This document provides an introduction and table of contents for a book on advanced laboratory techniques in avian medicine. The introduction gives an overview of traditional diagnostic methods and emerging molecular biological techniques. The table of contents outlines two main sections - traditional diagnostic methods, and molecular biological techniques - covering topics like isolation and identification of microorganisms, serological procedures, and nucleic acid and protein methods.

1. ADVANCED LABORATORY TECHNIQUES
in
AVIAN MEDICINE
Dr. Joseph J. Giambrone
Professor
and
Teresa Dormitorio
Research Associate III
201 Department of Poultry Science
260 Lem Morrison Drive
Alabama Agricultural Experiment Station
Auburn University, AL 36849-5416
Revised 7/13/2013

2. 2
Dr. Joseph Giambrone
Uhttp://www.auburn.edu/~giambjjU/
email: giambjj@auburn.edu
Teresa Dormitorio
Email: tdormito@acesag.auburn.edu

3. Preface
The purpose of this book is to provide the diagnostic laboratory, which is already
experienced and equipped for diagnosis of avian diseases, more advanced and
sophisticated techniques for disease diagnosis. The book is divided into two sections.
The first section gives credit to the time honored traditional methods. The second
provides an introduction to newly developed techniques in molecular biology.
Diagnostic methods will be covered for infectious organisms only, which include
bacteria, mycoplasma, fungi and viruses. For the molecular diagnosis of DNA containing
microorganisms, the Mycoplasma species will be used. The very common avian viruses,
infectious bursal disease and avian reoviruses, are used as an example of RNA containing
microorganisms. Only the most commonly found organisms in each group will be
covered, but the techniques are similar for less important species. The mention of any
product or company name does not imply endorsement.
Acknowledgments
This book and CD depended upon many people without whom it could not have
been written. Sincere thanks go out to former graduate student, Wayne Duck, who
suggested a need for this book and thereby helped in the preparation of some of the initial
materials. We would also like to thank Loraine M. Hyde from Poultry Science
Department for her help in typing, checking, and typesetting this manuscript. Thanks to
the Film Lab of AU for there help in scanning the photos and organizing the Book and to
Kejun Guo for his help in editing and transfer of the document from MS word to adobe.
3

4. 4
TABLE OF CONTENTS
UPage
Authors 2
Preface 3
Acknowledgments 3
Table of Contents 4
Introduction 6
I. TRADITIONAL DIAGNOSTIC METHODS
A. Isolation and Identification of Microorganisms 7
1) Bacteria
a) Salmonella 10
b) Escherichia coli 13
c) Pasteurella multocida 15
d) Staphylococcus aureus 17
e) Mycoplasma 19
2) Fungi
a) Aspergillus 21
3) Viruses 23
a) Cultivation of viruses in chicken embryos 29
Routes of inoculation and collection 30
of specimens for avian influenza
b) Propagation in chicken tissues 39
c) Propagation in cell culture 40
Chicken kidney cells 42
Chicken embryo fibroblasts 43
Chicken embryo liver cells 45
Tracheal rings 46
Cell lines and Secondary cells 47
d) Application of cell culture techniques 49
in virology
e) Virus Identification 50
B. Serological procedures 64
1) Immunodiffusion 71
2) Agglutination—Salmonella 73
3) Hemagglutination Inhibition—ND, MG, IBV 74
4) Immunofluorescence 78
5) Virus Neutralization—IBV, AE, IBDV 84
6) Enzyme Linked Immunoabsorbent Assay 91

5. 5
C. Immunosuppression
1) Introduction 100
2) Definition 100
3) Evaluation 101
a) Antibody 102
b) CMI 102
4) Causes 102
5) Prevention 102
II. MOLECULAR BIOLOGICAL TECHNIQUES 104
A. Nucleic Acids 105
1) Propagation, purification and quantification 112
of IBDV RNA
2) Rapid IBDV RNA isolation procedure 130
3) Restriction fragment length polymorphism 134
a) Mycoplasma gallisepticum 137
b) Silver stain 141
4) Hybridization 142
a) Radioactive Probes 147
b) Non-radioactive Probes 149
c) Dot and Slot Blot 161
d) Southern Blot 166
e) Northern Blot 173
f) In situ Hybridization 183
g) Tissue Print Hybridization 184
h) In situ PCR 187
i) Nested PCR 189
5) Polymerase Chain Reaction 194
a) Restriction fragment length polymorphism 205
b) Real Time PCR for avian influenza 211
c)AIV MolecularTechniques 223
D ILTV detection 261
e) Loop Mediated Lamp 275
e) Taqman for reoviruses 294
f) Syber Green PCR 311
g) Sequencing 324
6) Microarray Assay 338
B. Proteins 339
1) Electrophoretic Separation 342
2) Dot and Western Immunoblots 345
3) Monoclonal antibodies—productionand uses 357
a) Antigen capture ELISA 365
b) Immunoperoxidase test 370
Appendix
1. Selected list of suppliers 373
2. Major sites for molecular biology on the world wide web 378
3. Procedures for Preparation of Buffers and Reagents 378
4. Commonly Used Abbreviations 384

6. 6
Glossary 283

7. 7
INTRODUCTION
Much of the rapid development in the poultry industry worldwide has been due to
improvements in genetics, nutrition and disease control. Knowledge of the cause of diseases has
expanded dramatically over the years. Advances in the diagnosis, treatment and vaccination have
contributed to improved disease control.
It is extremely important to identify a pathogen before the disease can be adequately controlled.
However, the isolation of an organism from a lesion does not always mean that it is directly
responsible for the disease. The agent may be a secondary invader or become a primary pathogen after
the bird’s immune system was suppressed. This immunodepression could be brought about by a
variety of agents and environmental conditions. In addition, birds may be submitted late in the course
of the disease and only secondary invaders such as bacteria are readily isolated. Affected birds should
be submitted as early as possible to increase the chance of isolation of primary invaders, especially
viruses.
Diseases may be caused by one or more agents. Therefore, it is important to undergo a routine
battery of tests; otherwise you may miss one or more affecting agents. It may be also necessary to
collect serum from live, diseased birds to check for abnormally high or low levels of antibody against a
variety of common infectious organisms.
Submission of at least 10 birds from a disease flock is usually adequate. A combination of
normal, sick and recently dead birds and/or tissues, blood specimens, samples of feed, water and litter,
plus a thorough history of the flock should be submitted. The time honored traditional methods of
isolation and identification of disease pathogens and/or the antibodies they induce is still the backbone
of the diagnostic laboratory. However, more sophisticated techniques using molecular biological
techniques such as monoclonal antibodies, nucleic acid probes, polymerase chain reaction, and
restriction fragment length polymorphism are now being used routinely in diagnostic laboratories. It is
the subject of these advanced techniques, which sets this book apart from its predecessors.
In the chapters on molecular biology, introductory material will explain the basis of each
technique after which specific methodology will follow which gives details in step by step fashion.
The specific techniques will be centered on one DNA containing organism, e.g. mycoplasma or RNA
microbe, e.g. infectious bursal disease virus. These pathogens are featured since they are extremely
important pathogens of poultry and because much more is known about their genetic material.
However, at the molecular level, genetic manipulations are basically the same and techniques
described herein can be adapted for most avian pathogens with little modifications.
UTABLE of CONTENTS

8. 8
I. TRADITIONAL DIAGNOSTIC METHODS
A. Isolation and Identification of Microorganisms
Bacteria
Bacteria, along with blue-green algae, are prokaryotic cells. That is, in contrast to eukaryotic cells, they
have no nucleus; rather the genetic material is restricted to an area of the cytoplasm called the
nucleoid. Prokaryotic cells also do not have cytoplasmic compartment such as mitochondria and
lysosomes that are found in eukaryotes. However, a structure that is found in prokaryotes but not in
eukaryotic animal cells is the cell wall which allows bacteria to resist osmotic stress. These cell walls
differ in complexity and bacteria are usually divided into two major groups, the gram-positive and
gram-negative organisms, which reflect their cell wall structure. The possession of this cell wall,
which is not a constituent of animal cells, gives rise to the different antibiotic sensitivities of
prokaryotic and eukaryotic cells. Prokaryotes and eukaryotes also differ in some important metabolic
pathways, particularly in their energy metabolism and many bacterial species can adopt an anaerobic
existence.
In this section, we shall look at the structure of typical bacterial cells and the ways in which they liberate
energy from complex organic molecules. Various aspects of bacterial structure and metabolism are the
basis of bacterial identification and taxonomy. Bacteria are constantly accumulating mutational changes
and their environment imposes a strong selective pressure on them. Thus, they constantly and rapidly
evolve. In addition, they exchange genetic information, usually between members of the same species
but occasionally between members of different species. We shall see how this occurs.
Bacteria have parasites, the viruses called bacteriophages which are obligate intracellular parasites that
multiply inside bacteria by making use of some or all of the host biosynthetic machinery. Eventually,
these lyse the infected bacterial cell liberating new infection phage particles. The interrelationships of
bacteria and the pages will be investigated.
Taxonomy
The basis of bacterial identification is rooted in taxonomy. Taxonomy is concerned with
cataloging bacterial species and nowadays generally uses molecular biology (genetic) approaches. It is
now recognized that many of the classical (physiology-based) schemes for differentiation of bacteria
provide little insight into their genetic relationships and in some instances are scientifically incorrect.
New information has resulted in renaming of certain bacterial species and in some instances has
required totally re-organizing relationships within and between many bacterial families. Genetic
methods provide much more precise identification of bacteria but are more difficult to perform than
physiology-based methods.
Family: a group of related genera.
Genus: a group of related species.
Species: a group of related strains.
Type: sets of strain within a species (e.g. biotypes, serotypes).
Strain: one line or a single isolate of a particular species.
The most commonly used term is the species name (e.g. Streptococcus pyogenes or

9. 9
Streptococcus pyogenes abbreviation S. pyogenes). There is always two parts to the species
name one defining the genus in this case "Streptococcus" and the other the species (in this case
"pyogenes"). The genus name is always capitalized but the species name is not. Both species and genus
are underlined or in italics.
B. The Diagnostic Laboratory
The diagnostic laboratory uses taxonomic principles to identify bacterial species from birds.
When birds are suspected of having a bacterial infection, it is usual to isolate visible colonies of the
organism in pure culture (on agar plates) and then speciate the organism. Physiological methods for
speciation of bacteria (based on morphological and metabolic characteristics) are simple to perform,
reliable and easy to learn and are the backbone of hospital clinical microbiology laboratory. More
advanced reference laboratories, or laboratories based in larger medical schools additionally use
genetic testing.
Isolation by culture and identification of bacteria from patients, aids treatment since infectious
diseases caused by different bacteria has a variety of clinical courses and consequences. Susceptibility
testing of isolates (i.e. establishing the minimal inhibitory concentration [MIC]) can help in selection of
antibiotics for therapy. Recognizing that certain species (or strains) are being isolated atypically may
suggest that an outbreak has occurred e.g. from contaminated hospital supplies or poor aseptic
technique on the part of certain personnel.
Steps in diagnostic isolation and identification of bacteria
Step 1. Samples of body fluids (e.g. blood, urine, cerebrospinal fluid) are streaked on culture plates and
isolated colonies of bacteria (which are visible to the naked eye) appear after incubation for one - several
days. It is not uncommon for cultures to contain more than one bacterial species (mixed cultures). If
they are not separated from one another, subsequent tests can’t be readily interpreted. Each colony
consists of millions of bacterial cells. Observation of these colonies for size, texture, color, and (if
grown on blood agar) hemolysis reactions, is highly important as a first step in bacterial identification.
Whether the organism requires oxygen for growth is another important differentiating characteristic.
Step 2. Colonies are Gram stained and individual bacterial cells observed under the microscope.
Step 3. The bacteria are speciated using these isolated colonies. This often requires an additional 24 hr
of growth.
Step 4. Antibiotic susceptibility testing is performed (optional)
THE GRAM STAIN, a colony is dried on a slide and treated as follows: 3
Step 1. Staining with crystal violet.
Step 2. Fixation with iodine stabilizes crystal violet staining. All bacteria remain purple or blue.
Step 3. Extraction with alcohol or other solvent. Decolorizes some bacteria (Gram negative) and not
others (Gram positive).
Step 4. Counterstaining with safranin. Gram positive bacteria are already stained with crystal violet
and remain purple. Gram negative bacteria are stained pink.
Under the microscope the appearance of bacteria are observed including: Are they Gram
positive or negative? What is the morphology (rod, coccus, spiral, pleomorphic [variable form] etc)?
Do cells occur singly or in chains, pairs etc? How large are the cells? There are other less commonly
employed stains available (e.g. for spores and capsules).
Another similar colony from the primary isolation plate is then examined for biochemical
properties (e.g. will it ferment a sugar such as lactose). In some instances the bacteria are identified

10. 10
(e.g. by aggregation) with commercially available antibodies recognizing defined surface antigens. As
noted above genetic tests are now widely used.
Genetic characterization of bacteria
Whole genomes of a representative strain of many of the major human pathogens have been
sequenced, and this is referred to as genomics. This huge data-base of sequences is highly useful in
helping design diagnostic tests. However, rarely are more than one or two representative genomes
sequenced. There is a lot of variability in sequences among individual strains. Thus for practical
reasons, genetic comparisons must involve multiple strains. Certain genes have been selected to define
common traits among species and then this information is used to develop diagnostic tests.
1. Sequencing of 16S ribosomal RNA molecules (16S rRNA) has become the "gold standard" in
bacterial taxonomy. The molecule is approximately sixteen hundred nucleotides in length. The
sequence of 16S rRNA differentiates bacterial species.
2. Once the sequence is known, specific genes (e.g. 16S rRNA) are detected by amplification using the
polymerase chain reaction, PCR. The amplified product is then detected most simply by fluorescence
(“real time” PCR) or by gel electrophoresis (the molecular weight of the product).
3. DNA-DNA homology (or how well two strands of DNA from different bacteria bind [hybridize]
together) is employed to compare the genetic relatedness of bacterial strains/species. If the DNA from
two bacterial strains display a high degree of homology (i.e. they bind well) the strains are considered
to be members of the same species.
4. The guanine (G)+ cytosine (C) content usually expressed as a percentage (% GC) is now only of
historical value.
Chemical analysis
Commonly fatty acid profiling is used. The chain length of structural fatty acids present in the
membranes of bacteria is determined. Protein profiling is rapidly expanding. Characterization of
secreted metabolic products (e.g. volatile alcohols and short chain fatty acids) is also employed.
Rapid diagnosis without prior culture
Certain pathogens either can’t be isolated in the laboratory or grow extremely poorly.
Successful isolation can be slow and in some instances currently impossible. Direct detection of
bacteria without culture is possible in some cases; some examples are given below.
Bacterial DNA sequences can be amplified directly from human body fluids using PCR. For
example, great success has been achieved in rapid diagnosis of tuberculosis.
A simple approach to rapid diagnosis (as an example of antigen detection) is used in many
doctor's offices for the group A streptococcus. The patient's throat is swabbed and streptococcal
antigen extracted directly from the swab (without prior bacteriological culture). The bacterial antigen is
detected by aggregation (agglutination) of antibody coated latex beads.
Direct microscopic observation of certain clinical samples for the presence of bacteria can be
helpful (e.g. detection of M. tuberculosis in sputum). However, sensitivity is poor and many false
negatives occur.
Serologic identification of an antibody response (in patient's serum) to the infecting agent can
only be successful several weeks after an infection has occurred. This is commonly used in

11. 11
SALMONELLA
Introduction
Avian salmonellosis is divisible into three diseases: pullorum disease (S. pullorum), fowl
typhoid (S. gallinarum), and paratyphoid. Pullorum and typhoid are not often seen in commercial
poultry companies, where serologic testing and eradication of positive breeder flocks is practiced, but
are common in small backyard flocks. Paratyphoid is common in commercial poultry operations
worldwide. Two common paratyphoid organisms are S. enteritidis and S. typhimurium. S. enteritis
occurs in commercial layer (2% of US) and S. typhimurium in poultry flocks. They are common
causes of gastroenteritis in humans through contaminated poultry products. In the US, S. enteritidis is
not a pathogen in poultry, but is an important cause of disease in some parts of Europe.
Salmonella are horizontally and vertically transmitted. Pullorum and paratyphoid diseases
primarily affect young poultry, whereas typhoid can occur at any age. Lesions include fibrinopurulent
perihepatitis, pericarditis, and necrosis of the intestinal and reproductive tracts.
Sample Collection
Liver, spleen, heart, gall bladder, blood, ovary, yolk sac, joints, eye and brain can be used for
isolation on non-selective media. The gut is commonly colonized by salmonellae, with the ceca most
often infected. Tissues may be ground and inoculated onto agar or broth. Gut tissues generally require
selective media to inhibit common nonpathogenic contaminants. The yolk sac of day-old chicks is a
good source for isolation. Feed, water and litter may also be taken from poultry houses. Sterile cotton
swabs can be used for isolation. Cotton swabs can be dragged along litter to check for environmental
contamination or be used to check breeder nests, laying cages or hatchery machines. Swabs can be
stored under refrigeration in a sterile holding media such as 200 gr of Bacto Skim Milk in 1 litter of
distilled water.
Culture Media
None-Selective media include beef extract and beef infusion. Selective media include
tetrathionate broths, selenite enrichment broths, MacConkey's agar or eosin methylene blue agar
(EMG). Selective plating media include brilliant green (BG) agar supplemented with novobiocin
(BGN) and XLD agar supplemented with novobiocin (XLDN). Salmonella colonies on BG and BGN
agar are transparent pink to deep fuchsia, surrounded by a reddish medium. The HB
2BS positive colonies
on XLD or XLDN agars are jet black. Pink colonies/to 2mm in diameter are present on MacConkey's
agar and dark colonies 1mm in diameter on EMB. A Gram stain reveals negative rods.
Rapid Salmonella Detection Techniques
A variety of rapid detection systems include enzyme immunoassay antigen capture assays,
DNA probes, and immunofluorescence. These techniques will be discussed later in the book.

