a turning point in Willie Nelson's career. His albums "Shotgun Willie" (1973), "Red Headed Stranger" (1975). and "Stardust" (1978) received critical acclaim and commercial success. These albums not only solidified his position in the country music genre. but also introduced his music to a broader audience. The success of these albums played a crucial role in boosting Willie Nelson net worth.
Iconic Songs
Willie Nelson net worth is also attributed to his extensive catalog of hit songs. Tracks like "Blue Eyes Crying in the Rain," "On the Road Again," and "Always on My Mind" have become timeless classics. These songs have not only earned Nelson large royalties but have also ensured his continued relevance in the music industry.
Acting and Film Career
Hollywood Ventures
In addition to his music career, Willie Nelson has also made a mark in Hollywood. His distinctive personality and on-screen presence have landed him roles in several films and television shows. Notable appearances include roles in "The Electric Horseman" (1979), "Honeysuckle Rose" (1980), and "Barbarosa" (1982). These acting gigs have added a significant amount to Willie Nelson net worth.
Television Appearances
Nelson's char
Natural farming @ Dr. Siddhartha S. Jena.pptxsidjena70
A brief about organic farming/ Natural farming/ Zero budget natural farming/ Subash Palekar Natural farming which keeps us and environment safe and healthy. Next gen Agricultural practices of chemical free farming.
Diabetes is a rapidly and serious health problem in Pakistan. This chronic condition is associated with serious long-term complications, including higher risk of heart disease and stroke. Aggressive treatment of hypertension and hyperlipideamia can result in a substantial reduction in cardiovascular events in patients with diabetes 1. Consequently pharmacist-led diabetes cardiovascular risk (DCVR) clinics have been established in both primary and secondary care sites in NHS Lothian during the past five years. An audit of the pharmaceutical care delivery at the clinics was conducted in order to evaluate practice and to standardize the pharmacists’ documentation of outcomes. Pharmaceutical care issues (PCI) and patient details were collected both prospectively and retrospectively from three DCVR clinics. The PCI`s were categorized according to a triangularised system consisting of multiple categories. These were ‘checks’, ‘changes’ (‘change in drug therapy process’ and ‘change in drug therapy’), ‘drug therapy problems’ and ‘quality assurance descriptors’ (‘timer perspective’ and ‘degree of change’). A verified medication assessment tool (MAT) for patients with chronic cardiovascular disease was applied to the patients from one of the clinics. The tool was used to quantify PCI`s and pharmacist actions that were centered on implementing or enforcing clinical guideline standards. A database was developed to be used as an assessment tool and to standardize the documentation of achievement of outcomes. Feedback on the audit of the pharmaceutical care delivery and the database was received from the DCVR clinic pharmacist at a focus group meeting.
Characterization and the Kinetics of drying at the drying oven and with micro...Open Access Research Paper
The objective of this work is to contribute to valorization de Nephelium lappaceum by the characterization of kinetics of drying of seeds of Nephelium lappaceum. The seeds were dehydrated until a constant mass respectively in a drying oven and a microwawe oven. The temperatures and the powers of drying are respectively: 50, 60 and 70°C and 140, 280 and 420 W. The results show that the curves of drying of seeds of Nephelium lappaceum do not present a phase of constant kinetics. The coefficients of diffusion vary between 2.09.10-8 to 2.98. 10-8m-2/s in the interval of 50°C at 70°C and between 4.83×10-07 at 9.04×10-07 m-8/s for the powers going of 140 W with 420 W the relation between Arrhenius and a value of energy of activation of 16.49 kJ. mol-1 expressed the effect of the temperature on effective diffusivity.
Characterization and the Kinetics of drying at the drying oven and with micro...
Gjesm148651451593800
1. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
69
ABSTRACT: This study investigated the microbial community in a full scale anaerobic baffled reactor and sequencing
batch reactor system for oil-produced water treatment in summer and winter. The community structures of fungi and
bacteria were analyzed through polymerase chain reaction–denaturing gradient gel electrophoresis and Illumina high-
throughput sequencing, respectively. Chemical oxygen demand effluent concentration achieved lower than 50 mg/Llevel
after the system in both summer and winter, however, chemical oxygen demand removal rates after anaerobic baffled
reactor treatment system were significant higher in summer than that in winter, which conformed to the microbial
community diversity. Saccharomycotina, Fusarium, and Aspergillus were detected in both anaerobic baffled reactor and
sequencing batch reactor during summer and winter. The fungal communities in anaerobic baffled reactor and sequencing
batch reactor were shaped by seasons and treatment units, while there was no correlation between abundance of fungi
and chemical oxygen demand removal rates. Compared to summer, the total amount of the dominant hydrocarbon
degrading bacteria decreased by 10.2% in anaerobic baffled reactor, resulting in only around 23% of chemical oxygen
demand was removed in winter. Although microbial community significantly varied in the three parallel sulfide reducing
bacteria, the performance of these bioreactors had no significant difference between summer and winter.