12. 12
Basic Identification Media
A combination of triple-sugar-iron (TSI) and lysine-iron (LI) agars are sufficient for presumptive
identification of salmonella. On TSI agar, salmonellae produce an alkaline (red) slant and acid (yellow)
butt, with gas bubbles in the agar and a blackening due to HB
2BS production. Salmonellae will show
lysine decarboxylation, with a deeper purple (alkaline) slant and alkaline or neutral butt with a slight
blackening due to HB
2BS production. Before doing serological screening procedures, the culture should be
further evaluated using additional identification media (Table 1.0). Commercial kits employing more
extensive tests include API—20E (Analy Lab Products, Plainview, NY), or
Enterotube I (Roche Diagnostics, Montclair, NJ) are also available.
Table 1.0. Reactions of Salmonella Cultures in Media
Media S. pullorum S. gallinarun Paratyphoid
Dextrose A A AG
Lactose - - -
Sucrose - - -
Mannitol A A AG
Maltose - A AG
Dulcitol - A AG
Malonate broth - - -
Urea broth - - -
Motility media - - +
A = Acid, G = gas produced
Figure 1.0. Slide agglutination

13. 13
Serologic Identification
These methods including slide (figure 1.0) and plate agglutination will be discussed in a later
chapter.
References
Mallison, E.T. and G.H. Snoeyenbos, 1989. "Salmonellosis." In A Laboratory Manual for the
Isolation and Identification of Avian Pathogens. Kendall/Hunt Publishing, Co. Dubuque,
Iowa. pp. 3-11.
Table of Contents

14. 14
ESCHERICHIA
Introduction
Escherichia coli cause a common systemic infection in poultry known as colibacillosis.
Colibacillosis occurs as an acute septicemia, or chronic airsacculitis, polyserositis, or infectious
process in young poultry. Coligranuloma is a chronic infection resulting in lowered egg production,
fertility and hatchability in adult birds.
Clinical disease
Clinical signs are not specific and vary with bird age, duration of infection and concurrent
disease conditions. In septicaemia in young birds, signs include: anorexia, inactivity and somnolence.
Lesions may be seen as swollen, dark-colored liver and spleen and Ascities. Chronically affected birds
may have fibrinopurulent airsacculitis, pericarditis, perihepatitis, dermatitis and lymphoid depletion of
the bursa and thymus. Arthritis, osteomyelitis, salpingitis, and granulomatous enteritis, hepatitis and
pneumonia may occur in older birds.
Sample Collection
Heart, liver, lungs, spleen, bone marrow, joints and air sacs are all good specimens for isolation
using a sterile swab or needle or ground tissue. Cultures may be stored in E. coli broth upon
refrigeration.
Culture media
E. coli, a gram – rod (figure 1.2), grows well in meat media, Tryptose blood, blood agar, SI
medium, Lysine iron agar (LIA), MacConkey's agar (figure 1.1). Differential biochemical media can
be used such as triple iron agar slants or identification kits (API-2OE or Enterotube I).
On blue agar E. coli will show white glistening, raised colonies 1-to-3 mm diameter and under
the microscope as gram-negative rods. On MacConkey's agar pink, 1-2 mm diameter dry colonies
with dimple will be evident. On TSI slant, E. coli will produce a yellow slant and

15. 15
Figure 1.1. E. coli
butt with gas but no HB
2BS (no black color). On SMI medium the indole reaction is positive, HB
2BS
negative and motility +/-. In LIA the slant will be alkaline and the butt acid with no HB
2BS production.
Figure 1.2. Gram negative rods
References
Arp, L.H., 1989. "Colibacillosis." In a Laboratory Manual for the Isolation and Identification of
Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque, Iowa. pp. 12-13.
UTable of Contents

16. 16
PASTEURELLA
Introduction
The disease caused by the infection with Pasteurella multocida, a bipolar encapsulated rod
(figure 1.3), in poultry is called fowl cholera. It is common world wide and affects all species of birds
including turkeys, chickens, quail and wild water fowl.
Clinical disease
The disease occurs in birds of any age, but is more common in semi mature to mature birds. It
can occur as an acute septicemic disease with high morbidity and mortality, or chronic with low level
of performance in adult flocks. Signs include depression, diarrhea, respiratory signs, cyanosis,
lameness and/or acute death. Lesions include hyperemia, hemorrhages, swollen liver, focal necrotic
areas in the liver and spleen and increased pericardial fluids. Swollen joints and exudate in the wattles,
comb and turbinates may be seen in chronic cases.
Sample Collection
The organism may be isolated from the liver, spleen, gall bladder, bone marrow, heart and
affected joints with a sterile needle or swab. The organism is fairly stable on short term storage.
Pasteurella
Figure 1.3. Bipolar encapsulated rods

17. 17
Preferred Culture Media
Dextrose Starch agar (DSA), blood agar or trypticase soy agar are recommended for primary
isolation. On DSA, 24 hour colonies are circular, 1-3 mm in diameter, smooth, translucent, and
glistening. Colonies on blood agar are similar to those on DSA, but appear grayish and translucent. P.
multocida cells are typically rods of 0.2-0.4 x 0.6-2.5 um occurring singular in pairs of short claims.
Cells in tissues or from agar show bipolar staining with Giemsa, Wayson's or Wright's stains.
Capsules can be demonstrated by mixing a loop full of India Ink on a slide and the colony and
examining it at high magnification.
P. multocida can be further identified with biochemical tests. Fructose, galactose, glucose, and
sucrose are fermented without gas production. Indole and oxidase are produced and there is no
hemolysis of blood or growth on MacConkey's agar.
References
Rhoades, K.R., R.B. Rimler and T.S. Sandhu, 1989. "Pasteurellosis and Pseudotuberculosis." In a
Laboratory Manual for the Isolation and Identification of Avian Pathogens. Kendall/Hunt
Publishing, Co., Dubuque, Iowa, pp. 14-21.
UTable of ContentsU

18. 18
STAPHYLOCOCCUS
Introduction
Staphylococcus aureus (Figure 1.4) is frequently the cause of arthritis, synovitis, and localized
abscesses in joints, foot pads, skin, and over the breast muscle. The organism is ubiquitous in poultry
houses and is a common primary and secondary invader.
Clinical Disease
Staphylococcosis appears to be a classical opportunistic infection. Clinical disease is more
frequent in birds subjected to poor husbandry conditions such as overcrowding, sharp objects in the
house, poor ventilation, wet damp litter and birds that are immunosuppressed. The organism typically
occurs following recent viral or mycoplasma infections in the joints. The infection often occurs locally
through a wound and then may spread and become septicemic. The liver, spleen, and kidneys, may
become swollen. S. aureus may begin as a swelling in the breast area, foot pad or gangrenous dermatitis
or as yolk sac infections from a hatchery or breeder flock. Localized lesions may contain a white or
yellow cheesy exudate. Septicemic lesions may have necrotic and/or hemorrhage foci and cause
swelling and discoloration of the tissues.
Sample Collection
Specimens for culture include blood or exudate from lesions. They can be collected from
sterile swabs, loops or by needles and syringes. No special precaution is needed for handling,
transportation or storage of materials.
Culture media
Staphylococci grow readily on ordinary media. Blood agar or thioglycollate broth supports the
growth of the organism. Selective media include Manitol-salt agar or the similar staphylococcus 110
medium.

19. 19
Figure 1.4. Colonies on blood agar
Agent Identification
On agar cultures, staphylococci produce 1 to 3 mm diameter, circular, opaque, smooth, raised
colonies in 18 to 24 hours. S. aureus are hemolytic on blood agars (figure 1.5). On manitol-salt agar,
S. aureus colonies are surrounded by a yellow halo. Colonies are examined microscopically to confirm
that they contain gram-positive cocci. A positive coagulase test will confirm they are pathogenic
staphylococci. Commercially available desiccated rabbit plasma containing either citrate or EDTA is
used for the coagulase test. A commercial coagulase test that uses microtubes (STAPHase, Analylab
Products, Plainview, NY) is also available.
Figure 1.5. Isolation of organisms from tissues
References
Jensen, M.M. and J.K. Skeeles, 1989. "Staphylococcosis." In a Laboratory manual for the Isolation
and Identification of Avian Pathogens. Kendall/Hunt Publishing Co., Dubuque, Iowa, pp. 43-
44.
UTable of ContentsU

20. 20
MYCOPLASMA
Introduction
Mycoplasma are tiny prokaryotic organisms characterized by their lack of a cell wall (figure
1.6). There are numerous species of mycoplasma that infect poultry, however, the most common and
pathogenic are M. gallisepticum and M. synoviae. They are found in commercial breeder and layer
flocks world wide and may cause drops in egg production, fertility and hatchability as well as
respiratory and skeletal system disease. They may be transmitted in flocks both vertically and
horizontally.
Clinical disease
M. gallisepticum (MG) is a cause of respiratory disease and egg production drops in chickens
and turkeys. Severe airsacculitis, swollen sinuses, coughing, rales, depressed weight gain, poor feed
conversion, mortality and increased condemnation in the processing plant. M. synoviae causes lesions
of synovitis and respiratory disease in chickens and turkeys.
Sample Collection
Cultures may be taken from the trachea, choanal cleft, affected joints, sinuses or air sacs, with
sterile swabs. Tissues may be shipped frozen for later isolation. Isolated culture may be shipped in
broth medium by overnight carrier.
Culture media
Mycoplasmae are fastidious organisms that require a protein based medium enriched with 10—
15% serum. Supplementation with yeast and/or glucose is helpful. M. synoviae requires nicotinamide
adenine dinucleotide (NAD), cysteine hydrochloride is added as a reducing agent for the NAD. A
commonly used media is Frey's (Table 1.1).
Figure 1.6. Mycoplasma colonies

21. 21
P
P
Table 1.1. Frey's Media Formulation
Constant Amount
Mycoplasma broth base (BBL, Cockeysville, MD) 22.5 g
Glucose 3 gr
Swine Serum 120 ml
Cysteine hydrochloride 0.1 gr
NAD 0.1 gr
Phenol red 2.5 ml
Thallium acetate (10%) 2.5 to 5 ml
Penicillin G Potassium 106
units
Distilled HB
2BO 1,000 ml
Adjust pH to 7.8 with 20% NaOH and filter sterilize
Broth cultures incubated at 37 aerobically are generally more sensitive than agar. Cultures
are incubated until the phenol red indicator changes to orange, but not yellow. This may take
anywhere from 2 to 5 days. Agar plates are examined for colonies under low magnification under
regular light or with a dissecting microscope. Colonies are usually evident after 3 to 5 days.
Agent identification
Tiny, smooth colonies 0.1 to 1 mm in diameter with dense, elevated centers are suggestive of
mycoplasma (Figure 1.6). Mycoplasma speciation is by serological methods using polyclonal or
monoclonal antibody. Serological tests include immunodiffusion, agglutination, enzyme linked
immunosorbent assay (ELISA) and immunofluorescence. The problem with polyclonal serum is that
there can be cross reactions between MG and MS. Also, the serum may contain antibodies against the
serum present in the medium and give false positives. Breeders given inactivated vaccines, especially
vaccines against Pasteurella, may have false positive serologic reactions up to 6 weeks post
vaccination. Therefore, the use of monoclonal antibodies, to be discussed later in this book, is most
desirable.
References
Kleven, S.H. and H.W. Yoder, 1989. "Mycoplasmosis." In a Laboratory Manual for the Isolation and
Identification of Avian Pathogens, Kendall/Hunt Publishing, Co., Dubuque, Iowa, pp. 57-62.
UTable of ContentsU

22. 22
Mycology (Fungi)
Fungi are eukaryotic organisms that do not contain chlorophyll, but have cell walls, filamentous
structures, and produce spores. These organisms grow as saprophytes and decompose dead organic
matter. There are between 100,000 to 200,000 species depending on how they are classified. About
300 species are presently known to be pathogenic for man.
There are four types of mycotic diseases:
1. Hypersensitivity - an allergic reaction to molds and spores.
2. Mycotoxicoses - poisoning of man and animals by feeds and food products contaminated by fungi
which produce toxins from the grain substrate.
3. Mycetismus- the ingestion of preformed toxin (mushroom poisoning).
4. Infection
ASPERGILLUS
Introduction
The most common fungal disease of poultry is Aspergillosis. It is primarily a respiratory
disease, but the organism can spread to the brain and eye causing central nervous signs and blindness.
The organism is common in warm moist environments, which include hatcheries and poultry houses.
Young birds are most susceptible, since their immune system and respiratory tract cilia, responsible for
trapping foreign objects, are less developed at that age.
Clinical Disease
Aspergillus fumigatus and A. flavus are common causes of disease in commercial young
poultry. The pulmonary system is the initial point of entry, but the agent may spread to the
gastrointestinal tract, eye or central nervous system. There are two forms of the disease. The acute
form occurs as brooder pneumonia in young animals causing respiratory disease and death. The
chronic form occurs in older birds and may result in respiratory signs or torticollis and cloudy eyes.
Small, white cheesy nodules may occur in acute disease in the lungs, airsacs or intestinal tract. Plaques
(yellow or gray) may occur in chronic cases in the brain or respiratory tract.
Sample Collection
Lesions are the preferred source for culture using sterile swabs or inoculation loops. The
samples may be shipped or stored for a short time at refrigeration temperatures.

23. 23
Culture Media
Initial isolation may be accomplished on blood agar, or Sabouraud's dextrose agar. Specimens
can be smeared on plates or minced in a grinder with sterile saline. The plates can be inoculated at
37 C for 1 to 3 days. Chloramphenicol (0.5 g/liter) can be added to the media to inhibit bacteria
growth.
Figure 2.1. Fungal culture
Agent Identification
Small greenish blue colonies with fluffy down (Figure 2.1) can be transferred to Czapek's solution agar
(Difco Lab, Detroit, MI) for a definitive diagnosis. Scrapings of a colony or from a lesion can be placed
on a microscope slide and stained with 20% KOH. Branching septate hyphae 4 — 6 micron in diameter
will be evident. The presence of the conidial head is needed to differentiate the various species of
Aspergillus. Lactophenol, a semi-permanent mounting medium, contains 20 gr of phenol,
40 ml of glycerin, 20 ml of lactic acid and 20 ml of distilled HB
2BO. For staining hyphae and
examination of conidia, 0.05 g of cotton blue can be added to make lactophenol cotton blue. A piece
of colony can be teased apart with a needle, stained, marked and mounted with a cover slip. Species
identification may be achieved on the basis of morphological criteria upon microscopic examination.
References
Richard, J.L. and E.S. Beneke, 1989. "Mycosis and Mycotoxicosis." In a Laboratory Manual for the
Isolation and identification of Avian Pathogens. Kendall/Hunt Publishing Co., Dubuque, Iowa,
pp. 70-76.
UTable of Contents

24. 24
VIRUSES
Introduction
Viruses are important subcellular pathogens of poultry. Viruses are tiny obligate intracellular
organisms. They can only be seen with the electron microscope, and since they don't have cellular
organelles or metabolic machinery, they can only be propagated in a living host and are not affected by
common antibiotics. Important viruses of poultry include: infectious bronchitis, Newcastle disease,
influenza, laryngotracheitis, and pneumo viruses which cause respiratory diseases; Marek's disease and
lymphoid leukosis viruses, which cause lymphoid tumors, and immunosuppression; adenoviruses,
chicken anemia virus, reoviruses, and infectious bursal disease viruses, which cause morbidity,
mortality and/or immunosuppression; and fowl pox virus which causes skin and oral lesions.
Knowledge of viral replication and genetics is necessary for understanding the interaction
between the virus and the host cell. The interaction at the cellular level and progression of a particular
viral infection determines disease pathogenesis and clinical manifestations. The host immune response
to the presence of viruses will be examined later.
Interaction Between Viruses and Host Cells
The interaction between viruses and their host cells is intimately tied to the replication cycle of
the virus. Moreover, the interaction of virus with cellular components and structures during the
replication process influences how viruses cause disease. Overall, there are four possible primary
effects of viral infection on a host cell. Most infections cause no apparent cellular pathology or
morphological alteration; however, replication may cause cytopathology (cell rounding, detachment,
syncytium formation, etc.), malignant transformation, or cell lysis (death).
Cell Death
Cell death during viral replication can be caused by a variety of factors. The most likely factor
is the inhibition of basal cellular synthesis of biomolecules, such as proteins. During the replication
cycle, the virus induces the cellular machinery to manufacture largely viral products rather than those
the cell would normally make. As a result, the predominant products synthesized by the cell are viral
and the cellular products necessary for the survival of the cell are not present or present in too low a
quantity to maintain its viability. In addition to the lack of essential cellular products, this event results
in accumulation of viral products (RNA, DNA, proteins) in excess, which can be toxic for the cells. In
the release phase of the replication cycle of some viruses, apoptosis of the host cell is stimulated. In
other instances, inhibition of the synthesis of cellular macromolecules causes damage to lysosomal
membranes and subsequent release of hydrolytic enzymes resulting in cell death.
Cellular Effects
Cytopathic effect (CPE) denotes all morphologic changes in cells resulting from virus infection.
Infected cells sometimes have an altered cell membrane; as a result the infected cell membrane is
capable of fusing with its neighbor cell. It is thought this altered membrane is the result of the insertion

25. 25
of viral proteins during the replication cycle. The result of fusion is the generation of a multinucleate
cell or syncythia. The formation of syncythia is characteristic for several enveloped viruses, such as
herpesviruses and paramyxoviruses. The altered cell membrane also is altered with regard to its
permeability, allowing influxes of various ions, toxins, antibiotics, etc. These multinucleate cells are
large and are sometimes called "multinucleate giant cells".
Another aspect of CPE is the disruption of the cytoskeleton, leading to a "rounded up"
appearance of the infected cell. The cell in this case will either lyse or form syncythia. CPE occurrence
in clinical specimens can indicate viral infection and CPE is used as the basis for the plaque assay used
in viral enumeration. Infection of cells with some viruses (e.g., poxviruses and rabies virus) is
characterized by the formation of cytoplasmic inclusion bodies. Inclusion bodies are discrete areas
containing viral proteins or viral particles. They often have a characteristic location and appearance
within an infected cell, depending upon the virus.
Malignant Transformation
In this process, viral infection results in host cells that are characterized by altered morphology,
growth control, cellular properties, and/or biochemical properties. Malignant transformation and
resulting neoplasia may occur when the viral genome (or a portion) is incorporated into the host genome
or when viral products are themselves oncogenic. Viruses causing malignant transformation are referred
to as tumor viruses. Viruses from different families have been shown to possess the ability to transform
host cells. The tumor viruses have no common property (size, shape, chemical composition) other than
the development of malignancy in the host cell. Malignant transformation is often characterized by
altered cellular morphology. This includes the loss of their characteristic shape and assumption of a
rounded up, refractile appearance as described for CPE. This is the result of the disaggregation of actin
filaments and decreased surface adhesion.
Altered cell growth, the hallmark for malignant transformation, is exhibited in viral cells that
have lost contact inhibition of growth or movement, have a reduced requirement for serum growth
factors, and/or no longer respond to cell cycle signals associated with growth and maturation of the cell
(immortality). Some of the altered cellular properties exhibited by malignantly transformed cells
include continual induction of DNA synthesis, chromosomal changes, appearance of new or embryonic
surface antigens, and increased agglutination by lectins.
Commonly altered biochemical properties of malignantly transformed cells include reduced
levels of cyclic AMP. Cyclic AMP is a chemical signal associated with the cell cycle and by keeping the
levels reduced the cell continually divides. Also involved is the increased secretion of plasminogen
activator (clot formation), fermentation for the production of lactic acid (known as the Warburg effect),
loss of fibronectin, and changes in the sugar components of glycoproteins and glycolipids.
Oncogenesis
Although cause-and-effect has been difficult to obtain, a number of DNA and RNA viruses
have been associated with neoplastic transformation. Viruses implicated in oncogenesis either carry a
copy of a gene associated with cell growth and proliferation or alter expression of the host cell’s copy

26. 26
of the gene. Effected genes include those that stimulate and those that inhibit cell growth. Viral genes
that transform infected cells are known as oncogenes (v-onc genes), which stimulate uncontrolled cell
growth and proliferation. The discovery of oncogenes led to the finding that all cells contain analogous
genes, called proto-oncogenes (c-onc genes), which are normally quiescent in cells as they are active at
some point in development. Proto-oncogenes include cellular products such as growth factors,
transcription factors, and growth factor receptors.
DNA viruses associated with oncogenesis include the Marek’s disease virus (Herpesviridae).
This virus is typically circular episomic (independent of the host chromosome, rather than integrated)
nucleic acids. The oncogenes (v-onc) encode proteins associated with the replication cycle of the virus.
RNA viruses associated with oncogenesis include members of the family Retroviridae (e.g.,
avian leukosis virus). These viruses integrate their genomes (or a copy of the genome) into the host
chromosome; referred to as proviruses or proviral DNA. Viral integration is mediated by the terminal
ends of the genome, known as LTRs (long terminal repeats). LTRs contain promoter/enhancer regions,
in addition to sequences involved with integration of the provirus into the host genome. Retroviruses
can cause oncogeneses by encoding oncogenes themselves or by altering the expression of cellular
oncogenes or proto-oncogenes through insertion of their genomes into the host chromosome close to
these genes.
No Morphological or Functional Changes
In some instances, infection with viral production can occur with no discernable change in the
host cell. This is referred to as an endosymbiotic infection. This is probably dependent upon the
replication needs of the virus. Most likely the virus requires cellular processes to be active in order for
viral replication to take place and thus does not alter the features of the cell.
Pathogenesis of Viral Infections
Pathogenesis is defined as the origination and development of a disease. Viral infections can be
acute, chronic, latent or persistent. The first step in the disease process is exposure.
Exposure and Transmission
Exposure may occur by direct contact with an infected animal, by indirect contact with
secretions / excretions from an infected animal, or by mechanical or biological vectors. Transmission
of virus from mother to offspring (transplacental, perinatal, colostrum) is called vertical transmission.
Transmission via other than mother to offspring is horizontal transmission. Activation of latent,
nonreplicating virus can occur within an individual with no acquisition of the agent from an exogenous
source.
Portal of Entry
Viruses enter the host through the respiratory tract (aerosolized droplets), the alimentary tract
(oral-fecal contamination), the genitourinary tract (breeding, artificial insemination), the conjunctivae

27. 27
(aerosolized droplets), and through breaches of the skin (abrasions, needles, insect bites, etc.). Whether
or not infection ensues following entry depends upon the ability of the virus to encounter and initiate
infection in susceptible cells. The susceptibility of cells to a given virus depends largely on their
surface receptors, which allow for attachment and subsequent penetration of the virus.
Localized and Disseminated Infections
Following infection, the virus replicates at or near the site of viral entry (primary replication).
Some viruses remain confined to this initial site of replication and produce localized infections. An
example is the common cold and similar infections in domestic animals caused by rhinovirus. Other
viruses cause disseminated (systemic) infections by spreading to additional organs via the bloodstream,
lymphatics or nerves. The initial spread of virus to other organs by the blood stream is referred to as
primary viremia. Viremia can be either by virus free in the plasma or by virus associated with blood
cells. After multiplication in these organs, there may be a secondary viremia with spread to target
organs.
The virus is transmitted in a fecal-oral fashion. It initially replicates in the cells of the tonsils,
migrates to the intestines and mesenteric lymph nodes. From the mesenteric lymph nodes, the virus
enters the central nervous system. Once in the central nervous system, the neurological symptoms of:
ataxia, tremors, loss of coordination, stiffening of the limbs, convulsions, paralysis, and coma are
observed. The preference of a particular virus for a specific tissue or cell type is known as tropism.
Mechanisms of Viral Infections
Virus replication occurs in target organs causing cell damage. The number of cells infected
and/or the extent of damage may result in tissue/organ dysfunction and in clinical manifestation of
disease. The interval between initial infection and the appearances of clinical signs is the incubation
period. Incubation periods are short in diseases in which the virus grows rapidly at the site of entry
(e.g., influenza) and longer if infections are generalized (e.g., canine distemper). Some viruses infect
animals but cause no overt signs of illness. Such infections are termed subclinical (asymptomatic or
unapparent). There are numerous factors that may influence the outcome of viral infections. These
include preexisting immunity, genetics of the animal, age of the animal, and stress related factors such
as nutritional status, housing, etc.
The mechanisms by which viruses cause disease are complex. Disease may result from direct
effects of the virus on host cells, such as cell death, CPE, and malignant transformation. Alternatively,
disease results from indirect effects caused by the immunologic and physiologic responses of the host.
An example of indirect physiologic response is infection with rotavirus, which causes diarrhea in
young animals and humans. Diarrhea may be caused by rotavirus-infected erythrocytes that are
stimulated to produce cytokines, exciting enteric neurons, and inducing the secretion of excess fluids
and electrolytes into the large intestine. The virus spreads from the CNS to peripheral nerves within
axons. The host responds to the presence of the virus-infected neurons by inducing a cell-mediated
immune response. Macrophages, neutrophils, and specific cytotoxic T lymphocytes are activated to kill
bornavirus-infected neurons. The result is chronic inflammation in the CNS that corresponds with the
neurological signs associated with the disease.

28. 28
Two very important terms used in the discussion of microbial diseases are pathogenicity and
virulence. Pathogenicity denotes the ability of a virus or other microbial/parasitic agent to cause
disease. Virulence is the degree of pathogenicity. An avirulent virus is one lacking the capacity to
cause disease. An attenuated virus is one whose capacity to cause disease has been weakened
frequently by multiple passages in cell cultures, embryonated eggs or animals.
Virus Shedding
Virus shedding is the mechanism of excretion of the progeny virions to spread to a new host,
thus maintaining the virus in a population of hosts. Viruses are typically shed via body openings or
surfaces. For localized infections, virus is typically shed via the portal of entry. In disseminated
infections, virus may be shed by a variety of routes. Not all viruses are shed from their hosts. These
include viruses that replicate in sites such as the nervous system, as in viral encephalitis, and dead-end
hosts.
Evasion of Host Defenses
In an effort to ward off the infection, the host initiates an inflammatory response. Principal
components of this response include interferons, cytotoxic T lymphocytes, antibody producing B-
lymphocytes, a variety of effector molecules, and complement. These various components work in
concert and augment one another in an attempt to rid the host of the infecting virus. In this effort to rid
itself of the infecting virus, the inflammatory response causes many of the clinical signs and lesions
associated with viral infections.
Interferons (α and β) are produced by virus-infected cells. They act to stop further virus
replication in the infected and neighboring cells. Interferons also enhance antigen expression on
infected cells, thereby making them more recognizable to cytotoxic T cells. Some viruses (e.g.,
adenovirus) produce RNAs that block the phosphorylation of an initiation factor, that reducing the
ability of interferon block viral replication.
Cytotoxic T cells kill viral infected cells by releasing perforins, which create pores in the virus-infected
cell. Granzymes are then released into the virus-infected cell, which degrade the cell components.
Lastly, cytotoxic T cells stimulate apoptosis of the host cell.
Some viruses reduce the expression of MHC class I antigens on the surface of the host cell
(e.g., cytomegalovirus, bovine herpesvirus type I, adenoviruses). As cytotoxic T cells cannot detect
viral antigens that are not complexed with MHC class I antigens, virus-infected cells cannot be
destroyed in this manner, allowing "survival" of the virus within the host. However, cells with no or
insufficient MHC class I antigen on their surface are recognized by natural killer cells, which kill the
cell in a manner similar to that described for cytotoxic T cells.
Antibody producing B-lymphocytes secrete specific antibodies to neutralize the infectious
virions when the cell liberates them. Antigen-antibody complexes in turn can activate the complement
system. Complement aids in stimulating inflammation and the effective neutralization of virus and in
the destruction of viral infected cells.

29. 29
The various effector molecules (cytokines) that are produced by the cells of the immune system
have many roles, including the induction of fever and the attraction of other inflammatory cells, (e.g.,
neutrophils and macrophages) to the injured site. Some viruses possess receptors for a variety of
cytokines (e.g., vaccinia virus has receptors for interleukin-1, which stimulates fever production).
When immune cells release the cytokine, it is bound to the virus. This, in turn, reduces the amount of the
cytokines available to modulate immune responses. This enhances the "survival" of the virus within the
host. An alternate mechanism to evade the immune response is to have many antigenic types
(serotypes). An immune response to one serotype does not guarantee protection from another serotype
of the same virus. For example, there are over 100 serotypes of rhinovirus and 24 serotypes of
bluetongue virus.
Persistent Viral Infections
Some viruses have the ability to abrogate the inflammatory response and cause persistent infections.
They accomplish this in a number of ways, including the destruction of T lymphocytes causing
immunosuppression, the avoidance of immunologic surveillance by altering antigen expression, and by
the inhibition of interferon production.
There are three clinically important types of persistent infections:
Chronic-carrier infections
These are organisms that continually produce and shed large quantities of virus for extended periods of
time. As a result they continually spread the virus to others. Some chronic-carriers are asymptomatic or
exhibit disease with very mild symptoms. Examples include infections with equine arthritis virus,
feline panleukopenia virus, and avian polyoma virus.
Latent infections
A special type of persistent infection is one in which the virus is maintained in the host in a "non-
productive" state. Herpesviruses are notorious for causing latent infections. The viral genome is
maintained in neurons in a closed circular form, and is periodically reactivated (often during stressful
conditions) resulting in a productive infection and viral shedding. Latent infections also occur with
retroviruses in which the proviral DNA is incorporated into the host cell genome. Cell transformation
and malignancy may result if the integrated transcript causes a disruption of normal cellular control
processes.
Slow Virus Infections
This refers to those viral infections in which there is a prolonged period between initial infection and
onset of disease. In this case, viral growth is not slow, but rather the incubation and progression of
disease are extended.

30. 30
CULTIVATION OF VIRUSES IN CHICKEN EMBRYOS
Propagation of viruses is done for their initial isolation and detection, passage for stock cultures,
chemical analysis, vaccine production, preparation of antigens for serological tests, and for other
immunological and molecular needs Since viruses can only be propagated in living hosts,
embryonating eggs, tissues and cell cultures have been commonly used for their cultivation. Chicken
embryos are used because of their (1) availability, (2) economy, (3) convenient size, (4) freedom from
latent infection and extraneous contamination, and (5) lack of production of antibodies against the viral
inoculum. Eggs from healthy, disease-free flocks should be used.
Incubation of embryos is usually at 98.8—99.5F (37.1—37.5C) throughout the entire period.
Lower temperatures may be required under certain circumstances.
Knowledge of the development of the avian embryo is necessary for utilization of this medium
for cultivation of viruses. The embryo commences development as a sheet of cells overlying the upper
pole of the yolk. The embryo is recognized with difficulty during the first few days, but at 4- or 5-days
of incubation it may be readily detected by candling. From the 10th day the embryo rapidly increases
in size and feathers appear. As the embryo increases in size, there is an accompanying decrease in the
volume of the extraembryonic fluids. At the time of hatching there is no free fluid in any of the
extraembryonic cavities. Throughout incubation there is a steady loss of water by transpiration through
the shell.
The amnion and chorion arise by a process of folding and overgrowth of the somatopleure.
The amnion develops first over the head and then the caudal region. By fusion of the lateral folds, the
amnion completely envelops the embryo, except for the yolk sac, from the 5th day of incubation.
From the 6th to 13th days there is an average of about 1 ml of amniotic fluid. By the 10th day, the
chorion almost completely surrounds the entire egg contents and is in immediate contact with the shell
membrane.
The allantois appears on the 3rd day as a diverticulum from the ventral wall of the hind gut into
the extraembryonic cavity and rapidly enlarges up to the 11th or 13th day. During the process of
enlargement, the outer layer of the allantois fuses with the outer layer of the amnion and the inner layer
of the chorion to form the allantoic cavity. The amount of allantoic fluid varies from about 1 ml on the
6th day to 10 ml on the 13th day. The fused chorion and allantois is known as the chorioallantoic
membrane, which is highly vascular and constitutes the respiratory organ of the embryo.
In the early stages of development, the amniotic and allantoic fluids are solutions of
physiologic salts. After about the 12th day, the protein content and viscosity of the amniotic fluid
increases. The allantoic cavity receives the output of the kidneys, and after the 12th or 13th day the
allantoic fluid becomes turbid because of the presence of urates.
The yolk sac consists of a steadily enlarging sheet of cells. From the 12th day on, the yolk
material becomes progressively drier and the yolk sac more fragile. During the last 24 to 48 hours of
incubation, the yolk sac is drawn into the abdominal cavity.

31. 31
Routes of Inoculation and Collection of Specimens
The various procedures outlined for inoculation of chicken embryos and for collection of
specimens are a compilation of methods. Tissues and organs from embryos and birds should be
collected aseptically using standard recovery procedures. The CAM, yolk sac and embryo or bird
tissues should be ground as a 10% suspension in a sterile diluent with antibiotics and then centrifuged
at low speed (1,500 x g for 20 minutes before inoculation).
Some of the factors influencing the growth of viruses in chicken embryos are (1) age of the
embryo, (2) route of inoculation, (3) concentration of virus and volume of inoculum, (4) temperature of
incubation, and (5) time of incubation following inoculation. The presence of maternal antibody in the
yolk of hens immunized against or recovered from certain viral infections, precludes the use of the
yolk sac route for initial isolation and subsequent passage of viruses. All fluids from live birds
suspected of having virus material should have antibiotics such as gentamicin, penicillin+streptomycin
and fungizone added to it before inoculation into embryos.
It may take several “blind” passages (no pathology), before noticeable pathologic changes take
place in the embryo, if the virus is in small amount. When working with viral infected material, one
should always practice sterile technique and work under a class II microbiological safety cabinet.
Allantoic Cavity inoculation employs embryos of 9- to 12-days incubation. The inoculum is
generally 0.1—0.2 cc. Some of the avian viruses which grow well in the allantoic entoderm are those
of Newcastle disease, infectious bronchitis, and influenza. This route has the advantage of simplicity
of inoculation and collection of specimens when large quantities of virus-infected fluid are to be
obtained for use in chemical analysis, vaccine production, and preparation of antigen for serologic
tests.
1. Candle the embryos and select an area of the chorioallantoic membrane distant from the embryo
and amniotic cavity and free of large blood vessels about 3 mm below the base of the air cell. In
this area, make a pencil mark at the point for inoculation.
2. Make a similar mark at the upper extremity of the shell over the air cell.
3. Apply tincture of suitable disinfectant to the holes and allow to dry.
4. Drill a small hole through the shell at each mark but do not pierce the shell membrane.
5. Using a syringe with a 25 gauge 5/8 inch (16 mm) needle, inoculate 0.1 to 0.2 ml inoculum per
eggs by inserting the entire length of the needle vertically through the hole and injecting the
desired amount.
6. Seal the hole with glue or hot wax and return the eggs to the incubator.
7. Candle the eggs daily for 3 to 7 days for signs of death (absence of blood vessels and a dead
embryo at the bottom of the egg).

32. 32
8. Eggs dying in 24 hours should be discarded, since their death was probably due to bacteria
(which can be determined by isolation of fluids in media) or trauma.
9. Embryos dying after that time should be refrigerated for 1 hour then fluids harvested and frozen
at -70C for later use.
10.Blind passage of suspected viral inoculum can be accomplished by reinoculating the allantoic
fluids every 5 to 7 days into fresh eggs until pathology or death occurs. Initial isolation of some
viruses from clinically ill birds including infectious bronchitis virus (IBV) may take as many as
3 passages for embryo death to occur.
11.Always check live or dead embryos after harvesting fluids for evidence of pathologic changes
such as curling and stunting for IBV, and stunting and hemorrhages (Figure 3.1) for Newcastle
disease virus (NDV) or reoviruses.
12.All eggs should be disinfected before harvesting.
13.Crack the eggshell over the air cell by tapping the eggshell with the blunt end of sterile forceps.
Remove the eggshell which covers the air cell, being careful not to rupture the underlying
membranes, and discard pieces of the eggshell in disinfectant. Discard forceps in a beaker of
disinfectant.
14.Use forceps to tear the eggshell membrane, the CAM, and the amniotic membrane to release the
fluid. Depress the membranes over the yolk sac with the forceps and allow the fluid to collect
and pool above the forceps. Using a 5-ml pipette or syringe and needle, aspirate the fluid and
place it into a sterile 12 x 75-mm snap-cap tube or other suitable vial. It may be necessary to
carefully peel back the eggshell membrane from the CAM to permit a better view of the
membranes.
Figure 3.1. Embryo pathology induced by virus in embryo on the right

33. 33
Figure 3.2. Plaque on CAM
Figure 3.3 Viral isolation in embryos
15. Clarify the fluid by centrifugation at 1500 x g for 10 minutes and test the fluid for evidence
of virus infection using hemagglutination, electron microscopy, or other suitable methods.
16. Store at -70C for passage or other use.

34. 34
I. Avian Influenza
Figure 3.4 Avian virus morphology
AIV is in a family of negative-sense, single-stranded RNA viruses. They are smaller than the
paramyxoviruses and their genome is segmented (7 to 8 segments) rather than consisting of a
single piece of RNA. Influenza viruses are the only members of Orthomyxoviridae.
Viruses of this family have a predilection for the respiratory tract, but usually do not cause a serious
disease in uncomplicated cases. Exceptions are human infections with viruses of avian origin.
Principal viruses of veterinary importance are type A influenza viruses, which cause equine, swine,
and avian influenza.
Viral Characteristics
• Viruses have a segmented single-stranded RNA genome, helical nucleocapsids (each RNA
segment + proteins form a nucleocapsid) and an outer lipoprotein envelope. The segmented
genome facilitates genetic reassortment, which accounts for antigenic shifts. Point mutations in
the RNA genome accounts for antigenic drifts that are often associated with epidemics. In either
case, the changes are frequently associated with the HA (hemmaglutinin) and NA
(neuraminidase) antigens.
• The envelope is covered with two different kinds of spikes, a hemagglutinin (HA antigen) and a
neuraminidase (NA antigen). In contrast, the hemagglutinin and neuraminidase activities of
paramyxoviruses are in the same protein spike.
• In the laboratory, the virus replicates best in the epithelial cells lining the allantoic cavity of
chicken embryos.
• The viruses agglutinate red blood cells of a variety of species.
• Replication takes place in the nucleus.
• The viral RNA-dependent RNA polymerase transcribes the negative-sense genome into
mRNA.
• Influenza viruses are labile and do not survive long on premises.
is in a family of negative-sense, single-stranded RNA viruses. They are smaller than the
paramyxoviruses and their genome is segmented (7 to 8 segments) rather than consisting of a
single piece of RNA. Influenza viruses are the only members of Orthomyxoviridae.
Viruses of this family have a predilection for the respiratory tract, but usually do not cause a

35. 35
serious disease in uncomplicated cases. Exceptions are human infections with viruses of avian
origin. Principal viruses of veterinary importance are type A influenza viruses, which cause equine,
swine, and avian influenza.
Viral Characteristics
• Viruses have a segmented single-stranded RNA genome, helical nucleocapsids (each RNA
segment + proteins form a nucleocapsid) and an outer lipoprotein envelope.
• The segmented genome facilitates genetic reassortment, which accounts for antigenic shifts.
Point mutations in the RNA genome accounts for antigenic drifts that are often associated with
epidemics. In either case, the changes are frequently associated with the HA (hemmaglutinin)
and NA (neuraminidase) antigens.
• The envelope is covered with two different kinds of spikes, a hemagglutinin (HA antigen) and a
neuraminidase (NA antigen). In contrast, the hemagglutinin and neuraminidase activities of
paramyxoviruses are in the same protein spike.
• In the laboratory, the virus replicates best in the epithelial cells lining the allantoic cavity of
chicken embryos.
• The viruses agglutinate red blood cells of a variety of species.
• Replication takes place in the nucleus.
• The viral RNA-dependent RNA polymerase transcribes the negative-sense genome into
mRNA.
• Influenza viruses are labile and do not survive long on premises.
Swab preparation
BHIB with Penicillin/Streptomycin
(P/S) Procedure:
Add 900 ml ddH2O to 1 L flask.
Add 37g BHI powder and dissolve completely by stirring over low heat.
Pour half of the BHIB solution into another 1L falsk and cover both with foil.
Autoclave flasks for 15 min on a liquid exhaust cycle and cool on bench top.
In hood, add 6.02g of Penicillin-G to 150 ml beaker.WEAR GLOVES AND MASK!
In hood, add 10g of streptomycin sulfate to 150 ml beaker. WEAR GLOVES AND MASK!
In hood, add 50 ml ddH2O to 150 ml beaker and dissolve P/S.
Transfer P/S/ solution to 100 ml flask and add 100 ddH2O to 100 ml.
Filter P/S solution through a 0.22um filtration device into a sterile 125mL bottle.
Label and store in refrigerator until BHIB is cool.
Once BHIB is cool, add P/S solution (50 ml to each flask) and stir.
Pour into ten sterile 125 mL bottles.
Label bottles, put tape around bottle neck/cap, and store in freezer.
To prepare sampling vials:
Using sterile technique and working under a hood pipette 1.8mL BHIB with P/S into each disposable
5mL capped tubes.
Freeze vials in lab freezer until needed for sampling.