KEYWORDS: Anaerobic baffled reactor (ABR); Denaturing gradient gel electrophoresis (DGGE); High throughput
sequencing; Microbial community; Seasonal variations; Sequencing batch reactor (SBR); Oilfield produced
water; Sulfide reducing bacteria (SRB); Wastewater treatment plant (WWTP)
Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
DOI: 10.7508/gjesm.2016.01.008
*Corresponding Author Email: shaoyuanbai@126.com
Tel.: +86 13978389750; Fax: +86 13978389750
Note. Discussion period for this manuscript open until March
1, 2016 on GJESM website at the “Show Article”.
Seasonal variations of microbial community in a full scale oil field
produced water treatment plant
Q. Xie1
, S. Bai1,*
, Y. Li1
, L. Liu2
, S. Wang1
, J. Xi3
1
Center of Mining, Metallurgy and Environment, Guilin University of Technology, Guilin 541004, China
2
Hezhou University, Hezhou 542800, China
3
State Environmental Protection Key Laboratory of Microorganism Application and Risk Control,
Tsinghua University, Beijing 100084, China
INTRODUCTION
Oilfield produced water consists of toxic, aromatic,
and contaminated hypersaline water, which normally
are complex organic compounds, such as phenolics
and aromatic hydrocarbons, benzene, toluene,
ethylbenzene, xylene, naphthalene, phenanthrene, and
dibenzothiophene. The discharges of oilfield-produced
water without proper treatment can contaminate soil
and water bodies due to the existence of the toxic
organic compounds. Conventional treatment for
oilfield-produced water mainly relies on physical-
chemical methods, including gravity separation,
dissolved air flotation, hydrogen peroxide treatment,
photocatalytic degradation, coagulation and
flocculation . Since some halophilic bacteria, yeast and
fungi can grow well with crude oil as a source of carbon
and energy, some of them were utilized for
bioremediation to purify petroleum-produced water
because of the low cost. Sequencing batch reactor
(SBR) has been widely used in petroleum-produced
Received 24 September 2015; revised 29 October 2015; accepted 10 November 2015; available online 1 December 2015
ORIGINAL RESEARCH PAPER
2. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
70
Q. Xie et al.
water treatment, in which wastewater is initially
hydrolyzed under anoxic conditions and then treated
under aerobic conditions, by doing this, most of the
chemical oxygen demand (COD) can be removed.
Ghorbanian et al., (2014) showed that the average
petroleum hydrocarbon removal rates in an SBR were
99.9%, 99.6%, and 93.7% at initial concentrations of
950, 1450, and 2500 mg/L. Moreover, the removal rates
of COD, total organic carbon (TOC), and oil and grease
removed were 86.2%, 90.8%, and 90% respectively in a
MBR, with organic loading rate of 1.124 kg of COD/m3
d and hydraulic residence time (HRT) of 48h. Generally,
an anaerobic baffled reactor (ABR) is also used to
enhance the COD removal efficiency as a pretreatment.
Therefore, anABR and three SBRs in parallel integrated
process (Fig. 1) were employed in the oilfield-produced
wastewater treatment plant.
Microbial communities contribute to the
biodegradation of hydrocarbons and COD have been
investigated in previous molecular studies using sludge
obtained from oilfield produced water treatment plants.
Molecule microbial analytical methods such as
denaturing gradient gel electrophoresis (DGGE) profile
and high throughput sequencing, revealed that the
bacteria related to organic matter degradation belong
to different taxonomic groups, including
Methylobacterium sp., Rhodococcus aetherovorans,
Achromobacter xylosoxidans, Alcaligenes sp.,
Aquamicrobium defluvium, Rhizobium, and
Stenotrophomonas spp. . Moreover, temperature plays
a major role in biodegradation ofhydrocarbon. Changes
of the operating temperature in wastewater treatment
plants are due to seasonal variations. As removal
efficiency of hydrocarbon in a full-scale treatment plant
is different in summer and winter, the microbial
communities responsible for hydrocarbon degradation
during summer and winter are different. While the
microbial communities refer to oilfield-produced water
is scarce, especially with consideration of seasonal
effect on the microbial communities.