36. 36
II. Sample collection
Collect cloacal swabs, place in tubes and store on ice. Samples can be shipped with cool packs if they
will arrive at the laboratory within 48 hours.
Upon arrival in the lab, centrifuge fluid at low speed (500-1500 x g) to sediment debris. Supernatant
should be kept at 22-25 C for up to 15-60 min, to allow the antibiotics to reduce the level of bacterial
contamination. Supplementation with additional antibiotics may be needed. If further reduction in
bacterial contamination is required to reduce embryo deaths or nonviral HA activity of egg fluids, the
supernatant can be filtered through prewet 0.22-0.45-µm filter. However, filtration can remove low
levels of virus from samples and reduce isolation rates. Put samples in 3 vials/case then store at -700
C.
III. Processing cloacal swabs – inoculation
Candle 10 day old fertile eggs. Mark the edge of the air sac on viable eggs and discard dead/infertile
eggs.
Arrange eggs on a plastic flat in six rows of four eggs.
Label eggs with sample/bird number and egg letter (A thru D for each sample)
Retrieve samples (Swabs in vials of BHIB) from the ultra cold freezer, thaw quickly in a 37 C water
bath, and then keep cold for the rest of the procedure, either in the refrigerator or an ice bath.
Vortex samples for 1 min, then centrifuge for 15-20 minutes at 1200 rpm.
Sanitize eggs by lightly wiping with sterile swab dipped sparingly in 5% iodine in alcohol solution.
Sanitize egg punch with 70% alcohol. Use the egg punch to puncture a small hole in the shell just
above the air sac line. Do not damage the membrane that lies just below the shell.
Inoculate eggs using a 23 gauge needle on a 1cc syringe. Pull up 0.6 ml of sample and inoculate 0.15
mL into each egg through the punched holes, inserting the needle vertically, slightly pointed toward
the front of the egg.
Cover the holes with a small drop of Duco cement.
Incubate eggs for 48-72 hours in a 37 C humidified incubator.
Clean out and sanitize hoods with 70% alcohol.
IV. Processing cloacal swabs – harvest
Label a 96-well plate with one half-row per sample number and two sets of A-D columns.
Add 0.025mL PBS to each sample well and 0.50mL PBS to each control well.
Transfer eggs into cardboard trays and sterilize shells with a quick squirt of isopropanol.
Use an egg cracker and forceps sterilized by flaming to crack and peel away the top of the shell.
Using a sterile disposable pipette, place a drop of chorioallantoic fluid from each egg into the
appropriate well. Use a new pipet for each row/sample.
Cover tray of open eggs with foil and return to refrigerator.
After harvesting all the eggs, add 0.05mL 0.5% CRBC to each well of plate.
Cover and let sit at room temperature for 45 minutes.

37. 37
Read and record results: pelleted CRBCs that run in a tear-drop shape upon tilting the plate 45 degrees
indicate a NEGATIVE well; hemagglutinated CRBCs (formed in a lattice-work, giving a solid pink
appearance to the entire well) indicate a POSITIVE well.
Harvest all the chorioallantoic fluid from each positive egg separately into a labeled tube.
Perform an HA titer on the fluid harvested from each egg.
Pool harvests from eggs of the same sample with similar titers.
Aliquot into labeled cryovials and freeze in the ultra-cold freezer.
Controls:
Cell control – Add 0.05mL PBS and 0.05 mL CRBC to the bottom row of the plate. Each well should
pellet and run in a tear-drop upon tilting. (This is a negative control that tests CRBC integrity and
insures there is no agglutinating virus present in the blood suspension).
V. Processing cloacal swabs – Inoculating Re-passes
Thaw virus samples in 37 C water bath, then keep cold for the rest of the procedure. Vortex about 1
minute.
Dilute samples in BHIB with P/S. Dilute 1:10 if re-passing to increase titer or to check a questionable
(+/-) first pass; dilute 1:100 if re-passing to make more stock.
Centrifuge diluted samples for 15-20 minutes at 1500 rpm.
Filter samples through a 0.22 um filter into a sterile labeled cryovial.
Inoculate and harvest samples as outlined above.
VI. Hemagglutination (HA) Test
Add 0.05mL PBS to each well of a 96-well plate labeled with the sample number for every two rows
and “2, 4, 8, 16, 32, 64, 128, 256” (virus dilutions) across the top.
Add 0.05mL virus isolate to the first well of appropriate rows.
Mix and transfer 0.05mL across each row, discarding the final 0.05mL.
Add 0.05mL 0.5% CRBC to each well.
Cover and let sit at room temperature for 45 minutes.
Read and record results: pelleted CRBCs that run in a tear-drop shape upon tilting the plate 45 degrees
indicate a NEGATIVE well; hemagglutinated CRBCs (formed in a lattice-work, giving a solid pink
appearance to the entire well) indicate a POSITIVE well. Results are read as the inverse of the furthest
dilution producing complete agglutination, ie, the last positive well.
Controls:
Cell control – Add 0.05mL PBS and 0.05 mL CRBC to the bottom row of the plate. Each well should
pellet and run in a tear-drop upon tilting. (This is a negative control that tests CRBC integrity and
insures there is no agglutinating virus present in the blood suspension) (figure 3.5).

38. 38
Figure 3.5. HA test results
-HA test (top wells) and +HA test (bottom wells)
Chorioallantoic Membrane inoculation employs 10- to 12-day-old embryos and inoculum of
0.1-0.5 cc. This route is effective for primary isolation and cultivation of the viruses of fowl pox,
laryngotracheitis, infectious bursal disease virus, reoviruses, which produce easily visible foci or
"pocks." The chorioallantoic membrane is a suitable site for study of the development of pathologic
alterations and inclusion bodies, and titration of viruses by the pock-counting technique (Figure 3.2).
1. Candle embryos for viability.
2. Mark an area about 1/4 inch below and parallel to the base of the air cell. Disinfect
with 70% alcohol or Betadine® solutions.
3. Drill or punch a hole at this mark being very careful not to tear the shell membrane.
Punch a hole directly at the top of the air cell.
4. Holding the embryo in the same position and using a rubber bulb, draw air out of
the air cell by placing the bulb over the hole at the top of the embryo. This
negative pressure creates the artificial air cell by pulling the CAM down.
5. Using a 25-27 gauge needle, insert it into the artificial air sac about 1/8 inch and release
the inoculum. Make sure the embryo is lying horizontally for 24 hours of incubation
then return to upright position.
6. The following procedure is most commonly used for harvesting the CAM.
a) Crack the eggshell over the false air cell by tapping the eggshell with the blunt
end of sterile forceps. Remove the eggshell as close to the edge of the false air
cell as possible and discard pieces of eggshell in disinfectant. Discard the
forceps in a beaker of disinfectant.
b) Observe the CAM for signs of thickening (edema) and plaque formation.

39. 39
c) Harvest the CAM by grasping it with sterile forceps, stripping away excess
fluids with a second set of forceps. Place harvested CAM in a sterile petri plate
for further examination or in a 12 x 75-mm snap-cap tube or other suitable vial
for storage.
d) Freeze and store the vial containing the CAM at -70C.
Figure 3.6 Yolk sac injection
Yolk Sac inoculation is performed with 5- to 8-day-old embryos and inoculum of 0.2-1.0 cc.
This route can be used for initial isolation of reoviruses (figure 3.6).
1. Rotate the egg until blood vessels can be seen close to the margin of the air cell.These
vessels may appear as nothing more than an array of faint lines, orange in color,
extending from a clear halo. The embryo is within the area of the halo.
2. With an egg punch, make a hole in the top of the shell.
3. Use a 25-27 gauge, 1 ½-in. length needle. Insert the needle straight down into the yolk
sac until its point is one-half the depth of the egg. Aspirate some yolk material in the
egg, and then reinoculate the material with suspect virus material into the embryo.
4. For harvesting the Yolk-Sac Fluid:
a) Open the egg in the same way as described above for harvesting AAF.
b) Rupture the CAM to allow access to the yolk-sac membrane.
c) Grasp the yolk-sac membrane with forceps and carefully lift it to separate it
from the embryo and other membranes. Using a second set of forceps, strip off
the excess yolk and place the yolk sac in a sterile 12 x 75-mm snap-cap tube or
other suitable vial for storage.

40. 40
P
P
P
P
d) The fluid can also be taken directly by aspiration through a large (small gauge) needle
or pipette (Figure 3.7). Store yolk sac at -70C.
Figure 3.7. Harvesting virus from embryos
PROPAGATION IN CHICKEN TISSUES
Many tissues of the chicken can serve to propagate viruses. One of the most common is the
bursa of Fabricius. This organ is a sac-like organ in the form of a diverticulum at the lower end of the
alimentary tract in birds. It produces B lymphocytes which can differentiate into plasma cells upon
antigen stimulation. Mature B-cell can then produce immunoglobulins, which are active against
pathogenic organisms. Infectious bursal disease virus, reoviruses, adenoviruses, lymphoid leukosis
viruses, and Marek’s disease virus will readily propagate in the bursa. Infectious bursal disease virus
(IBDV) replicates to a very high titer nearly 109
/ml in the bursa. This virus can cause severe
morbidity, mortality and/or immunosuppression in susceptible chickens. Specific pathogen free (SPF)
chickens between the ages of 3 to 6 weeks are commonly used for the propagation of this virus.
Chickens are normally given by eye and nose drop about 103
/ml of the virus. The chicks are housed in
isolation units maintained with filtered air and sacrificed 3 days post infection. The bursae are placed
in NET buffer and stored at -70 C until needed. Bursae can be ground with a blender or grinder in
buffer at a 10% suspension and then stored in an ultracold freezer.
References
Senne, D.A., 1989. "Virus Propagation in Embryonating Eggs." In a Laboratory Manual for the
Isolation and Identification of Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque,
Iowa, pp. 176-181.
Villegas, P., 1986. "Cultivation of Viruses in Chicken Embryos." In A Laboratory Manual
of Avian Diseases. University of Georgia, Athens, GA. pp. 1-5.
UTable of ContentsU

41. 41
PROPAGATION IN CELL CULTURE
Introduction
Cell cultures are used in laboratories for the isolation, identification, and propagation of viruses
and for the detection of neutralizing antibodies. Cell cultures have advantages over animals or
embryonated eggs. Cell cultures are economical, and they are a homogeneous population of cells, free
of immunological and hormonal influences that might affect replication of the virus. In addition, many
cell lines can be stored in liquid nitrogen and be readily available.
Aseptic technique is important even in the presence of antibiotics. Contamination can be
reduced using laminar flow hoods and using alcohol cleaned gloves and wearing a mask.
Laboratory equipment
Culture media and solutions need a large supply of pure water. The water must be deionized,
double-distilled, or both, to remove traces of cytotoxic organic and inorganic materials. Reverse
osmosis followed by glass distillation is used.
In general, cells are cultured in plastic petri dishes, flasks, or roller bottles specially coated for
cell culture. Plastic vessels are sterilized after use by autoclaving and discarded. It is possible,
however, to recycle used plastics. Other equipment that is needed include an inverted microscope,
and, if cells are cultured in dishes or tubes open to the atmosphere, an incubator in which the
atmosphere can be maintained with 85% relative humidity and 5% carbon dioxide. Incubator
cleanliness is important to prevent contaminating the cultures. Mouth pipetting is not acceptable. Use
either a rubber pipette filler or an electric apparatus. An autoclave is needed to sterilize, clean and
disinfect lab ware at 20 lbs of pressure for 20 minutes.
Media and Solutions
The different cell-culture media all have the following composition:
1) A balanced salt solution.
2) A protein supplement such as serum.
3) An antibiotic mixture to control microbial contamination.
Cell culture media can be bought nearly complete (except for sera and antibiotics)
commercially from many sources in a powdered or liquid format. This medium provides the cells
nutrients and conditions for growth. Complex media such as minimum essential medium (MEM),
M199 and RPMI-1640 are normally purchased as 10x liquid concentrate or in powdered form). They
are normally prepared with buffered salts such as Hank's or Earle's. Additional vitamins, amino acids

42. 42
(particularly L-glutamine which is not stable at refrigerated temperature) are added to improve growth.
A typical avian cell culture growth media contains the following:
Table 3.1. Balanced Salt Solutions (BSS) and Phosphate-Buffered Saline (PBS)
200 mM Glutamine 10ml
7.5% NaHCOB
3B 29.30 ml
10x MEM 100 ml
HB
2BO 760.7
Serum* (10%) 100ml
Total 1,000 ml
*Maintenance media may contain any where from 0 to 3% Fetal Bovine Serum depending on
confluency and age of the cells.
Hanks' and Earle's BSS are frequently used as bases for growth medium. Their function is to
maintain a physiological pH (7.2 to 7.6) and osmotic pressure and to provide water, glucose, and
inorganic ions needed for normal cell metabolism. They usually contain an indicator of pH, e.g.,
phenol red. BSS and PBS are also frequently used to wash inocula and dead cells from cultures, to
remove serum-containing media before trypsinization, and to dilute trypsin solutions.
The stock solutions can be autoclaved, sterilized by filtration, and stored frozen or at 4C. For
use, one part of the 10x solution is added to nine parts of water, and it is finally sterilized either by
filtration or by autoclaving.
Trypsin-Versene Solution
Trypsin is needed to digest connective tissue so individual cells suspensions can be made.
Stock solutions of up to 2.5% trypsin can be prepared or obtained commercially. Sterilize by filtration.
Dispense in 50-to-100-ml quantities and freeze at -20C. Use as 1x (final concentrations: 0.05%
trypsin and 0.025% versene (TV)) by mixing 100 ml 10x TV with 900 ml of sterile glass-distilled
water. It is recommended that TV be warmed to 37 C before use.
Sodium Bicarbonate Solution
For pH control, sodium bicarbonate is added to the medium just before use. Various
concentrations from 1.4% to 10% have been used. Sterilize by filtration and store at room
temperature.
Neutral Red Solution
A 1% solution of neutral red (Difco, Detroit, MI) can be prepared in water, sterilized by
filtration and stored at room temperature to observe pH of the medium.

43. 43
Antibiotic Solution
Penicillin G sodium and dihydrostreptomycin sulfate are purchase desiccated and stored in the
refrigerator or in solution and stored frozen. A final concentration of 100 IU penicillin and 100 ug of
dihydrostreptomycin are normally used to control bacteria. Gentamicin sulfate stock solution at 10
mg/1 ml can be substituted at a use level of 0.1 ml/10 ml of medium. To control fungi Nystatin
(Mycostatin, Squibb, New York, NY) or amphotericin B (Fungizone, Squibb) can be added at 40 IU or
2 ug per ml of medium, respectively.
Sera
Fetal bovine (FBS) or calf serum (CS) are routinely added to media for cell cultures. The sera
provide unknown cofactors needed for cell growth. Only purchase sera, which have been tested to be
free of mycoplasma.
Sterilization
Many items are purchased sterilized. Others including neutral red, versene and water can be
prepared by autoclaving. Media containing thermolabile compounds such as amino acids, (antibiotics,
serum or trypsin) must be sterilized by filtration. Pressure filtration through membrane filters
(Millipore, Corp., Bedford, MA or Gelman Sciences, Ann Arbor, MI) is routinely used.
Preparation of primary avian cell cultures requires that organs be aseptically removed from
embryos or young chicks. Organs must be cut into small pieces and tissues dispersed into a suspension
of single cells by enzymatic digestion. They are then allowed to grow into confluence in an incubator.
Chicken Kidney Cells (CEK)
Kidney cells can be prepared from 18-20-day-old embryos or day-old to three-day-old chicks.
The amounts indicated here are for preparing kidney cells from 10-15 embryos.
1. Prepare media and trypsin solution and set in 37 C water bath.
2. Spray eggs with disinfectant and allow drying under a sterile hood.
3. Using sterile technique (sterile equipment and media) remove embryos with blunt ended curved
forceps and put into tray. Wash embryos with 70% alcohol or sterile distilled water.
4. Use regular dissection methods or cut the backbone right above wing joint and separate. This
exposes the kidneys without having to touch the intestines and viscera.
5. Remove kidneys and put into glass beaker containing phosphate buffer solution (PBS) or
Hank's balanced salt solution (HBSS).

44. 44
P P
6. Pour off supernatant and clean kidneys. If there are any large chunks, mince lightly with
scissors or squeeze gently with forceps. Wash three to four times with PBS or HBSS. Use 75-
100 ml PBS total.
7. Drain off the last wash and pour the tissue fragments into a trypsinization flask containing a
magnetic stir bar. Add 50-100 ml prewarmed (37 C) trypsin-EDTA solution.
8. Put the flask on a stirrer base in 37 C incubator and stir very slowly for 15-20 minutes.
9. When the supernatant is cloudy, shake flask, and then set it down for several minutes to let the
clumps settle out. Take out one drop of supernatant and put it on a glass slide and observe. If
there are many single cells and small clumps (two to 10 cells) with few very large clumps then
it is time to pour off the supernatant. Have ready a sterile graduated centrifuge tube with 5 ml
of cold heat-inactivated calf serum in it. (Set in a pan of ice.) Pour supernatant through gauze
covered funnel into this tube. (The serum stops the trypsin action). With fresh trypsin repeat
process one to two times (10 min. ea.) more. Do not extend trypsinization time past 1 hr.
Centrifuge at 1000 RPM for 10 minutes.
10. The kidney cells (and RBC's) will pellet. Note the amount of cells obtained. Pour off trypsin
solution. Resuspend cells in 3-5 mls of minimal essential medium (MEM) or Hams F-10 with
Earl's balanced salt solution (EBSS). Add the cells to the appropriate amount of MEM (EBSS)
with 10% heat-inactivated fetal calf serum (growth media). One ml of cell pack can be
resuspended in approximately 200 ml of MEM (EBSS). Cells can be counted in a
hemocytometer by resuspending in a known amount of media. Make 1 to 10 dilutions of cells
in trypan blue. You will want approximately 2.5 x 106
cells/ml of media to plate out the cells.
2 2
The 35 mmP
P
plates require 2 ml and 60 mm P
P
plates require 5 ml. Do one plate first and
observe after the cells are allowed to settle for a few minutes.
The cells should form a monolayer in one to two days. When monolayer is formed, they may be
inoculated or if it is desirable, they may be inoculated simultaneously. After the cells have formed a
monolayer, the old media can be poured off, the monolayer washed with PBS. The cells are then ready
to be infected with virus or given maintenance media with 0-3% serum. The CEKS's are mainly
epithelial cells and are used for growth of infectious bronchitis virus, adenoviruses and reoviruses.
CEFC's are mainly fibroblasts and are used for growing Newcastle disease, infectious bursal disease,
and herpes viruses.
Chicken Embryo Fibroblast (CEF)
1. Use nine-11 day old embryos. The technique described here is for three to five embryos.
Spray eggs with a disinfectant (70% alcohol is commonly used). Using sterile technique, open
shell and remove embryo with blunt ended curved forceps.
2. Place embryos in petri dish and cut off heads and limbs.

45. 45
3. Transfer bodies to new petri dish or beaker containing PBS. In the beaker, the bodies can be
fragmented by carefully chopping them with sterile scissors. Another procedure that can be
used when large number of embryos is to be processed is as follows: attach a cannula to a 35 or
50 cc syringe, remove plunger, and pour tissue chunks into barrel and force through cannula
with the plunger into a 30 ml beaker. Keep the cannula and syringe sterile and use it to draw
off supernatant from above settled tissue chunks during PBS washes.
4. Wash with PBS 3-4 times to remove red blood cells.
5. Pour tissue fragments into trypsinization flask containing magnetic stirring bar. Add about 50
ml pre-warmed (37 C) trypsin solution to flask and put on stir plate at slow speed on 37 C
incubator for 10-15 minutes. Stop trypsinization by adding 1ml calf serum or by placing the
flask on ice for 3-5 min. Another trypsinization may be done on the clumps of tissues after the
supernatant with single cells has been decanted.
6. Strain cells through two folds of sterile gauge.
7. Centrifuge at 1000 rpm for 10 min and discard supernatant.
8. Add fresh PBS and vortex to wash and suspend cells.
9. Centrifuge again at 1000 rpm for 10 min and discard supernatant.
10. Note the amount of pelleted cells obtained. Resuspend cells in 1X MEM containing glutamine
and 10% FBS. One ml of cells can be diluted in 80 ml of media. Cells can be plated into 5, 25
or 100 ml flasks, or in a roller bottle. Lids of containers kept in a COB
2B atmosphere need to be
loosened to allow exchanges of gases. CEFC's will grow in a non- COB
2B atmosphere and their
lids need to be kept tightly closed.
MEM (1X)
Glutamine 5ml 5ml
NaHCO3 14.65ml 14.64ml
H2O 375.35ml 410.35ml
FBS 50ml 50ml
Pen-Strep 10ml 10ml
NOTE: Secondary cells may be made from a confluent monolayer of CEF. Dilute trypsin solution 1:2
with Hank's Balanced Salt Solution (HBSS). Pour off media on CEF plates, wash plates with 1
ml trypsin solution (for 60 mm size dish) and pour off immediately. Add 2 ml trypsin solution
to each plate and incubate in 37 C COB
2B incubator for two to five minutes. Remove
trypsinized cells from dish with a pipette and put into centrifuge tube with 1 ml serum to stop

46. 46
reaction. Centrifuge 10 min. at 1000 rpm. Secondary cells may be plated 1:3 as heavy as the
primary culture.
Normal CEFs CPE in CEFS
http://poisonevercure.150m.com/wi.htm http://www.cdc.gov/ncidod/EID/vol9no9/03-0304-G1.htm
Primary Chicken Embryo Liver Cells (CELIC)
1. Use 13-15 day-old embryos and spray eggs with a disinfectant.
2. Using sterile technique, remove embryos from eggs, open embryos to expose livers.
3. Remove the livers with curved, blunt ended forceps and put them into a beaker containing
sterile buffer solution. Be sure to cut out the gall bladder before putting into the buffer.
4. Trim off any visible connective tissue or pieces of attached intestine. Mince tissue lightly with
scissors or forceps.
5. Allow the liver pieces to settle to bottom of beaker. Decant and discard buffer containing
RBC's. Wash three times or until the buffer is clear. (Usually 100 ml of buffer is enough for
the collection and washes).
6. Drain off the last wash and pour the tissue fragments into a trypsinization flask, rinsing the
beaker out with the trypsin solution. Add 50 ml prewarmed (37 C) trypsin solution to the
flask, which already has a magnetic stirrer bar in it.
7. Put flask into 37 C incubator and stir gently for 15-20 minutes. Check cells as for CEKC step
#9.