The studies aimed at assessment of the effects of
temperature and treatment units on microorganisms
targetingoilfield-producedwaterare still unclear.Abetter
understanding of the microbial organisms can lead to a
better understanding of the contribution ofthe microbial
organisms in the degradation of hydrocarbons in oilfield-
produced water. The aims of the present study were (i)
to assess the pollutant removal efficiency of COD in a
treatment plant; (ii) to analyze the compositions of
bacterial and fungi in the treatment plant; (iii) to select
the dominant species in the process of degrading
hydrocarbon in oilfield produced water.
Thisstudyhasbeen performed inBeihaiCity, Guangxi
ZhuangAutonomous region during 2012 to 2013.
MATERIALS AND METHODS
Study site description
The wastewater treatment plant (WWTP) was
established in 2006 to treat 1000 tons of wastewater per
day from Weizhou Island Oil Production Plant (China
National Offshore Oil Corporation). The influent
wastewater composition is illustrated in Table 1. The
plant is located in the southeast of Beihai City, Guangxi
Zhuang Autonomous Region in China. During the
system, anABR was followed bythree sequencing batch
reactors. The ABR (21 m long, 16.6 m wide and 6.5 m
high)andthreeSBRs(20.0 mlong,12.0 mwide,and5.8m
high) were connected to enhance the performance of the
WWTP. The effective volumes of the ABR and three
sulfide reducing bacteria (SRBs) were 1500, 360, 360
and 360 m3
respectively.All of the SBRs were operated
according to the following strategies: filling (1.0 h),
reaction (aeration, 8.0 h), settling (2.0 h), extraction (1
h), and idle.
Sampling and analysis
Water samples were collected from the influent and
effluent of the ABR, and three parallel SBRs effluent
(1#SBR, 2#SBR, and 3#SBR) between 9:00 and 10:00
during a day in August 2012 and February 2013
respectively. COD was measured according to standard
method. The temperature of the samples was also
determined. Statistics analysis was employed to
investigate the relationship between temperature and
COD removal efficiency/microbial diveristies using the
one-way ANOVA test in the SPSS 17.0 software and
difference were considered to be significant when
p<0.05.
Table 1: Composition of oilfield produced wastewater
Parameter Range
Cl-
/mg/L 14000–15000
CODCr/mg/L 384–584
BOD5/mg/L 50–127
Total petroleum hydrocarbon /mg/L 11.5–15
S2-
/mg/L 11.8–20.1
TN/mg/L 9–13
TP/mg/L 7–12
SS/mg/L 140–610
pH 7.8–8.2
3. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
71
Sludge samples was collected in August and
February from theABR (denoted as SAin summer and
WAin winter) and three parallel SBRs (denoted as SS1,
SS2, and SS3 for samples collected in summer and WS1,
WS2, and WS3 for samples collected in winter) for
molecular and biological analyses. Six samples at
different sites were collected from each reactor, and
then fixed and stored at “20 C before analysis.
Micobial community analysis
DNA extraction, PCR amplification, DGGE and
sequencing
The total genomic DNA was extracted from sludge
samples using Power Soil DNA isolation kit (Mo Bio
Laboratories, Inc., Carlsbad, CA, USA). DNA was
purified using Universal DNA purification kit
(TIANGEN Biotech Co., Ltd., Beijing, China) and
quantified using Nano-Drop UV-3000
spectrophotometer (Nanodrop Technologies Inc.,
Delaware, USA) according to the manufacturer’s
instructions. Isolated DNA was amplified through PCR
using primers specific for fungi (ITS1F
CTTGGTCATTTAGAGGAAGTAA and ITS4
TCCTCCGCTTATTGATATGC), targeting the ITS1
region to analyse sludge fungal communities. PCR
amplifications of the ITS1 region from genomic DNA
were performed in 25 μL mixture containing 5 μL of 5×
PrimeSTAR®
buffer with MgCl2
, 2 μL of deoxyri-
bonucleotide triphosphate mixture, 0.5 μLofeachprimer,
0.25 μL of PrimeSTAR®
HS DNA polymerase, 1 μL of
DNA, and 15.75 μL of molecular-grade water. PCR
reactions were performed as follows: 95 °C for 5 min
(one cycle); 95 °C for 30 s, 59 °C for 30 s, and 72 °C for
50 s (30 cycles); and 72 °C for 7 min (one cycle). The
amplified products were subjected to electrophoresis
on 0.8% agarose gels.All PCR amplification reactions
were performed in an S1000TM
BioRad model iCycler.
The purified PCR products were analysed on 8%
polyacryamide gels containing gradients of 31%–53%
denaturant. DGGE was performed in aDCode Universal
Mutation Detection System (Bio-Rad) at a constant
voltage of 80 V and temperature of 60 °C for 16 h in
1×TAE runningbuffer.The gels werestained with SYBR
Gold nucleic acid gel stain (Molecular Probes, Eugene,
OR) and then imaged with the FluoroImager System
Model 595 (Molecular Dynamics, Sunnyvale, CA). Gel
images were analyzed with Gelcompar II v5.0 (Applied
Maths, Sint-Martens-Latem, Belgium) to generate
dendrogram profiles.
The individual bands of the DGGE gels were excised
and eluted with 30 μL of dH2
O for 48 h at 4 °C before re-
amplification using the same set of primers. Sequencing
was performed on a 3730 DNA Analyzer using
BigDyeqR
Terminator v3.1 cycle sequencing kit
(Applied Biosystems, United States) according to the
manufacturer’s instructions. A phylogenetic tree was
constructed through neighbor-joining method using
the MEGA 4.1 with sequences and bootstrapped for
1000 iterations.
High throughput sequencing analysis
The purified totalcommunity DNA samples prepared
in 2.2.2 were submitted to Novogene Bioinformatics
Institute (Beijing, China) for high-throughput
Fig. 1: Simplified system of the Weizhou wastewater treatment plan
(pumps were not shown)
4. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
72
Microbial community changes in oil field produced water treatment plant
sequencing using Miseq Illumina. Primers for
sequencing were 515F (5’ -GTG CCAGCM GCC GCG
GTAA-3’) and 806R (5’-GGACTACHV GGG TWT
CTAAT-3’), with different barcodes for the V4 region
of the 16S rRNA gene. Reads with incorrect barcodes,
incorrect primer sequences, average quality scores of
< 25, homopolymers of > 6 and read lengths < 200 bp
were excluded from further analysis. High-quality
sequences were processed through CD-HIT to generate
operational taxonomic units (OTUs) with 97% sequence
similarity threshold. Representative sequences from
each OTU were aligned using PyNAST. Average data
were calculated for each sludge sample before analyzing
the unique and shared OTUs/genera.
RESULTS AND DISCUSSION
Effect of temperature on COD removal in the full scale
ABR-SBR
The average temperature in summer (August, 2012)
and winter (February, 2013) were 29 °C and 18 °C. The
influent concentration of COD was 535±49 mg/L in
summer and 418±34 mg/L in winter (Fig. 2). Statistical
analyses of COD removal in ABR system showed
significantly(P<0.05)lowerefficiencyinwinter(23±4%)
than in summer (30±3%), even though it received lower
influent concentration. The corresponding of low
temperature and low COD removal inABR may cause
by lower functional microbial activity appearance in
winter. However, the removal efficiencies of COD in
both season achieved 90±2% in summer and 88±4% in
winter, both with effluent concentration lower than 50
mg/L after full-scale ABR-SBR system, which proves
the high application performance of ABR-SBR
technology for oilfield produced wastewater.
Variations in fungal community composition
The DGGE fingerprints of the fungal community of
sludge sampled from theABR and SBRs during summer
and winter were analyzed and 28 different bands were
detected (Fig. 3). Phylogenetic analysis indicated that
the majority of these 28 fungal clones belonged to the
Ascomycota, which consisted of the Pezizomycotina
and the Saccharomycotina. The Pezizomycotina was
the dominant taxon and further divided into four
distinct groups, including the Fusarium, Bionectria,
Stachybotrys, and Aspergillus (Fig. 4). The
Mucoromycotina was also observed in the fungal
clones (Fig. 4). Fig. 5 shows proportion of the major
fungi in the ABR and SBRs collected in summer and
winter, with the Saccharomycotina, Fusarium, and
Aspergillus were detected in all the samples and the
rest fungi were detected conditionally with
consideration of season and treatment units.
It’s apparent to see that the Stachybotrys was
shaped by seasons and treatment units, while the
Saccharomycotina, Fusarium, and Aspergillus were
ubiquitous in all sludge sampled from ABR and SBRs
during summer and winter, although their abundance
differed. Previous studies suggested that the
filamentous fungi can produce extracellular enzymes
and degrade polycyclic aromatic hydrocarbons (PAHs).