47. 47
8. Follow CEKC procedure for remaining steps.
9. Dilute liver cells 1:150 in MEM.
Chick Embryo Tracheal Rings
1. Tracheal ring cultures are organ cultures and do not form single cell monolayers. They are used
for primary culturing of many respiratory viruses. Use either embryos (19-20 day-old) or one-
day-old chickens. Open disinfected egg shell and remove embryo cutting away the yolk sac.
2. Cut skin until trachea is completely exposed.
3. Carefully remove the trachea with forceps and remove all fatty tissue surrounding it.
4. Place trachea in glass petri dish containing approximately 5 mls of HBSS.
5. Lay tracheas on sterile filter paper and place on tissue chopper. Use sterile razor blade and cut
trachea into rings at medium speed.
6. Wash mucous from inside of rings with a syringe and needle containing HBSS. Place rings in a
separate petri dish containing HBSS.
7. With small forceps, place individual rings into sterile test tubes. Cover with 0.5-1.0 mls of
media. Be sure rings are immersed in solution.
8. Put tubes in rack and rotate at 37 C for 24 hours. Mucous may again need to be washed from
inside of the rings with HBSS.
9. At the end of 24 hours, check for ciliary movement under the microscope (use either the 4X or
10 X objectives).
10. Score the ciliary movement as follows:
If half the ring has movement, the ring would be assigned a 2.
If 3/4 of the ring has movement, the ring would be assigned a 3.
If the entire ring has movement, the ring would be assigned a 4.
Rings with reading lower than 2 are not used.
11. The rings are now ready to be inoculated. The ciliary movement should be read after 3-5 or 7
days, depending upon the virus being studied.
Tracheal rings can be used to detect the presence of infectious bronchitis virus (IBV), Newcastle
disease virus (NDV), and laryngotracheitis virus (LT). They can also be used to run Virus
Neutralization Tests for IBV. Tracheal rings can also be used to evaluate ciliary activity after

48. 48
challenge with field isolates. Rings are prepared from adult birds four days after challenge. The
ciliary activity is evaluated as described.
Procedure for Inoculating Preformed Monolayers
1. Swirl plate to resuspend as many RBC's and debris as possible and then decant and discard
growth medium.
2. Wash monolayer gently with 2-3 mls of prewarmed PBS and discard.
3. Add 0.1 ml sample inoculum to the small 10 x 35 mm plates or 0.2 ml for the larger size (60
mm). Rock each plate gently to distribute inoculum evenly over the cell monolayer.
4. Incubate inoculated cultures in 37 C incubator for 45 minutes to allow virus to absorb Rock
tray once or twice during incubation if possible.
5. Add 2 ml maintenance medium to each 35 mm plate (or 5 ml for 60 mm plates.)
Note: Maintenance media — 0% - 3% heat-inactivated calf serum.
6. Incubate at 37 C. Check plates daily for damage to the cells or cytopathogenic effect (CPE).
7. To harvest samples, freeze plates and then thaw two to three times, shaking flask when media is
partially thawed to help dislodge cells and collect. Alternatively, cell monolayers can be
removed by removing media and then scraping adherent cells with a sterilized "rubber
policeman". Virus will be present both extracellularly in media and intracellular in cells.
Freezing and thawing or sonication for five minutes will disrupt cells to remove virus. For
some highly intracellular viruses such as herpes viruses it is best not to disrupt the cells.
Cell Lines and Secondary Cultures
A cell line is a population of cells derived from an animal tissue, which can be continually
propagated over numerous passage mammalian cell lines which support avian virus growth. They
include VERO and BGM—70 cells. VERO cells are derived from kidney tumors of African green
monkeys whereas BGM cells are kidney cells derived from a bovine tumor. The tumor cells’ genetic
material allows them to grow indefinitely. Avian viruses such as Newcastle disease, infectious
bronchitis, infectious bursal disease and reoviruses have been adapted to these cell lines. Cell lines
from tumors of ducks and chickens will also support avian herpesviruses, avian leukosis viruses,
Marek's disease virus and the chicken anemia virus. Primary Chicken Embryo Fibroblast Cells
(CEFC's) that can be passaged up to four times in cell culture are called secondary cells. The
advantages of all lines and secondary cells are that they don't require live animals embryos and can be
stored frozen in liquid nitrogen so they are readily available when needed. The passage and use of
these lines or cells is as described under CEFC's.

49. 49
Freezing cells
A low temperature freezer (-70C) or liquid nitrogen container (-196 C) is needed. The
freezer should be plugged into an electric surge protector and be equipped with an alarm in case of
temperature rise, and backed up with a gas powered electric generator in case of long term power
failure. The liquid nitrogen tank should be checked monthly with a ruler to measure depth of nitrogen
in the tank. The tank normally needs to be refilled every four to six weeks depending on usage.
Procedure for freezing cells
1) Use only actively growing cells (2 to 5 days of age).
2) Prepare the cells as outlined for passage of secondary CEFC's.
3) Centrifuge the cells at 400 g for 5 mins and discard the supernatant fluid.
4) Resuspend cells in cold culture medium or calf serum containing 10% dimethyl sulfoxide.
5) Transfer the cells to prechilled freezing vials and place in an insulation container which allows
for a gradual drop in temperature of 1 C per minute. Place the container in a -20 C freezer
for 1 hr. then -70 C for 8 hours and, if available, liquid nitrogen. Cells are viable for months
at -70 C and for years at -196 C.
6) For use, cells should be thawed in a water bath at room temperature.
7) Thawed cells should be plated at 2x the density of primary cell lines. Maintenance of these
cells is as previously mentioned.

50. 50
APPLICATION OF CELL CULTURE METHODS FOR VIROLOGY
Virus multiplication in cell culture can be detected in several ways:
1) Morphologic alternation of the cell, called cytopathic effect (CPE) due to degeneration of
cellular organelles. The CPE can be seen as holes in the monolayer (Figure 3.3).
Prior to death, cells may round up, become refractile or partially detach from the monolayer.
2) The formation of giant cells or syncythia (fusion of cell membranes).
3) The pH changes in the medium (red to yellow color change) due to changes in cell metabolism.
4) Serologic methods such as fluorescence or immunoperoxidase assays, can detect viral
multiplication in cells. As with chicken embryos, viruses upon initial isolation may have to be
passaged blindly (no visible CPE) several times before their presence becomes apparent (figure
3.8).
Figure 3.8 Viral CPE (hole in monolayer)
UTable of ContentsU

51. 51
VIRUS IDENTIFICATION
Animal viruses are classified based on their physical and chemical characteristics. Viruses are
first divided into two groups based on their nucleic acid content. Deoxyribonucleic acid (DNA) viruses
are divided into seven families, five of which contain avian pathogens. These families also contain
either single or double stranded nucleic acid. Ribonucleic acid (RNA) viruses are divided into
16 families, nine of which cause disease in poultry. Some of the DNA families and representative
viruses are 1) Adenovirus — inclusion body hepatitis; 2) Herpes virus — Marek's disease, and 3) Pox
virus — Fowl pox. Some of the most important RNA virus families and representative individuals
include: 1) orthomyxovirus — Avian influenza; 2) paramyxovirus — Newcastle disease; 3)
coronavirus — infectious bronchitis; 4) Retrovirus — leukosis; 5) picorna virus — avian
encepholamyelitis; 6) reovirus — viral arthritis; and 7) birna virus — infectious bursal disease.
Reoviruses and birna viruses contain double stranded RNA.
Other Criteria for classifying viruses include:
1) Presence of a lipoprotein envelope; 2) diameter of the virion, and 3) symmetry of nucleocapsid.
Knowledge of these criteria will help place the virus in a recognized family, however, to
positively identify a virus serologic methods (reacting an unknown virus with a known antibody) are
often required (Table 3.2).
Table 3.2. Important Biological, Physico-chemical Properties of Enveloped and Nonenveloped
Virions
Characteristic Nonenveloped Virus Enveloped Virus
Ultraviolet radiation
Gamma radiation
Thermostability
Susceptibility to ice crystal damage
Sensitive
Sensitive
Thermostable
Yes
Sensitive
Sensitive
Thermolabile
Extensive
Inactivation by lipid solvents
and detergents
No Yes
Determining type of nucleic acid
The type of nucleic acid (either DNA or RNA, but not both for viruses) can be determined by
various specific inhibitors that affect virus replication. Thymidine analogs are a simple method to
determine if the virus contains DNA. 5'-iodo-2'- deoxy uridine (IUDR) (Calbiochem Corp, San Diego,
CA) is commonly used. A simple method is as follows.
1. Prepare maintenance medium with 50 ug/ml IUDR. The media must be homogenized and
sterilized by filtration (Run sterility check on each concentration). Prepare dilutions of virus
with and without IUDR.

52. 52
Note: IUDR goes into solution faster if the pH of the medium is increased. Tighten the cap of the
bottle and place it on a magnetic stirrer preferably at 37 C for approximately 15 minutes.
2. Inoculate preformed monolayers with the appropriate dilutions of the virus being tested. Use
two to three plates per dilution of IUDR.
3. Absorb virus at 37 C for 45 minutes and discard excess fluid into a beaker containing
disinfectant solution.
Figure 3.9. Viral titration in cell culture by counting plaques (holes) in monolayers
4. Add maintenance medium with IUDR to the dishes.
5. Controls should be included using known DNA and RNA viruses. Both samples and known
controls should also be inoculated in regular maintenance medium.
6. Harvest dishes when cytopathogenic effect (Figure 3.9) is observed in controls.
7. Freeze-thaw the dishes three times (The cells can also be sonicated to speed up the process).
8. Titrate pooled controls and all plates where IUDR was used.
9. The virus contains DNA if the titer is 1 logB
10B lower with the analog than without.

53. 53
-1 -2
Determining single or double stranded nucleic acid.
The sensitivity of the virus to actinomycin D can be used to differentiate viruses. Actinomycin
D will prevent transcription of messenger RNA from double stranded nucleic acid. This technique can
be done as follows: 1) Prepare cell culture media with and without Actinomycin D at 1ug/ml; 2) treat
the cells with the drug for two hours before adding the virus; 3) after 48 hours, harvest the virus and
titrate it in cell culture. Compare the titer of the virus with and without Actinomycin D. A reduction
in 1 logB
10B of titer indicates sensitivity to Actinomycin D and that the virus contains double stranded
nucleic acid.
Determining the presence of lipoprotein envelope.
The sensitivity of the virus to lipid solvents correlates with whether it has a lipoprotein
envelope. To determine the presence of the lipoprotein envelope the following procedure can be done
with either of two lipid solvents (ether or chloroform):
1. Dilute virus stock or sample to be tested 1:10 and divide into two aliquots.
2. Add 0.2 ml of CHClB
3B to 2 ml of one aliquot in a 15 ml centrifuge tube or 20% volume of ether.
Dispense 2 ml of the other aliquot into another 15 ml centrifuge tube.
3. Mix both tubes on Vortex for 10 minutes, keeping the tubes in an ice bath between mixes.
4. Allow the solvent to sediment in refrigerator overnight or by centrifuging (1500 rpm for 30
minutes).
5. Set at room temperature undisturbed for one to two minutes. Using a long sterile Pasteur
pipette, collect the clear layer on the top being careful not to pick up any solvent which will
appear cloudy. The top layer which has been collected may be left in an opened vial under the
hood for 10-15 minutes to allow any solvent present to evaporate prior to inoculation. Cap the
vial and refrigerate overnight.
6. Make 10P
P
and 10P
P
dilutions and inoculate undiluted and diluted samples (solvent treated and
non-treated) in macro or micro dishes or in embryos.
Note: Glass equipment should be used because the solvents may react with plastic.
7. Compare the titer or CPE of the viral stocks with and without solvent.
If there is a significant drop in titer of the virus treated with solvent, then it contains a lipoprotein
envelope.

54. 54
P P
Morphology of the Virus Particle
The size and shape are also important criteria for classifying viruses. The best method for
determining the size of a virion is with the electron microscope (Figures 3.6 and 3.7). Determining the
size by membrane filtration is not highly accurate due to virus clumping and occlusion of the membrane
pores with cellular debris. The electron microscope is a valuable tool in virology and produces much
information required to identify and classify a virus: lipoprotein envelope, size, and morphology. The
procedure entails concentration of the virus by ultracentrifugation and resuspension in distilled water.
A drop of virus is dropped on a plastic-coated grid and mixed with a drop of 2% phosphotungstic acid
in distilled water (adjust to pH 6.5 with KOH). Viral concentrations of at least
106
/ml is required to detect virions with this method.
Table 3.3 outlines the characteristics used to differentiate the families of viruses of importance
to avians. After a virus has been classified within a family, it has to be further identified. Serologic
identification is very specific, and techniques such as virus-neutralization, immunoprecipitation,
hemagglutination-inhibition, immunofluorescence, immunoperoxidase, and enzyme-linked
immunosorbent assays are used to identify viruses. The techniques will be discussed later in this book.
http://www.accessexcellence.org/RC/

55. 55
P P
1
Table 3.3 Differentiating Criteria for DNA and RNA viruses that are important in avian
medicine.
I. DNA—Sensitive to thymidine analogs
A. Lipid solvent sensitive
1. More than 200 nm, Herpes virus (Marek's disease virus).
2. Less than 200 nm, Pox virus (Fowl pox virus).
B. Lipid solvent resistant
1. More than 50 nm, Adenovirus (inclusion body hepatitis virus).
II. RNA—Resistant to thymidine analogs
A. Lipid solvent sensitive
1. HA-positive1
a. Sensitive to Actinomycin D,
Orthomyxoviridae (influenza virus)
b. Resists Actinomycin D,
Paramyxoviridae (Newcastle disease virus)
2. HA-negative
a. Sensitive to Actinomycin D,
Retroviridae (Avian Leucosis virus)
b. Resists Actinomycin D, Coronaviridae (infectious bronchitis virus)
B. Lipid Solvent Resistant
1. Sensitive to Actinomycin D, Reoviridae (viral tenosynovitis)
Birnaviridae (infectious bursal disease virus) (figure 3.10).
2. Resists Actinomycin D, Picornaviridae (avian encephalomyelitis virus)
P PHA = Hemagglutination.
Figure 3.10. EM pictures of AIV (left) and IBDV (right) virions

56. 56
Collection and Submission of Specimens
The laboratory diagnosis of clinical illness depends to a large extent upon the kind and condition of
submitted specimens. It also depends upon the practicing veterinarian and laboratory working in close
concert. Because many of the laboratory tests are for specific disease agents, an adequate clinical
history must accompany all submissions. This will permit laboratory staff to perform additional tests if
indicated.
General guidelines for the collection and submission of specimens are presented below. Most
laboratories supply a specimen submission form that should be completed with the available pertinent
information. In the absence of a form, the veterinarian should supply as complete a history as possible.
Veterinarians should contact the diagnostic laboratory if they have any questions.
Animals
Live, sick animals are preferable to dead animals. Whenever possible, animals should be submitted
directly to the diagnostic laboratory for complete necropsy examination. If a herd problem exists, more
than one animal should be submitted. Bus and courier service may be used to ship small birds,
provided they are packaged in leak-proof insulated containers with sufficient ice or cold packs. Do not
freeze animals submitted for necropsy.
Tissues
To minimize contamination during necropsy, it is best to collect a routine set of tissues prior to
thorough examination. Recommended tissues are lung, kidney, liver, spleen, small intestine, large
intestine, and mesenteric lymph nodes. Brain tissue or head should also be collected if central nervous
system disease is suspected. Other tissues containing abnormalities noted during the thorough
examination should also be collected. A portion of these tissues should be placed in leak proof plastic
bags and placed under refrigeration. While it is recommended that each tissue be placed in a separate
bag, it is absolutely essential that intestine be separated from other tissues; otherwise bacteriologic
examinations will be compromised.
Tissues should be brought directly to the laboratory, or shipped under refrigeration by over-night mail,
bus, or courier service. Tissues collected during the latter part of the week should be frozen and shipped
on Monday. Since many viruses produce characteristic microscopic lesions, small pieces (1/4 inch
thick) of each tissue should be placed in ten percent buffered formalin for histopathologic
examination. An entire longitudinal half of the brain should be submitted. These samples should not be
frozen.

57. 57
Feces
Feces should be collected from acutely ill animals and placed in leak proof containers. While well-
saturated swabs are adequate for many individual virologic examinations, several milliliters or grams
of feces permit a more complete diagnostic work-up including bacteriologic and parasitologic
examinations. Samples should be submitted to the laboratory using cold packs as coolant.
Swabs
Nasal and ocular swabs are useful for isolating viruses from animals with upper respiratory-tract
infections. Genital infections may also be diagnosed by examining swabs collected from the
reproductive tract. These swabs should be collected from acutely ill animals and placed directly into
screw-capped tubes containing a viral transport medium. The sampling of several animals in different
stages of the illness increases the likelihood of isolating the causative agent. Swabs are also useful for
the sampling of vesicular lesions. Fresh vesicles should be ruptured and the swab saturated with the
exuding fluid. Two swabs should be collected, one for virus isolation and one for electron microscopy.
The swab for virus isolation should be placed in viral transport medium and the swab for electron
microscopy should be placed in a screw-capped tube containing one or two drops of distilled water.
Scab material from the more advanced lesions should also be submitted. There are several
commercially available viral transport media that help maintain the viability of viruses during
shipment to the laboratory. Most of these transport media are balanced salt solutions containing high
protein content and antibiotics to prevent bacterial overgrowth. Many diagnostic laboratories provide
their own version of transport medium to practicing veterinarians upon request.
Slides
A number of infectious diseases can be diagnosed by examining slides prepared from blood and tissues.
Blood smears and conjunctival scrapings are used for diagnosing viral diseases. Conjunctival scrapings
are particularly useful for diagnosing herpesvirus and chlamydial infections. Imprints made from liver,
spleen, and lungs are especially useful for diagnosing Chlamydia and herpesvirus infections of
psittacine birds.
Slides should have sufficient cells to allow thorough examination but should not be so thick as to cause
difficulty in staining. A conjunctival scraper or some other device (blunt end of scalpel blade) should
be used to scrape the conjunctiva; cotton swabs are not adequate. Matted eyes should be cleaned and
flushed prior to scraping the conjunctiva. Tissue imprints should be made by lightly touching the
microscope slide with fresh cuts of tissue previously blotted with a paper towel to absorb some of the
blood. Slides should be air-dried and sent to the laboratory in slide holders to prevent breakage.
Several slides permit a more thorough diagnostic work-up, including cytologic examinations.