In the present study, significant difference in the
Fig. 2: COD concentration and removal efficiencies of the ABR influent
and effluent and three parallel SBRs. Data Bars followed by different
letters are significantly different (p< 0.05)
5. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
73
removal efficiency of COD were observed between
seasons and treatment units, which may due to the
difference of microorganisms communities existed in
the sludge samples. However, the proportion of the
fungi in theABR and SBRs during summer and winter
were not corresponded to the COD removal efficiency,
which may imply that fungal community will not
influence the COD removal in the present study.
Variation in microbial community compositions
The bacterial community diversities of the sludge
used in batch tests were analyzed by lllumina
sequencing. The number of bacterial species can be
estimated using the number of OTUs (Fig. 6). Fig. 6
shows the number of OUTs in summer was higher than
in winter, indicating that the bacterial diversity was
relatively higher in summer than that in winter in terms
of eitherABR or SBRs.
Microbial community in SRBs
In aerobic sludge, the number of OTUs were 4535
(genus level) and 9203 (species level) in SS and 3647
(genus level) and 7254 (species level) in WS. In
agreement with previous reports, the present study
showed that changes in environmental conditions,
particularly temperature shock, directly influenced
microbial communities. Temperature plays a vital role
in biodegradation, and the microbial diversity in the
wastewater treatment system reduced as the reactor
progressively recovered from low-temperature shock.
Extreme temperatures may confer irreversible damages
and even death in some bacteria .
Fig. 7 shows that the majority of the bacteria (39.3%)
in the treatment plant for oilfield-produced water
belonged to the phylum Proteobacteria, followed by
the phyla Firmicutes and Chloroflexi, which accounted
for 19.6% and 13.5% of the total population,
respectively. The phyla Bacteroidetes, Actinobacteria,
and Planctomycetes accounted for 5%, 4.7%, and 2%
of the total population, respectively. Similarly, previous
research showed that bacterial communities at different
operating temperatures consisted mostly of the phyla
Proteobacteria, Bacteroidetes, and Firmicutes, which
can effectively degrade organic compounds . Analysis
of MBR and conventional sludge produced from PAH-
contaminated wastewater showed that Proteobacteria
could be the potential organism for remediating
degraded petroleum.
SS1 SS2 SS3 SA WS1 WS2 WS3 WA 0
Fig. 3. DGGE analysis of the 16S rRNA gene fragment of fungal
population from the ABR (SA for summer and WA for
winter) and three parallel SBRs (SS for summer and WS
for winter). Sequenced bands are marked on the gel.
6. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
74
Q. Xie et al.
The majority of the OTUs contained only one tag,
and tag numbers were counted at different levels to
determine the optimal taxonomic level for relevant
comparisons . The proportions of assignable tags for
the SBR andABR samples were higher than 70% at the
order level, whereas lower than 50% at the family level.
Therefore, the order level was selected as the optimal
taxonomic level for comparison.
The results demonstrate that bacterial diversity
was relatively higher in summer than that in winter
(Fig. 7). In SBRs, namely, SS samples, the most
abundant order was DRC31 from the phylum
Chloroflexi (18.16%), followed by Lactobacillales
(11.7%) and Bacillales (6.9%) from the phylum
Firmicutes. The relative abundance of Rhodospirillales
(phylum Proteobacteria), and Gammaproteobacteria
Fig. 4: Phylogenetic tree of the 16S rRNA sequences derived from the DGGE bands
7. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
75
Fig. 5: Relative abundance of the major fungi in each sludge samples from the ABR and three
parallel SBRs collected in summer and winter
No.ofOTUs
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
10000
SS WS SA WA
Sludge Samples
Species
Genus
Fig. 6: Analysis of OTUs from sludge sampled from the ABR and SBRs in
summer and winter
and Rhizobiales (phylum Proteobacteria) were
comparable, which were 4.6%, 4.3%, and 4.2%,
respectively. By contrast, WS samples harbored high
relative abundance of Pseudomonadales (35.6%,
phylum Proteobacteria), Clostridiales (12.2%, phylum
Firmicutes), and Lactobacillales (8.9%). Furthermore,
Ignavibacteriales (6.5%), and Sphingobacteriales
(7.4%) were detected in SS with low abundance and
were absent in WS (Fig. 8). The members of
Pseudomonadales, Lactobacillales, and Bacillales
participate in the biogeochemical transformation of
petroleum. Silva et al., (2013) has indicated on the
diversityofmicrobialcommunities in petroleumsamples
fromBrazilian oil fields showed that eight different phyla
(Actinobacteria, Bacteroidetes, Deferribacteres,
Spirochaetes, Firmicutes, Proteobacteria,
Thermotogae, and Synergistetes) were the dominant
groups involved in hydrocarbon degradation.According
to the performance of SBRs, the COD removal
efficiencies were similar (88.5% to 82.2%) when the
influent COD concentration were 375.5 and 320.9 mg/L
in thesummer and winter, respectively(Fig. 2).Although
the microbial communities significantly varied between
summer and winter, the relative abundance of the
dominant hydrocarbon degrading bacteria still remained
at a high level (see above metioned). Therefore, the
changes ofbacterial communities from summerto winter
did not affect the performance of SRBs.