58. 58
Serum
Blood samples should be collected in sterile tubes containing no anticoagulants. These should be
submitted to the laboratory in specially designed Styrofoam holders to avoid breakage. Blood samples
should not be frozen or allowed to overheat. If samples cannot be delivered to the laboratory within a
reasonable time, serum should be refrigerated.
Figure 3.11. EM scope
Concentration and Purification of Viruses
Once a virus has been adequately propagated, it needs to be recovered from host cells and debris and
purified. This is accomplished by a number of processes that involve differential centrifugation (various
speeds), dialysis, precipitations, chromatography and density gradients. The initial step of this process
is differential centrifugation; a slow speed (~2,000 x g) is used to remove large cellular debris. This is
followed by high-speed centrifugation (40K to 80K x g) to concentrate the virus for small volumes; by
dialysis and precipitation for larger volumes; and by cold (-70°C) methanol or polyethylene-glycol
precipitation, also for large volumes. Purification is achieved through chromatography and
centrifugation through density gradients. Enveloped viruses can be purified by velocity sedimentation
through sucrose gradients. Nonenveloped viruses can be purified by centrifugation through cesium
chloride gradients and viewed with the EM scope (figure 3.11).
Infectivity and Storage
Infectivity
Infectivity is a virus particle’s ability to infect a host cell. The temperature outside of a host cell readily
affects the virus’ ability to retain its infectivity, particularly in the case of enveloped viruses. As
viruses have no metabolic activity of their own, infectivity is the best means to evaluate the integrity of
the viral particle following exposure at a particular temperature.
The following are important considerations:
• At 60°C, infectivity of the virus will decrease rapidly within seconds.
• At 37°C, infectivity will decrease dramatically within minutes.
• At 20°C, infectivity decreases within hours.

59. 59
• Infectivity at the above temperatures influences viral spread by direct contact (at 37°C) and by
fomites (at 20°C).
• At 4°C, infectivity in tissues is lost over days. Clinicians should keep this in mind regarding
clinical specimens.
Temperatures below freezing are often used for long-term storage. The important consideration is
keeping ice crystal formation to a minimum.
It should be kept in mind that viruses vary greatly in their resistance and lability. Some are able to
survive for hours, days, and even months under environmental conditions, while others are inactivated
in a few minutes under similar conditions.
The three principal methods of storing viruses are:
• Freezing at 70°C with or without a cryopreservative.
• For long term storage, freezing in liquid nitrogen (-196°C).
• Lyophilizing or freeze drying with storage in a freezer or at room temperature.
Virus Visualization
The two major methods mainly used to visualize the structure/morphology of viruses are electron
microscopy and atomic force microscopy. Other types of microscopy are used to observe changes
induced by virus replication in virus-infected cells. Without a means to visualize viruses, it is difficult to
obtain information about structure or virus-cell interactions. Furthermore, being able to visualize viral
particles allows one to estimate the number of particles present in a suspension directly. There are other
methods that allow one to estimate the number of viruses indirectly. In either case, direct or indirect,
enumeration quantification is always an estimate of numbers. This estimate is important when preparing
vaccines, when determining the minimum number of virions required to produce disease,
and in viral research procedures.
Light Microscopy
While the light microscope is not useful for the direct examination of viruses (except poxviruses), it is
useful for observing the effects of viral infection on the host cell. The virus-caused cell damage or
destruction is referred to as the cytopathic effect (CPE). Observable cytopathic effects include:
1. Cells rounded up and aggregated in grape-like clusters, as with adenoviruses;
2. Cells round up, shrink, and lyse, leaving large amounts of cellular debris, as with enteroviruses;
3. Cells become swollen and round up in focal areas, as with herpesviruses; and
4. Cells fuse producing multinucleate cells (syncythia), as with paramyxoviruses.
Additionally, inclusion bodies, characteristic of some viruses, can be visualized.

60. 60
Fluorescence Microscopy
Fluorescence microscopy can be used to visualize virus-infected cells or tissues using virus antigen-
specific fluorochrome tagged antibody. The antibody binds specifically to virus antigens within the cells
or tissues and thus labels them with a fluorescent tag (usually fluorescein). The fluorescent tag is then
visualized with a UV microscope that excites the fluorochrome, which one sees as a colored focus with
a relatively dark background. Alternatively, visualization can be performed indirectly by using
unlabeled antibodies (as found in convalescent serum) followed by fluorochrome labeled antibodies that
bind the first antibody. Fluorescent antibody based assays are commonly used in viral diagnosis and
research.
Electron Microscopy
Electron microscopy involves the acceleration of electrons to high energy and magnetically focusing
them into the sample. The high-energy electrons have very short wavelengths and thus provide better
resolution of very small structures. Electron microscopy has enough resolution power to visualize large
polymers, such as DNA, RNA, and large proteins.
To facilitate visualization, samples may be coated with heavy metals, such as osmium, prior to
examination by electron microscopy. The electrons hit the heavy metals, which are then visualized on
a fluorescent screen. Electron microscopy yields 3-dimensional images of virions and their localization
within the host cell (nuclear or cytoplasmic) at a given point in time following infection. As the samples
are treated with heavy metals, observing virions within live cells is not possible.
Atomic Force Microscopy
The atomic force microscope works by measuring a local property (such as height, optical absorption,
magnetism, etc.) with a probe placed very close to the sample. This makes it possible to take
measurements over a small area of the sample. Electrons are able to "tunnel" between atoms, resulting
in a small, but measurable force. The result of these measurements is a detailed contour map of the
surface of a structure.
The advantages of atomic force microscopy are minimal sample preparation and use on living
specimen. This method has been useful for detailed images of capsid structures and virus-cell
interactions.
Immunoelectron Microscopy
This technique allows the visualization of antibody/antigen complexes that are specific to a particular
virus. In this method, ultra thin sections are cut and incubated with antibody that is specific for the
virus. Following a washing step, the section is incubated with Protein A conjugated gold particles (size
range is 5 to 20 nm). The Protein A gold particles bind to the Fc portion of the antibody and are
detected by electron microscopy.
Radioimmunoassay
Use: To detect antigen or antibody.
Nowadays, radioimmunoassay systems are rarely used in veterinary diagnostic laboratories. There
are two basic radioimmunoassay(RIA) systems, liquid phase and solid phase. In the liquid

61. 61
phase system, the antigen-antibody complexes are precipitated by subsequent addition of anti-
gammaglobulin. The precipitate is collected by centrifugation and dried. The amount of radioactivity
in the precipitate compared to the total radioactivity is a quantitative measure of the antigen-antibody
reaction. The labeling is done with 125
I (see Immunodiffusion), and anyone of the three components
can be labeled.
In the solid phase system, the antibody is coated to the inside of a polystyrene tube and then reacted
with antigen. Briefly, the specimen is added to a polystyrene tube previously coated with antiviral
antibody. If the antigen is present, it attaches to the bound antibody. Following rinsing, 125
I labeled
antiviral antibody is added, which reacts with the complex giving a "sandwich effect". The tube is
washed and the amount of radioactivity is determined. While the aforementioned techniques of antigen
detection are used as the first approach to viral diagnosis, in many instances these techniques are not
applicable because appropriate specimens are often not obtainable from live animals. Also, rapid
antigen detection systems are not available for numerous viral diseases. In these instances, virus
isolation is attempted.
Direct Enumeration of Viruses
Estimating the number of viruses has a number of important uses including research and vaccine
production. Electron microscopy is used for the enumeration of viral particles in a cell free solution. A
known volume of sample is examined and the number of virions counted. This number is then used to
estimate the number of viruses. One limitation is that empty capsids, thus non-infective particles, are
also counted. In research, the number of infectious particles and the total number are compared and
establish a ratio of total particles/infectious particles for a given virus.
Indirect Enumeration of Viruses
Indirect methods of viral enumeration are those that utilize factors associated with infectivity
(biological activity). The three principal methods used to indirectly assess viral concentrations are
hemagglutination assays, plaque forming assays, and the limiting dilution method.
Hemagglutination
This assay is based upon the property of many enveloped viruses to agglutinate red blood cells
(RBCs).
The assay is carried out by adding red cells to dilutions of the virus sample in a microtiter plate, then
observing for hemagglutination. It takes many viruses to coat RBCs and result in hemagglutination.
For example, it takes approximately 104
influenza virions per hemagglutination unit (HA unit). An HA
unit is defined as the highest dilution of the viral sample that causes complete hemagglutination.
Hemagglutination is useful in the concentration and purification of some viruses, and as a rapid
presumptive test for the presence of these viruses in fluids from infected cell cultures and chicken
embryos. It is especially useful for assaying viral activity of cell cultures infected with
hemagglutinating viruses that produce little or no discernible cytopathic effect (CPE). Clinical
specimens such as feces can also be directly examined for hemagglutinating activity of particular

62. 62
viruses (discussed further in Chapter 7). Similar type assays that test for enzyme activity of a particular
virus (such as one producing reverse transcriptase) can be performed in a similar manner.
Plaque Forming Assay
This assay involves the inoculation of susceptible host cells with virus and using their biological
activity to estimate the number of virions present. In the procedure, ten-fold serial dilutions of virus
sample are used to inoculate monolayers of host cells. Following incubation to allow the virions to
adsorb to the surface of the host cells, the monolayer is overlaid with a gel composed of host cell
medium and agarose. The presence of the agar prevents viral spread in the culture of host cells on a
large scale, but allows localized cell-to-cell spread. With cytopathic viruses, host cell destruction results
in the development of clear zones called plaques, which can be visualized within 24 to 72 hours of
incubation. A calculation involving the number of plaques observed, the dilution factor of the sample,
and the volume of sample dilution used, yields the plaque forming units (PFU) per milliliter of sample.
The Limiting Dilution Method
This titration-based assay measures an effect on cells in vitro, such as CPE, when exposed to various
dilutions of a virus-containing solution. If possible, a known concentration of reference virus culture is
used as a positive control. Depending upon the virus, either two-fold or ten-fold serial dilutions of the
viral material are made and placed with the cells. The infectivity titer (reciprocal of the highest dilution
showing 50% CPE of the infected cultures) is expressed as the TCID50/ml (tissue culture infectious
dose). This assay may be used with cultured cells, embryonated eggs or even in laboratory animals.
Miscellaneous Methods Used for Characterization
There are some methods used in virology that are helpful in the identification and classification of an
unknown virus. Some of the techniques will be briefly mentioned here, but explained in greater detail
later if they are used in the laboratory diagnosis of a particular virus.
Sensitivity to Lipid Solvents
The sensitivity of viruses to lipid solvents, such as chloroform and ether, aids in the taxonomy of some
viruses. Any viruses that possess a membranous outer envelope are susceptible to lipid solvents. All
enveloped animal viruses, except some poxviruses, are ether sensitive.
Identification of Nucleic Acid Type
This is performed by examining nucleic acid synthesis in cell cultures in the presence of DNA
synthesis inhibitors, such as 5-bromo-2-deoxyuridine (BRU). If viral synthesis is inhibited, then virus
multiplication will likewise be decreased. In the event that virus growth is not inhibited, the virus is
presumed to contain RNA.

63. 63
Restriction Enzyme Analysis
Restriction enzymes (RE) are endonucleases that cut double-stranded DNA at specific recognition sites,
ranging from four to eight base pair palindromic sequences. Restriction endonuclease analysis is
particularly useful in the "subserotypic" classification of viruses, in the differentiation of modified-live
virus of vaccines from virulent virus, and in the epidemiologic tracking of disease outbreaks.
Procedurally, the method entails treating viral DNA with one or more REs, and then separating the
resulting fragments according to size by polyacrylamide gel electrophoresis. RNA viruses can be
similarly analyzed by first making a complementary DNA (cDNA) strand from the RNA using the
enzyme reverse transcriptase, and then amplifying this cDNA by the PCR method described later in this
publication.
Hemadsorption
Membrane-bound viruses such as orthomyxoviruses and paramyxoviruses obtain their outer envelope
by budding through the cell membrane. Prior to budding, viral coded proteins (hemagglutinins) are
incorporated into the cell membrane. Such cells will adsorb erythrocytes to their surfaces, and the
resulting foci of hemadsorption can be detected microscopically.
Immunological Methods
Animals infected with viruses respond by producing specific antibodies. Detection and measurement
of these antibodies, which reflect disease status, are useful in planning herd health programs and
studying the epidemiology of disease outbreaks.
While detection of antibodies is also useful in disease diagnosis, it is often a time-consuming process
requiring the comparative measurements of antibody in acute and convalescent sera, usually collected
10 to 14 days apart. A more rapid approach is to use specific antiviral antibodies to detect viral
antigens directly in clinical specimens. These antibodies are usually obtained by hyperimmunizing
rabbits or goats with a specific virus. Alternatively, monoclonal antibodies may be used, if available.
Monoclonal antibodies (mAbs) are prepared in mice by first exposing the mouse to the viral antigen,
which sensitizes B cells of the spleen. These cells are collected and chemically fused with a mouse
plasmocytoma cell line that secretes IgG. These hybrid cells are then cloned and the resulting
hybridomas, which are derived from a single cell, are analyzed for secretion of the specific antiviral
IgG. Selected hybridoma cells are injected back into mice intraperitoneally, where the cells grow
rapidly, and cause an accumulation of ascitic fluid containing a high concentration of mAb.
Monoclonal antibodies are particularly useful in typing and subtyping viruses. When coupled to a
fluorochrome, mAbs are widely used for the detection of viruses in tissues. They are also used in a
number of commercial ELISAs for identification of viruses.

64. 64
References
Lukert, P.D., 1989. "Virus Identification and Classification." In A Laboratory Manual for the isolation
and Identification of Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque, Iowa. pp.
182-185.
Schatt, K.A. and H.G. Purchase, 1989. "Cell-Culture Methods." In a Laboratory Manual for the
Isolation and Identification of Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque,
Iowa. pp. 167-177.
Senne, D.A., 1989. "Virus Propagation in Embryonating Eggs." In a Laboratory Manual for the
Isolation and Identification of Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque,
Iowa, pp. 176-181.
Villegas, P., 1986. "Cultivation of Viruses in Chicken Embryos." In A Laboratory Manual
of Avian Diseases. University of Georgia, Athens, GA. pp. 1-5.
UTable of Contents

65. 65
B. Serologic Procedures
Serology is the science of using or detecting antibody in the fluids of animals. Antibodies are
made up of immunoglobulins (Ig). Various serologic tests may utilize IgG, IgM or IgA in such fluids
as tracheal washes, egg yolk, or serum. Serological monitoring is an important tool for detecting the
presence of disease agents in poultry flocks. It is also useful for determining the immune status of
poultry flocks. A serological test procedure offers a rapid and economical method for disease
diagnosis.
©1998 by Alberts, Bray, Johnson, Lewis, Raff, Roberts, Walter.
http://www.garlandscience.com/ECB/about.html

66. 66
©1998 by Alberts, Bray, Johnson, Lewis, Raff, Roberts, Walter.
http://www.garlandscience.com/ECB/about.html

67. 67
©1998 by Alberts, Bray, Johnson, Lewis, Raff, Roberts, Walter.
http://www.garlandscience.com/ECB/about.html
The presence of antibodies in the serum of birds, following a disease outbreak or vaccination,
can give assurance that a certain disease did occur or that a vaccination procedure did have an effect.
The presence of maternal antibody usually is desirable, and its detection and quantification are
important in determining the timing of early vaccination procedures — another reason for serological
testing.
Techniques for detection of antibody have evolved from procedures used primarily in the
research laboratory. These have been developed to the point where many now are high automated and
performed routinely in laboratories. Veterinarians, production managers, servicemen and growers
have come to depend heavily on serological test procedures for important decisions on clean-up,
depopulation and vaccine use.
Many such testing procedures are slow and time-consuming. The increased demand for
serological testing, because of the valuable information it provides, has caused considerable interest in
the development of new testing procedures which are reliable, rapid and economical.

68. 68
Serological procedures are either qualitative or quantitative. The agar gel precipitin (AGP) test,
for all practical purposes, is an example of a qualitative technique. There are several disease agents
for which AGP test procedures are available. This type of test, however, only confirms the presence or
absence of antibody. A quantitative AGP test can be done by preparing dilutions of the antibody in
question.
Most serological procedures involve the determination of a titer, and are quantitative in nature.
In titer methods, serum is serially diluted to a point (titer) where antibody no longer can be detected.
Titers usually are expressed either as the dilution (expressed as a ratio, i.e. 1:64), or as the reciprocal of
dilution (i.e. 64).
The concept of titer, or end point dilution, is easily and widely understood by veterinarians and
poultry disease experts alike. A high titer is synonymous with disease or possibly with immunity,
depending on the type and method of vaccination. Spray vaccination and inactivated (killed virus)
vaccines usually produce high titers.
Examples of quantitative serological tests include virus neutralization (VN), using eggs or cell
culture; hemagglutination inhibition (HI), and enzyme-linked immunosorbent assay (ELISA). Virus
neutralization is a good technique, but it takes three to seven days to obtain results, and bacterial
contamination frequently is a problem when serum samples are not collected aseptically.
Bacterial and viral agents that hemagglutinate lend themselves to the HI test. This is an
excellent procedure that can be performed quickly and economically, but standardize reagents are not
available and therefore, results may vary widely from the same sample done by different laboratories.
Another problem is that all agents do not hemagglutinate. Agglutination, and specifically micro-
agglutination tests, can be performed for many bacteria, but the test is not very sensitive. Viruses are
not large enough to be used in agglutination procedures. Antigens must be large enough to be visible
in order to detect agglutination when and if it appears.
Regardless of the type of serologic test employed, large-scale testing programs present a series
of problems associated with serum samples. These problems relate to the need for trained personnel
plus materials and equipment for collection, processing, field storage, and transport of large numbers of
sera. The result is increased cost of programs. Two alternative sources for obtaining antibody include
egg yolk and whole chicken blood dried on filter paper for certain routine serotests. Problems
associated with conventional serum samples can be avoided with these methods. For egg yolk, the
yolk can be diluted 1:10 In PBS. For whole blood a more detailed method is described.
Filter paper from Scleicher and Schuall, Inc. Keene, NH, #740 is cut in strips approximately ½ X
8 inches, and three strips are overlapped in the middle and stapled together. The cluster of three strips
can be used to collect six samples because blood can be collected on both ends of each strip. Individual
birds or flocks can be identified on each strip. Whole blood sample is collected on the filter paper from
a small pool of blood formed on the wing surface after puncture of a wing vein with a sharp object. The
end (½ to 3/4 inch) of each strip is saturated with blood and complete saturation evidenced by equal
blood staining on both surfaces. Partially clotted blood should not be collected.

69. 69
Samples should then be allowed to dry for at least 30 minutes at room temperature or with a
suitable warm air source. Dried blood samples should then be sealed in plastic bags. If the serum
samples are to be examined by the ELISA test, then they need not be refrigerated and can be sent
unrefrigerated by regular mail to a lab. If sera are to be tested for neutralizing antibodies, then the
paper samples should be refrigerated. A portable cooler is ideally suited for this purpose when in the
field.
Once samples reach a lab, a standard 4.8 mm-diameter paper punch (Gem Paper Punch, McGill
Metal Products C., Marengo, IL) can be used to cut two disks from each sample. These disks are
punched directly into one well of a 96-well microplate. After the disks are punched, phosphate buffered
saline for the ELISA or cell culture media and antibiotics for the VN test are added to individual
samples with a 200-ul pipette or (Medical Laboratory Automation, Inc., Mount Vernon, N.Y.) to rows
of 12 samples with a multispenser (Dynatech Lab., Inc., Alexandria, VA.). Samples
plus diluent are then agitated for about one hour on a shaker and then stored overnight in a refrigerator
for complete elution of the sera from the disks. Disk color is the criterion used to assure complete
elution. The color of completely eluted disks is uniformly light, whereas the color of incompletely
eluted disks is darker in the center than at the periphery.
After complete elution, the samples can have complement inactivated by incubation at 56 C
for 30 minutes. The samples are then ready to be transferred into the first well for ELISA or
neutralization testing. Comparing results from testing of serum from whole bloods taken with a
syringe versus collected by elution from dried blood on paper strips, will be similar. Generally titers
obtained from dry blood will be about 1:10 that of the conventional method.
The simplicity, economy, and reproductability of the dried blood collection and processing
method make large scale serotesting more feasible. In addition, samples may be collected by persons
with little training and experience and can be held for long periods of time before testing. Poultry
servicemen can collect samples from flocks and eliminate the need for blood-collection crews.
Arrangement of paper strips in clusters eliminates the need for a sample carrier or support, and sample
identification can be written directly on the strip.
The one limitation of this technique is the initial dilution factor (1:10) introduced by elution of
the sample. This becomes a problem for the NDV-Hl test when using eight or 10 HA units. The
lowest Hl titer that can be tested would be 1:10 x 8 HA units or 1:80. This would be a problem
especially for young poultry vaccinated for the first time. It is not uncommon for young vaccinated
birds to have titers of less than 1:80, yet they are resistant to challenge. In such cases, testing of
circulating antibodies would be of limited value since their immunity probably resides in local sites
(i.e. Harderian gland or upper respiratory tract) or is cell-mediated.

70. 70
Latex Agglutination (LA)
Use: To detect antigen or antibody.
LA tests are similar in principle to bacterial agglutination in that latex particles coated with antibody
will agglutinate when mixed with the corresponding antigen and thus identifying it.
Conversely, the latex particles can be coated with antigens and used to detect antibody. These tests are
easy to perform and provide results within minutes. Commercial kits for "in office" use are available
for the detection of antibody to some diseases and for detection of some viruses.
Immunoelectron Microscopy
Use: To demonstrate and identify viruses.
The negative staining technique of electron microscopy referred to earlier for the demonstration of
viruses is also useful for identification. The virus is reacted with immune serum, resulting in clumping
that can be seen when viewed under the electron microscope.
Complement Fixation Test
Use: To detect and measure antibody.
Complement fixation (CF) tests are most useful as an aid in the diagnosis of acute or recent viral
infections, because they primarily detect IgM, the first immunoglobulin class to respond to infection.
The test entails the use of viral antigens, guinea pig complement, and an indicator system of
"sensitized" sheep RBCs. Reacting with antibody directed against them sensitizes the sheep RBCs. This
anti-sheep RBC antibody is referred to as hemolysin and is prepared in rabbits. The antigen and
complement are each titrated and diluted. If no specific antibodies are present in the serum being tested,
the complement is free to react with the sensitized RBCs, causing lysis. If sufficient antibody is present,
the specific antigen-antibody complexes will have bound the complement and no lysis of the
RBCs will occur.

71. 71
References
Skeeles, K., 1985. ELISA's Role in Serological Monitoring of Poultry Flocks. Vineland Update, No.
12, March. Vineland, N.J.
UTable of ContentsU

72. 72
IMMUNODIFFUSION
These tests are routinely used to demonstrate the presence of antibodies against adenovirus or
avian influenza in sera, or the presence of viral antigens such as infectious bursal disease, or reoviruses
in concentrated cell culture or embryo fluids. The most common technique is the two-dimensional
double diffusion procedure, in which both antigen and antibodies diffuse toward each other from
separate wells in agar in a petri dish or glass slide (Figure 1.0). This double-diffusion test is known as
agar gel precipitin (AGP) or double immunodiffusion (DID) tests.
Figure 1.0. AGPT
A typical AGP test is as follows.
1. Prepare agar gel plates:
NaCl 8% (8 gm)
Noble Agar* 0.7% (0.7 gm)
0.1 M PBS pH 7.2 10 ml
1% Thimerosal 1 ml
Polyethylene Glycol (6000 MW) 2 gm
Distilled Water 89 ml
Autoclave for 10 minutes and pour into small (35 mm) tissue culture plates (2 ml per plate).
After the agar has cooled, punch holes with a commercial puncher.

73. 73
2. Place antigen in the center well and serum samples in outer wells or vice versa. Always
include a known positive control. Do not overfill the wells.
3. Place in moisture chamber at room temperature and check for precipitation daily.
4. The antigen and specific antiserum should form a band of precipitation (tiny white line). If the
unknown sera samples contain antibodies specific for the antigen in center well, a band should
also be present.
Note: The test can also be run using regular glass slides. The agar is poured on the slide and the holes
are punched. Humidity must be high in the chamber to avoid desiccation of the agar.
*The agar can also be prepared using purified agar or ionagar #2.
Figure 1.0. AGPT test for mycoplasma
References
Villegas, P., 1986. "Immunodiffusion." In Laboratory Manual, Avian Virus Diseases. University of
Georgia Press, Athens, GA. pp. 13.
UTable of ContentsU

74. 74
AGGLUTINATION
The clumping or agglutination of bacteria by antibody is a relatively simple and older
technique. The tests are routinely done on breeder or layer flocks for Salmonella and Mycoplasma.
The serum plate or slide test is used as an initial screening test. If the serum agglutinates the stained
antigen, the bird had been exposed to the organism. Standardized agglutination reagents are available
for the previously mentioned organisms. These tests can be done as rapid whole-blood, standard
macroscopic tube, microagglutination or microantiglobulin tests.
The rapid whole-blood test is the most widely used for detecting S. pullorum and S. gallinarum
infected chickens. In this test a drop of crystal-violet-stained pullorum polyvalent K antigen is mixed
on a glass or plastic plate with a loopful of whole blood. The plate is rocked for 2 minutes and results
read. If there is visible clumping of the antigen, the sample is positive. If the antigen-blood mixture
remains clear the sample is negative.
References Mallison, E.T. and G.H. Snoeyenbos, 1989. "Salmonellosis." In A Laboratory Manual
for the Isolation and Identification of Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque, Iowa.
pp. 3-11.
UTable of ContentsU

75. 75
HEMAGGLUTINATION-INHIBITION (HI)
This test is a rapid, sensitive serologic method for determining antibody against Newcastle
disease (ND), infectious bronchitis (IB), avian influence (AI) and adenoviruses, as well as Mycoplasma
gallisepticum and M. synoviae. In order for this test to be used the organism in question must have the
ability to agglutinate red blood cells (hemagglutination). The inhibition or blocking of hemagglutination
(HA) of red blood cells by antibody specific for an organism is the basis for this test. The simplicity,
ease and the fact that it doesn't require expensive equipment are its main advantages. The major
disadvantage is that the preparation and quantitation of HA antigen and procedures for running the HI
test vary among laboratories, resulting in nonuniformity of results for the same sample obtained from
different laboratories.
The basic reagents in the test are the HA antigen (microorganism), serum diluted two-fold in a
saline solution and erythrocyte suspension. The test is usually done in 96 well microtiter plates with
micro diluters and pipettors. The constant-antigen, diluted-serum (Beta technique) is most often used.
The antigen is first prepared and titrated in saline and incubated with erythrocytes for HA activity. The
antigen is then serially diluted in saline and used as a constant amount in the HI test. The amount of HA
units depends on the microorganism. In the HI test, the serum, after having the complement activity
destroyed, is serially diluted in saline and incubated with a constant amount of antigen. The
erythrocytes are then added and the test incubated. Some viruses such as NDV and AI produce an
enzyme, neuraminidase, which can cleave the hemagglutinin causing the virus and red blood cells to
detach after one hour. Therefore, both the HA and HI test must be read within one hour or false results
will occur.
Collection and preparation of chicken red blood cells (RBC's)
1. Use a sterile syringe and needle. For chickens older than 5 weeks, it is advisable to use a 20
gauge, 1 ½" needle.
2. Use Alsever's solution as anticoagulant. Draw the Alsevier’s solution to approximately half the
total syringe volume.
3. Using 3-5 known SPF birds which have never been exposed to or vaccinated with the organism
you are testing for, draw blood to fill the syringe. Mix well but gently.
4. Dispense into clean graduated centrifuge tube. Centrifuge at about 1,500 RPM's (revolutions
per minute) for 5 minutes. Remove and discard the supernatant.
5. Resuspend the RBC's to the original volume using phosphate buffer saline (PBS) solution. Mix
well and centrifuge again. Repeat this procedure approximately 3 times.
6. After the last washing, resuspend the RBC's in buffer solution to make a 5% stock solution.
7. Refrigerated RBC's should be good for approximately one week.

76. 76
Preparation of Newcastle disease virus (NDV) antigen for HI tests
3 5
1. Inoculate 9-12-day-old embryonating chicken eggs via the allantoic cavity with 10P
P
to 10P
P
ELDB
50B's of NDV and incubate at 37 C.
2. Discard embryos dying within 24 hours post-inoculation.
3. Collect dead eggs and refrigerator for 4 hours when embryo mortality reaches 10 to 30%.
4. Harvest and pool the allantoic fluids (AF), but discard any fluids inadvertently contaminated
with RBC.
5. Clarify AF by low speed centrifugation for 10 minutes.
Antigen production for the hemagglutination inhibition (HI) test for infectious bronchitis
3 5
1. Dilute the strain of infectious bronchitis virus (IBV) appropriately (10P
P
to 10P
P
) according to its
titer in Hanks balance salt solution.
2. Inoculate 9-11 day chick embryos with 0.1 ml diluted virus.
3. Incubate inoculated embryos, candle and discard dead at 24 hours.
4. Remove embryos from incubator 30-48 hours post-inoculation and place in refrigerator (4 C)
overnight for a minimum of 3 hours.
From this point on, handle allantoic fluid or antigen preparation on ice.
5. Collect allantoic fluid (AF) as free from red blood cells as possible.
6. Centrifuge AF at 1500 rpm for 30 minutes to remove red blood cells and debris, decant and
save supernatant. Note how many ml of AF you have.
7. Concentrate virus by pelleting at 30,000 G for 90 minutes and discard supernatant.
8. Resuspend virus pellet in HEPES buffer at pH 6.5 by adding 1 ml per 100 ml of AF prior to
centrifugation.
9. Add an equal volume of phospholipase C (Sigma Chemical) with 1 unit/ml diluted from
concentrate in HEPES buffer. The enzyme exposes the hemagglutinin on the viral surface.
10. Mix until the fluid is in a uniform suspension.
11. Incubate 2 hours at 37 C, vortexing every 30 min.

77. 77
st st
st
st
12. Storage: The antigen is stable at 4 C for 2 months. Repeated freeze-thawing adversely
affects antigen titer.
The antigen must be titrated before use.
Hemagglutination (HA) Determination
1. Add 50ul of PBS to each well of 96 well microtiter plates.
2. Add 50ul of antigen to first well and test antigen undiluted and at a 1:5 dilution.
3. Make serial two fold dilutions of the antigen.
4. Fill each well with 50ul of 0.5% RBC.
5. Seal each plate with saran wrap and incubate at room temperature for 30-40 min.
6. The titer of the antigen is the last dilution of antigen showing agglutination of red blood cells
(lacy circular pattern).
7. The HA titer is equal to 1 HA unit.
Hemagglutination Inhibition Test
1. Make dilution of antigen to yield 8 HA units.
2. Add 50ul of working antigen to all wells except rows A and B. Add PBS in these rows instead.
3. Add 50ul PBS in the 1P
P
wells of rows A and B, and working antigen on 1P
P
well of C and D.
4. Add 50ul of positive test sera in 1P
P
wells of rows E, F and G.
5. Add 50ul of negative test sera in 1P P well of row H.
6. Make serial two fold dilutions in all wells.
7. Cover plates with saran wrap.
8. Incubate at 37 C for one hour.
9. Fill each well with 50ul of 0.5% RBC.
10. Incubate at room temperature for 30-40 min.

78. 78
11. The HI titer of the serum is computed by multiplying the reciprocal of the serum titer, last
serum dilution showing no hemagglutination (button formation), by the number of HA units
used in the test (8 HA units) (Figure 3.0).
Figure 3.0. HI test for NDV (wells A-E are positive in rows 8+9)
References
Beard, C.W., 1989. "Serologic Procedures." In A Laboratory Manual for the Isolation and
Identification of Avian Pathogens. Kendall/Hunt Publishing, Co., Dubuque, Iowa. pp. 192-
200.
Villegas, P., 1986. "Collection and Preparation of Chicken Red Blood Cells." Preparation of
Newcastle disease virus antigen for HI tests." Antigen Production for the Hemagglutination
Inhibition (HI) test in Infectious Bronchitis." In Laboratory Manual: Avian Diseases.
University of Georgia, Athens, GA. pp. 14-19.
UTable of ContentsU

79. 79
IMMUNOFLUORESCENCE
Antigens or antibodies can be labeled with fluorochromes. These labeled reagents, when
exposed to a specific wavelength of light, will give off a detectable color. Immunofluorescence is
most often used to detect the presence of microbes in tissues or cell cultures, but can be used to detect
antibody in serum or antibody secreting cell culture fluids.
Detecting fluorochrome-labeled reagents
To detect fluorochrome-labeled reagents, a specially equipped microscope is required. To
detect low levels of fluorescence commonly produced in cell staining experiments, the microscope
must have epifluorescence in which the exciting radiation is transmitted through the objective lens onto
the surface of the specimen. Absorbing radiation of the appropriate wavelength causes electrons of the
fluorochrome to be raised to a higher energy level. As these electrons return to their ground state, light
of a characteristic wavelength is emitted. This emitted light produces the fluorescent image seen in the
microscope. Individual fluorochromes have characteristic excitation and emission spectra. Filters are
used to ensure that the specimen is irradiated only with light at the correct wavelength for excitation.
By placing a second set of filters in the viewing light path that only transmit light of the wavelength
emitted by the fluorochrome, images are formed only by the emitted light. This produces a black
background and a high-resolution image.
Because some fluorochromes have emission spectra that do not overlap, two fluorochromes can
be observed on the same sample. This allows the study of two different antigens in the same specimen
even when they have identical subcellular distributions.
The most commonly used fluorochromes are fluorescein and rhodamine. They are normally
available as isothiocynate derivatives. They can be conjugated to anti-immunoglobulin antibodies,
protein A, protein G, avidin, or streptavidin. These conjugates are available from many commercial
sources or can be prepared in your laboratory. Filter sets are commercially available that will permit
independent observation of these two fluorochromes in the same sample from Sigma Chemical Co.
Rhodamine requires an excitation wavelength of 552 and emission wavelength of 5% and produces a
red color. Fluorescein needs an excitation wavelength of 495 and produces an emission wavelength of
525 and a green color.
Fluorescence detection is not compatible with histochemical stains, because the components of
these stain autofluoresce. Fluorescence detection is not compatible with enzyme detection systems,
because the deposition of insoluble compounds after enzyme detection will block the emission of light
from the fluorochrome.
Isothiocyanate labeling
Both fluorescein and rhodamine isothiocyanate derivatives are available for coupling reactions.
The major problem encountered is either over- or undercoupling, but the level of conjugation can be
determined by absorbance readings.

80. 80
1. Prior to the coupling, prepare a gel filtration column to separate the labeled antibody from the
free fluorochrome after the completion of the reaction. Use a gel matrix with an exclusion limit
of 20,000-50,000 for globular proteins. Use fine-sized beads (approximately 50 m in
diameter).
To determine the size of the column, multiply the volume of the reaction by 20. Prepare a
column of this size according to the manufacturer's instructions (swelling, et.).
Equilibrate the column in PBS. Allow the column to run until the buffer level drops below the
top of the bed resin. Stop the flow of the column by either using a valve at the bottom of the
column or by plugging the end with modeling clay.
2. Prepare an antibody solution of at least 2 mg/ml in 0.1 M sodium carbonate (pH 9.0).
3. Dissolve the fluorescein isothiocyanate (FITC) or tetraethyl-rhodamine isothiocyanate (TRITC)
in dimethyl sulfoxide at 1 mg/ml. Prepare fresh for each labeling reaction.
4. For each 1 ml of protein solution, add 50 l of the dye. The dye should be added slowly in 5-
l aliquots, and the protein solution should be gently, but continuously, stirred during the
addition.
5. Leave the reaction in the dark for 8 hours at 4 C.
6. Add NHB
4BCl to 50 mm. Incubate for 2 hr at 4 C. Add xylene cylanol to 0.1% and glycerol to
5%.
7. Separate the unbound dye from the conjugate by gel filtration. Carefully layer the coupling
reaction on the top of the column. Open the block to the column and allow the antibody
solution to flow into the column until it just enters the column bed. Carefully add PBS to the
top of the column and connect to a buffer supply. The conjugated antibody elutes first and can
be seen under room light.
8. Store the conjugate at 4 C in the column buffer in a lightproof container. If appropriate, add
sodium azide to 0.02% to inhibit microbial contamination. When using low concentrations of
antibody (i.e., < 1 mg/ml), it is advantageous to add bovine serum albumin to a final
concentration of 1%.
9. For fluorescein coupling, the ratio of fluorescein to protein can be estimated by measuring the
absorbance at 495 nm and 280 nm. For rhodamine, measure at 575 nm and 280 nm. The ratio
of absorbance for fluorescein (495—280 nm) should be between 0.3 and 1.0; for rhodamine
(575—280 nm), between 03. and 0.7. Ratios below these yield low signals, while higher ratios
show high backgrounds.
If the ratios are too low, repeat the conjugation using lower levels of antibody and higher levels
of dye. If higher levels are found, repeat the labeling with higher levels of antibody and lower
levels of dye. Equilibrate and load the column with 10 mM potassium phosphate (pH 8.0).

81. 81
Elute with increasing salt concentrations. Measure the ratios (495/280 or 575/280) of each
fraction and select and pool the appropriate fractions.
There are two methods of the fluorescent antibody (FA) test that can be performed, the direct
and indirect. The direct method requires only 1 antibody and it must be conjugated. This antibody is
called the primary antibody and must be directed against the microorganism. This method is less
sensitive than the indirect, but yields less nonspecific fluorescence. It also requires conjugation of
numerous antibodies against each organism to be detected.
The indirect method requires two antibodies, the primary and secondary. The primary antibody
is directed against the microorganism and is unconjugated. The secondary antibody is conjugated and is
directed against the primary antibody. It is usually an anti-immunoglobulin IgG. Commercial
conjugated anti-chicken IgG immunoglobulin reagents are available prepared in goats and rabbits. For
reasons of increased sensitivity and beyond, only one commercially available conjugate is needed; the
indirect test is most often used.
Indirect fluorescence antibody test for viral antigen detection
I. 96-well plate method
1. Aspirate medium from wells of plate containing cells infected with the virus.
2. Wash once with PBS.
3. Immediately aspirate buffer, tap plate on towel to remove excess buffer.
4. Fix for 15 min w/ 1:1 acetone-methanol (Do not let this go more than a couple of minutes more
before proceeding to the next step).
5. Pour off acetone-methanol, tap on a towel. Immediately put buffer in wells, this can sit until all
plates are fixed.
6. Once all plates are fixed and contain buffer, wait 10 min, and then do one more 10 min wash
and pour off.
7. Rinse with HB
2BO and pour off. Tap on towel and allow plates to sit upside down (drain). Tap
again and then add primary antisera (antimicroorganism).
8. Incubate 1 hour at 37 C and rinse with HB
2BO.
9. Wash twice (10 min each) with buffer and repeat step 7 (rinse).
10. Add conjugated (secondary) antibody (antichicken IgG) and incubate 1 hr at 37 C.

82. 82
P
P
P
P
11. Rinse with HB
2BO and add buffer to wells and keep in dark until examination under an ultraviolet
microscope.
II. Slide Method
1. Scrape the cells where the virus was propagated to 90% CPE from the flask.
2. Centrifuge at 1500 rpm for 10 min.
3. Decant the media.
4. Wash cells with PBS.
5. Centrifuge at 1500 rpm for 5 min.
6. Decant supernatant.
7. Put a drop of the packed cells on a slide and air-dry.
8. Immerse slide in acetone-methanol solution (1:1) for 5 min and wipe dry.
9. Flood fixed samples with primary antisera.
10. Incubate at 37o
C for 30 min.
11. Wash with PBS 2x thoroughly (5 min/wash).
12. Wipe sides and back of slides.
13. Flood with conjugated (FITC) secondary antibody.
14. Incubate at 37o
C for 30 min.
15. Wash with PBS. Wipe.
16. Put a drop of mounting liquid (1 part PBS/9 parts glycerol)
17. Cover with cover slip and view with fluorescent microscope (Figure 4.0).