Diversity of microbial community in ABR
The OTUs were higher in SA and reached 1787 at
the genus level and 3540 at the species level. By
contrast, the number of OTUs in WA was 1555 at the
genus level and 3057 at the species level in theABR. In
anaerobic sludge, SA samples harbored abundant
populations of Rhizobiales (13.2%), Thermotogales
(phylum Thermotogae, 10.7%), and Actinomycetales
(phylum Actinobacteria, 10.4%). Rhodospirillales and
8. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
76
Microbial community changes in oil field produced water treatment plant
Fig. 7: Microorganism distribution at the phylum level in sludge sampled from
three parallel SBRs and ABR in summer and winter
Fig. 8: Microorganism distribution at the order level in sludge sampled from three
parallel SBRs and ABR in summer and winter
9. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
77
Rhodobacterales accounted for 8.5% and 4.7% of the
population, respectively (Fig. 7). Rhodospirillales
showed the largest proportion (19.1%) of the bacterial
population in WA samples, followed by the order
Actinomycetales (18.4%). DRC31 and
Gammaproteobacteria unclassified were also
abundant and accounted for 9.7% and 8.1%,
respectively (Fig. 7). The mean proportion of DRC31
in SS was 18.2% and decreased to 5.7% in WS. High
temperatures seemed to be more beneficial in DRC31
survival under aerobic conditions than low
temperatures. However, under anaerobic conditions,
DRC31 accounted for higher proportion (9.7%) in the
WA samples than that in the SA samples (2.3%).
Although information about the role of DRC31 in
petroleum hydrocarbon degradation remains limited,
DRC31 is speculated to positively affect high COD
degradation during summer.
Actinobactera, Thermotogales and Rhizobiales are
mainly isolated from petroleum hydrocarbon-
contaminated environments, such as marine sediment,
beach, and groundwater; and genera within these
families contain members with active roles in
biogeochemical transformation of petroleum. The
relative abundance of Rhizobiales and Thermotogales
were decreased from13.15% and 10.72% in the summer
period to 5.3% and 0.4% in the winter time respectively.
However, the relative relative abundance of
Actinomycetales increased by 8.1%. The results reveal
that the total amount of the dominant hydrocarbon
degrading bacteria was decreased in the winter period,
compared to summer time.Additionally, around 159.1
and 97.4 mg/L of COD, on average, were removed in
the ABR in summer and winter respectively (Fig. 2).
Therefore, the removed COD was declined resulting
from the dominant hydrocarbon degrading bacteria
decreasing.
CONCLUSION
COD removal rates afterABR treatment system were
significantly higher in summer than in winter, which
conformed to the microbial community diversity.
Moreover, COD effluent concentration achieved lower
than 50 mg/L level after full-scale ABR-SBR system,
which proves the high performance of the technology
for oilfield-produced wastewater. The fungal
communities inABR and SBR were shaped by seasons
and treatment units, while there was no correlation
between abundance of fungi and COD removal rates.
Different seasons affected the microbial community
both inABR and in SRBs. The performance of theABR
was slightly decreased in terms of COD removal.
However, the COD removal efficiencies in the three
parallel SRBs kept stable between summer and winter.
ACKNOWLEDGEMENT
The work was funded by the National Natural
Science Foundation of China (No. 51168012), the
State Environmental Protection Key Laboratory of
Microorganism Application and Risk Control
(No. SMARC2013D 009), and supported by the project
of high level innovation team and outstanding scholar
in Guangxi Colleges and Universities.
CONFLICT OF INTEREST
The authors declare that there are no conflicts of
interest regarding the publication of this manuscript.
REFERENCES
Ahmadun, F.R.; Pendashteh, A.; Abdullah, L.C.; Biak, D.R.A.;
Madaeni, S.S.; Abidin, Z.Z., (2009). Review of technologies
for oil and gas produced water treatment. J. Hazard. Mater.,
170: 530-551 (22 pages).
Bonfá, M.R.L.; Grossman, M.J.; Mellado, E.; Durrant, L.R.,
(2011). Biodegradation of aromatic hydrocarbons by
haloarchaea and their use for the reduction of the chemical
oxygen demand of hypersaline petroleum produced water.
Chemosphere, 84: 1671–1676 (6 pages).
Cho, H.U.; Kim, Y.M.; Choi, Y.-N.; Kim, H.G.; Park, J.M., (in
press). Influence of temperature on volatile fatty acid
production and microbial community structure during
anaerobic fermentation of microalgae. Bioresource Tech.
Availablt at: http://www.sciencedirect.com/science/article/
pii/S0960852415003120
Diya’uddeen, B.H.; Daud, W.M.A.W.; Aziz, A.R.A., (2011).
Treatment technologies for petroleum refinery effluents: A
review. Process. Saf. Environ., 89: 95-105 (11 pages).
Ghorbanian, M.; Moussavi, G.; Farzadkia, M., (2014).
Investigating the performance of an up-flow anoxic fixed-
bed bioreactor and a sequencing anoxic batch reactor for the
biodegradation of hydrocarbons in petroleum-contaminated
saline water. Int. Biodeter. Biodegr., 90: 106-114 (9 pages).
Isanta, E.; Bezerra, T.; Fernández, I.; Suárez-Ojeda, M.E.; Pérez,
J.; Carrera, J., (2015). Microbial community shifts on an
anammox reactor after a temperature shock using 454-
pyrosequencing analysis. Bioresource. Tech., 181: 207-213
(7 pages).
Lors, C.; Aldaya, M.M.; Salmon, S.; Ponge, J.-F., (2006). Use
of an avoidance test for the assessment of microbial
degradation of PAHs. Soil Biol. Biochem., 38(8): 2199-
2204 (6 pages).
Lors, C.; Ponge, J.-F.; Aldaya, M.M.; Damidot, D., (2010).
Comparison of solid-phase bioassays and ecoscores to
evaluate the toxicity of contaminated soils. Environ. Pollut.,
158(8): 2640-2647 (8 pages).
10. Global J. Environ. Sci. Manage., 2(1): 69-78, Winter 2016
78
Q. Xie et al.
Lu, M.; Zhang, Z.; Yu, W.; Zhu, W., (2009). Biological
treatment of oilfield-produced water: A field pilot study.
Int. Biodeter. Biodegr., 63: 316-321 (6 pages).
Nazina, T.N.; Shestakova, N.M.; Pavlova, N.K.; Tatarkin, Y.V.;
Ivoilov, V.S.; Khisametdinov, M.R.; Sokolova, D.S.; Babich,
T.L.; Tourova, T.P.; Poltaraus, A.B.; Belyaev, S.S.; Ivanov,
M.V., (2013). Functional and phylogenetic microbial diversity
in formation waters of a low-temperature carbonate petroleum
reservoir. Int. Biodeter. Biodegr., 81: 71-81 (11 pages).
Pendashteh, A.R.; Abdullah, L.C.; Fakhru’l-Razi, A.; Madaeni,
S.S.; Abidin, Z.Z.; Biak, D.R.A., (2012). Evaluation of
membrane bioreactor for hypersaline oily wastewater
treatment. Process Saf. Environ., 90: 45-55 (11 pages).
Piubeli, F.; Grossman, M.J.; Fantinatti-Garboggini, F.; Durrant,
L.R., (2012). Enhanced reduction of COD and aromatics in
petroleum-produced water using indigenous microorganisms
and nutrient addition. Int. Biodeter. Biodegr., 68: 78-84 (22
pages).
Potin, O.; Rafin, C.; Veignie, E., (2004). Bioremediation of an
aged polycyclic aromatic hydrocarbons (PAHs)-contaminated
soil by filamentous fungi isolated from the soil. Int. Biodeter.
Biodegr., 54(1): 45-52 (8 pages).
Ren, L.; Siegert, M.; Ivanov, I.; M.Pisciotta, J.; E.Logan, B.,
(2013). Treatability studies on different refinery wastewater
samples using high-throughput microbial electrolysis cells
(MECs). Bioresource Tech., 136: 322–328 (7 pages).
Ribeiro, H.; Mucha, A.P.; Almeida, C.M.R.; Bordalo, A.A.,
(2013). Bacterial community response to petroleum
contamination and nutrient addition in sediments from a
temperate salt marsh. Sci. Total. Environ., 458-460: 568–
576 (10 pages).
Rosano-Hernández, M.C.; Ramírez-Saad, H.; Fernández-
Linares, L., (2012). Petroleum-influenced beach sediments
of the campeche bank, Mexico: Diversity and bacterial
community structure assessment. J. Environ. Manage., 95:
S325-S331 (7 pages).
Shariati, S.R.P.; Bonakdarpour, B.; Zare, N.; Ashtiani, F.Z.,
(2011). The effect of hydraulic retention time on the
performance andfouling characteristics of membrane
sequencing batch reactors used for the treatment of synthetic
petroleum refinery wastewater. Bioresource Tech., 102:
7692–7699 (8 pages).
Shen, P.; Zhang, J.; Zhang, J.; Jiang, C.; Tang, X.; Li, J.; Zhang,
M.; BoWu, (2013). Changes in microbial community
structure in two anaerobic systems to treat bagasse spraying
wastewater with and without addition of molasses alcohol
wastewater. Bioresource Tech., 131: 333–340 (8 pages).
Silva, T.R.; Verde, L.C.L.; Neto, E.V.S.; Oliveira, V.M., (2013).
Diversity analyses of microbial communities in petroleum
samples from Brazilian oil fields. Int. Biodeterior. Biodegr.,
81: 57-70 (14 pages).
Táncsics, A.; Szabó, I.; Baka, E.; Szoboszlay, S.; Kukolya, J.;
Kriszt, B.; Márialigeti, K., (2010). Investigation of catechol
2, 3-dioxygenase and 16S rRNA gene diversity in hypoxic,
petroleum hydrocarbon contaminated groundwater. Syst.
Appl. Microbiol., 33: 398–406 (6 pages).
Verma, V.; Raju, S.C.; Kapley, A.; Kalia, V.C.; Daginawala, H.F.;
Purohit, H.J., (2010). Evaluation of genetic and functional
diversity of Stenotrophomonas isolates from diverse
effluent treatment plants. Bioresource Tech., 101: 7744–
7753 (10 pages).
Wiszniowski, J.; Ziembinska, A.; Ciesielski, S., (2011). Removal
of petroleum pollutants and monitoring of bacterial
community structure in a membrane bioreactor.
Chemosphere, 83: 49–56 (8 pages).
Yeung, C.W.; Stempvoort, D.R.V.; Spoelstra, J.; Bickerton, G.;
Voralek, J.; Greer, C.W., (2013). Bacterial community
evidence for anaerobic degradation of petroleum
hydrocarbons in cold climate groundwater. Cold Reg. Sci.
Technol., 86: 55-68 )14 pages).
Zhang, X.; Gao, J.; Zhao, F.; Zhao, Y.; Li, Z., (2014).
Characterization of a salt-tolerant bacterium Bacillus sp.
from a membrane bioreactor for saline wastewater treatment.
J. Environ. Sci., 26: 1369-1374 (6 pages).
AUTHOR (S) BIOSKETCHES
Xie, Q., Ph.D., Professor, Center of Mining, Metallurgy and Environment, Guilin University of Technology, Guilin 541004, China. Email:
xqinglin@hotmail.com
Bai, S., Ph.D., Associate Professor, Center of Mining, Metallurgy and Environment, Guilin University of Technology, Guilin 541004, China.
Email: shaoyuanbai@126.com
Li, Y., Ph.D., Professor, Center of Mining, Metallurgy and Environment, Guilin University of Technology, Guilin 541004, China.
Email: 331842901@qq.com
Liu, L., Ph.D., Professor, Hezhou University, Hezhou 542800, China. Email: 1315099645@qq.com
Wang, S., M.D., Center of Mining, Metallurgy and Environment, Guilin University of Technology, Guilin 541004, China.
Email: 410178957@qq.com
Xi, J., MSc. Student, State Environmental Protection Key Laboratory of Microorganism Application and Risk Control, Tsinghua University,
Beijing 100084, China. Email: 56362159@qq.com
DOI: 10.7508/gjesm.2016.01.008
URL: http://gjesm.net/article_14865_1931.html
How to cite this article:
Xie, Q.; Bai, Y.; Li, Y.; Liu, L.; Wang, S.; Xi, J., (2016). Seasonal variations of microbial community in a full
scale oil field produced water treatment plant. Global J. Environ. Sci. Manage. 2 (1): 69-78.