83. 83
Figure 4.0. FA positive cells
III. Fresh or Frozen Tissue Imprints Method
1. Cut a cross-section of the tissue and imprint the cut side on a slide. Allow to dry.
2. Dip the slide in 1:1 acetone-methanol.
3. Incubate for 2 min at room temperature.
4. Rinse twice in PBS.
5. Flood fixed samples with primary antisera.
6. Incubate at 37 C for 30 min.
7. Wash with PBS (2x) thoroughly (5 min/wash)
8. Wipe sides and back of slides
9. Flood with conjugated (FITC) secondary antibody
10. Incubate at 37 C for 30 min
11. Wash with PBS and wipe.
12. Put mounting liquid & cover with cover slip and observe microscopically.
IV. Formalin Fixed Paraffin Embedded Tissue Sections Method.
1. Prepare unstained formalin fixed paraffin embedded tissue sections as you would for standard
Hematoxylin and Eosin pathologic slides.
2.. Deparafinize and rehydrate sections through xylene and graded alcohol series.

84. 84
a. place slide in xylene for 3 mins and again for 3 min in a fresh solution.
b. place slide in 100% ethanol for 2 mins and then for 2 mins in a fresh solution.
c. place slide in 95% ethanol for 2 mins.
d. rinse slide for 5 min in distilled water.
3. Repeat staining procedures with primary and secondary antibody listed under Indirect FA test
using fresh or frozen tissue imprints.
References
Harlow, E. and Lane David, 1989. "Cell Staining." In Antibodies, A Laboratory Manual, Cold Spring
Harbor Publishing, Cold Spring Harbor, NY. pp. 353-354, 409.
UTable of ContentsU

85. 85
VIRUS NEUTRALIZATION (VN) TEST
The VN test employs the ability of specific antibody to bind to the virus and neutralize its
infectivity. Antibody has cell surface receptors, which can attach to receptors on the virus envelope.
The antibody, through a variety of mechanisms, can inhibit virus attachment and/or penetration into the
host cells or viral uncoating within the cell. Some antibody also has the ability to destroy virus
particles prior to attachment or penetration into the cell.
The VN test can be used to determine the amount of antibody in bodily fluids. In this
procedure (Beta) a constant amount of virus is used and the antibody is serially diluted. The test can
also be used to identify unknown viruses and differentiate between serologic types of subtypes using
an Alpha procedure. This technique employs a constant amount of known sera and serially diluting
known or unknown virus. In either assay, the virus-serum mixture is allowed to incubate for 30 to 60
minutes usually at 37 C and then inoculated into susceptible embryonating eggs, cell cultures or live
animals. The VN titer is calculated with an equation, which utilizes the highest dilution of virus or
antisera which causes or neutralizes infectivity in the assay system. Infectivity can be measured by
morbidity, mortality, gases or microscopic lesions of cytopathic changes in the assay system
(susceptible host or cells).
The following procedures are routinely done for common avian viral pathogens.
Calculation of Neutralizing Titer
Beta Method: A 50% end point of neutralization is calculated by the method of Reed and Muench.
The neutralizing titer is calculated from the endpoint. Table 1.4 shows typical results of a VN test.
Table 5.0 Results for VN Test
Dilution of Serum Infectivity ratio Percent infected
1/16 *1/5 20
1/64 3/5 60
1/128 5/5 100
*Number positive over total number
Method: The Neutralization index (NI) of the serum is the difference between the log titer of the
virus control (negative serum) and the log titer of the serum—virus mixture. Tables 5.0 and 5.1 show
typical results and the data are calculated as follows:
Titer of virus control (negative serum + virus) = 3.5
Titer of positive serum + virus = U-1.5U
Difference (NI) = 2.0

86. 86
-1 -2 -3 -4 -5 -6 -7 IDB50B
5/5PaP
5/5 4/5 1/5 0/5 0/5 0/5 3.5PbP
3/5 0/5 0/5 0/5 0/5 0/5 0/5 1.5
= 49
Table 5.1. Example of Virus—neutralization results
Virus dilution (logB10B) Log10
Serum
Negative
Positive
NI
2.0
IDB50B = mean infectious dose. NI = Neutralization index.
PaP
Number dead over number inoculated.
PbP
Titer calculated by Method of Reed and Muench.
UMean infective dose (IDUBU
50UBU) represents the amount of organism capable of infecting 50% of the animal
The equation to use from these data is calculated as follows:
⎡⎣50%-(% infected at dilution below 50%)⎤⎦Proportionate distance=
(% infected at dilution above 50%)−(% infected at dilution below 50%)
(50− 20) 30
= = = 0.75
(60− 20) 40
= (0.75 x 0.6) + (1.2)
0.6 =log of the serum dilution factor
1.2=log of the lower dilution used to calculate proportionate distance
50% neutralization endpoint = 1.49
= 1.65
antilog of 10P
1.65
P
I. Alpha Method (Constant-Serum Diluted Virus)
This procedure is used to quantify antibodies against avian infectious bronchitis virus and avian
encephalomyelitis. The serum-virus mixtures are incubated and then assayed for residual virus in
chicken embryos by quantal response.

87. 87
-6 -10
th
-1 -6
-6
-5
-4
-3
-2
1. Heat inactivate serum sample for about 30 minutes at 56 C in water bath. Make 1:2 dilution
if quantity is insufficient for the test. You will need at least 2.0 ml of serum for test. Use
phosphate buffered saline (PBS) for diluting. Make the lowest dilution possible.
2. Make virus dilutions. Use MASS 42 Infectious Bronchitis Virus (IBV) (Beaudette Strain) or
AE virus (Van Roekel Strain). Make dilutions from 10P
(TPB) with antibiotics.
3. Virus dilutions are added to the serum tubes:
P
to 10P
P
in tryptose phosphate broth
Tube 1 = 0.4 ml serum + 0.4 ml virus 10P
P
Tube 2 = 0.4 ml serum + 0.4 ml virus 10P
P
Tube 3 = 0.4 ml serum + 0.4 ml virus 10P
P
Tube 4 = 0.4 ml serum + 0.4 ml virus 10P
P
Tube 5 = 0.4 ml serum + 0.4 ml virus 10P
P
Incubate for 1 hour at Room Temperature.
4. Place 0.4 ml TPB and 0.4 ml of the virus dilutions 10P
This is the virus titration.
5. Incubate for one hour at Room Temperature
P
through 10P
P
into each separate tube.
6. Leave at least five embryos uninoculated for controls.
7. Seal eggs with Duco cement and place in the incubator at 37 C.
8. Candle eggs daily. Discard and disregard all embryonated eggs dead at 24 hours.
9. Record deaths each day for 7 days. On the 7P
P
day, open live embryos by refrigeration for 4
hours and check for stunting of embryo which is characteristic of IBV virus. Infected or
positive embryos show mortality (gross lesions, hemorrhages, curling, stunting, clumped down
and/or kidney urates. Embryos can also be weighed. Embryos weighing less than 80% of the
uninoculated control are considered infected (non-neutralized). All eggs are discarded and
incinerated.
10. Calculate neutralization index according to previously listed equation.
II. (Beta Procedure)
This procedure is used for infectious bronchitis (in CEKC) and for reovirus and infectious bursal
disease virus in CEF.

88. 88
P
P
1. Dilute virus to obtain the appropriate amount of virus to be used in the test. One hundred
TCIDB
50B is frequently used. The virus dilution is determined from previous titration of the virus
by the same methods (i.e. quantal response in cell culture).
2. Add 100 l of virus to well 1 from A to H and 50 l to all other wells except to wells in
column 12, which will be the CELL CONTROL.
3. In the first well (column 1, A) add 25 l of the heat-inactivated (56 C for 30 min) serum
sample using a 25 l microdiluter.
can be tested per plate).
All samples are placed in well 1 from A to H (8 samples
4. Using the multimicrodiluter, transfer 50 l of virus-serum mixture from well 1 to well 2 and
continue to well #10. Discard the content of the microdiluters by using sterile blotted paper.
Add 50 ul of a known normal serum or PBS to column 11 which will serve as VIRUS
CONTROL.
5. Incubate the plates for approximately 30-45 minutes at 37 C.
6. Add 0.2 ml of freshly prepared chicken embryo kidney cells, or CEF diluted to contain
approximately 5 x 104
cells per well, to all wells. Add 50 ul of PBS to all no. 12 wells..
7. Cover the plates with sterile polystyrene covers or with sterile tape.
8. Incubate for approximately 72 to 96 hours.
9. Fix and stain (see technique for staining cell culture monolayers that is listed at the end of this
section).
10. The end-point of any serum sample will be the dilution where the virus has been neutralized by
the diluted serum. It should look like the cell control and contain no virus specific CPE.
11. Positive and negative controls should ALWAYS be included.
Calculate neutralization index according to previously listed equation.
UTable of ContentsU

89. 89
MICRONEUTRALIZATION TEST
1. Prepare the chicken embryo fibroblast (CEF) adapted strain of virus so that approximately 100
infectious units (IU) will be present in 0.05 ml (50 ul).
2. Using the 50 ul pipette, add one drop of the diluted virus to all wells (from 1 to 11) except in
well #12. This well will be the cell control.
3. Add 50 ul of the serum sample (Figure 5.1) in the first well (well 1, row A). Follow the same
procedure for each one of the serum samples (sample 2 will be located in well 1, row B; sample
3 in well 1, row C; and so on).
4. Using the 50 ul microdiluter fitted with the handle, dilute all samples in the first well and
transfer 50 ul to the second well. Repeat the same procedure up to well #10 and discard the 50
l left.
5. Allow the preparation to incubate at room temperature for 30-45 minutes.
6. Add 0.2 ml of CEF that has been prepared and diluted to be used in microtiter plates (each well
should receive 0.2 ml of cells).
7. Add 50 ul of Hank's balanced salt solution to all number 12 wells.
8. Cover the plates with sterile polystyrene covers or with sterile tape.
9. Incubate for approximately 72-96 hours.
10. Fix and stain (Figure 5.0).
Controls:
1. Always include a known positive and negative antiserum.
2. Wells 12 will be cell control.
3. Wells 11 will be virus control.
11. Calculate neutralization index.
Staining CKC Monolayers in Microtiter Dishes
1. Pour the media out of the wells of the microtiter dish. If the wells contain virus, pour the media
into disinfectant solution.
2. Wash the cells once with PBS and pour into disinfectant.

90. 90
3. Fill the wells with 95% ethanol and allow the cells to fix for three to five minutes.
4. Pour off the ethanol.
5. Add 1% crystal violet staining solution (see Appendix for preparation) to the wells and allow
the cells to stain for three to five minutes.
6. Pour off the stain and wash the dish with tap water until all excess stain has been removed from
the wells (generally three to four washes).
7. Allow the wells to drain and dry the dish.
8. Read the plates as follows:
Virus Control
The wells where the virus has produced cytopathogenic effect (CPE) will be clear. The titer of the
virus will be the reciprocal of the highest dilution where there is CPE.
Cell Control
The cell control should be stained dark (purple or blue) since there is no CPE.
Positive Serum Control
Should appear similar to the cell control.
Negative Serum Control
Should look like the virus control.
CRYSTAL VIOLET SOLUTION
Stock Solutions
Solution A:
Crystal violet (90% dye-content) 2 g
Ethanol (95%) 20 ml
Solution B:
Ammonium oxalate 0.8 g
Distilled water 80 ml

91. 91
Figure 5.0. VN Test in cell culture
Staining Solution
Mix 1 part of solution A and 9 parts of solution B.
Figure 5.1. Heart Bleeding
References
Beard, C.W., 1989. "Serologic Procedures." In A Laboratory Manual for the Isolation and
Identification of Avian Pathogens. Kendall/Hunt Publications, Co., Dubuque, Iowa. pp. 201-
207.
Reed, L.J. and H. Meunch, 1938. A simple method for estimating fifty percent endpoints. Am. J. Hyg.
27:493-497.
Villegas, P., 1986. "Virus Neutralization Test in Embryos." "Neutralization Test."
Microneutralization Test for Infectious Bursal Disease Virus." Staining CKC Monolayer in
Microtiter Dishes." In Laboratory Manual for Avian Viral Diseases." University of Georgia,
Athens, GA. pp. 10, 26, 27, 42.
UTable of ContentsU

92. 92
ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA)
The ELISA has received considerable attention since its introduction in 1972. A mass of
publications has been generated in almost every research area with this immunological assay.
Techniques have been developed for almost every pathogen of both man and animal. This includes
ELISA techniques for a variety of poultry pathogens. ELISA is convenient, reliable, fast, highly
sensitive, and results have compared favorably with other assay procedures such as virus
neutralization.
Simplicity and economy are dependent on the availability of the reagents needed for the test,
the type of laboratory equipment available and the type and training of laboratory personnel involved
in performing the procedure. The indirect ELISA for detection of antibody consists of the following
basic steps:
1. Absorption of antigen to a solid phase.
2. Wash
3. Addition of antibody
4. Wash
5. Addition of an enzyme-linked antiglobulin
6. Incubation
7. Wash
8. Addition of substrate (responsible for color reaction)
9. Determination and expression of tests results.
ELISA is simple, but there are more steps in this procedure than in other serological tests
commonly used in diagnostic laboratories. Several companies have developed, or are in the process of
developing, ELISA kits for common poultry pathogens. These companies (IDEXX, Portland, ME;
Affiniteck, LTD. of Bentonville, Ark; and Kirkegaard and Perry Lab, Gaithersburg, MD.), have
developed and marketed world wide commercial kits for determining antibody against a variety of
common poultry pathogens. The ever growing list includes Pasteurella multocida, Bordetella avian,
Hemorrhagic enteritis virus, infectious bursal disease virus, infectious bronchitis, Newcastle disease,
Avian encephalomyelitis, reovirus, mycoplasma, infectious laryngotracheitis, infectious anemia and
avian leukosis viral antigens. These kits are sold in 4-96 well plates for an individual organism. Each
kit can test 360 samples in about 4 hours time, costing about 50¢ per sample depending on number of
kits purchased, shipping and custom charges.

93. 93
Figure 6.0. Automated ELISA systems
ELISA is the immunological test of choice for the present — one of the major reasons being
the rapid turn-around time once a test is established, and the ability to incorporate computer-assisted
analysis and data management as part of the actual test procedure.
Most laboratory equipment, including the spectrophotometers used for determining raw ELISA
test results, has the capability of being interfaced with a microcomputer (Figure 6.0). Once into the
computer, it can be easily analyzed, interpreted, stored, retrieved and reported.
The ability to report results graphically, in the form of a histogram or bar graph, is done with relative
ease by the computer. Numbers that are difficult to understand by all but the highly trained can be
replaced by graphs or pictures that are easy to interpret. The ability to manage, maintain and retrieve
records on tests performed at different time intervals can be done by pressing a few keys. The ability
of one computer to access another via telephone linkup makes the movement of data from the
laboratory back to the submitter, a very rapid process.
The real strength of the ELISA procedure is that results can be recorded photometrically.
Specialized spectrophotometers are available which can read test results right in the well in which the
test is performed. Results from the spectrophotometer reading (absorbance) can be reported in a
number of different ways:

94. 94
1. As "positive" or "negative." A certain optical density (O.D.) can be predetermined using
known negative and positive serum samples that would correlate as being "positive" or
"negative."
2. As an O.D. unit or absorbance value. When the quantity of antibody in the sample increases,
the O.D. value increases.
3. As a positive/negative ratio (P/N). The O.D. of a positive sample over the O.D. of a negative
sample at one set dilution (1:50 or 1:100). The higher the P/N ratio, the more antibody is
present.
4. Titer can be determined by carrying out serial dilutions of serum until the P/N ratio is less than
or equal to (U<U) 1, An end-point dilution or titer can be determined as with a VN or HI test.
5. Use of a standard curve made from a group of positive serum samples of varying antibody titer.
Using one dilution of serum and appropriate standards, one can determine the titer of an
unknown serum sample.
6. Combinations of the above.
The method of performing the ELISA test, and the details of calculating the end result, may
appear somewhat confusing. With appropriate automated equipment and computer-assisted analysis,
however, tests can be performed and results obtained with great speed. Hundreds of samples can be
tested in a matter of a few hours.
The ELISA assay is an antigen-antibody reaction system which uses an antibody-coupled
enzyme as the indicator. Color development after reaction of the enzyme with the substrate is directly
proportional to the amount of antibody (or antigen) present in the sample being tested (figure 6.1).
The commercial assays are bought as kits and set up in microtiter plates by the manufacture for
ease of testing large numbers of samples. The wells of the microtiter plates are coated with a
standardized amount of antigen (for the detection of antibodies) or antibody (for the detection of
antigen). The sample(s) is incubated in the test well during which time the antigen-antibody complex
forms. Excess or unbound material is washed from the well and anti-chicken IgG-horseradish
peroxidase conjugate (or anti-antigen conjugate) is added. This binds to the antibody (antigen) bound
to the fixed antigen (antibody). This is incubated and the excess is washed away. Lastly a chromogen
(orthophenylenediamine or OPD) and enzyme substrate (hydrogen peroxide) are added to the wells.
Subsequent color development is proportional to the amount of antibody (antigen) in the original
sample.
I. Preparation of Dilution Plates from Commercial Kits. Each Kit contains all necessary
materials, reagents and buffers to run the test.
1. Add 200 l of dilution buffer to each well of an uncoated low protein binding 96 well
microtiter plate. This plate serves as the serum dilution plate.

95. 95
2. Add 4 l of unknown serum per well (producing a 1:50 dilution). Start with well A4
and end with well H9 (moving left to right, row by row of wells). For example, wells
one through 10 contain the diluted sera of flock one, wells 11-20 contain the diluted
sera of flock two, etc.
3. Aspirate and remove any liquid in dilution plate wells A1, A2, A3, H10, H11 and H12.
4. Allow all diluted sera to equilibrate in dilution buffer for 5 min before transferring to an
antigen coated ELISA plate.
5. Diluted serum should be tested within 24 hours.
II. Preparation of Reagents
1. 1X Wash Solution
Dilute 1 ml of concentrated Wash solution in 19 ml of distilled water.
Approximately 400 ml of Wash Solution is needed for each 96 well plate.
2. 1X Stop Solution
Dilute 1 ml of concentrated Stop Solution in 4 ml of distilled water.
Approximately 15 ml is needed per plate.
3. Controls
Dilute an aliquot of each positive control and normal control sera with dilution
buffer (1:100) in separate 5 ml test tubes, e.g. 10 l/1ml buffer. 300 l is needed per
plate.
4. Conjugate Solution
Dilute 100 l of horseradish peroxidase conjugated anti-chicken IgG in 10 ml
of dilution buffer.
5. Substrate Solution
Each plate will require approximately 10 ml of substrate solution.
III. ELISA Test Procedure
1. Label antigen test plate according to dilution plate identification.
2. Add 50 ul of dilution buffer to each test well (with exception of wells A1, A2, A3, H10,
H11 and H12).

96. 96
3. Add 10 ul of diluted Normal Control Serum to wells A2, H10 and H12.
4. Add 100 l of diluted Positive Control Serum to wells A1, A3 and H11.
5. Transfer 50ul/well of each of the unknowns from the dilution plate to the corresponding
wells of the coated test plate. Do the transfer as quickly as possible.
6. Incubate plate for 30 min at room temperature.
7. Tap out liquid from each well onto an appropriate decontamination vessel.
8. Wash each well with 300 ul of 1X wash solution. Allow to soak for 3 min and tap into
waste container. Repeat this procedure two more times.
9. Dispense 100 ul of diluted conjugate into each assay well.
10. Incubate for 30 min at room temperature.
11. Wash as in steps 7 and 8 above.
12. Dispense 100 ul of the Substrate Solution into each test well.
13. Incubate 15 min at room temperature.
14. Add 100 ul Stop Solution to each test well.
15. Allow bubbles to dissipate before reading plate.
Figure 6.1. ELISA Diagram

97. 97
IV. Processing of Data
Measure and record the absorbance at 490 nm wavelength using a microplate spectrophotometer.
If the spectrophotometer is interfaced to a computer and the computer contains software furnished by
one of the ELISA kit manufacturers, all calculations, analysis and tabulating of data into bar graphs or
histograms will be automatic. If no software or kits are available for your needs or the laboratory is
making their own reagents, the calculations can be done manually as shown below.
CONTROLS
Negative controls (2) must have a mean ODB
490B of less than 0.150.
Positive controls must have a mean ODB
490B of at least 0.200 greater than the negative controls.
Ex. If NCx= 0.120
0.200 minimum difference
then PCx=0.320
INTERPRETATION
The relative levels of antibody are calculated using sample to positive ratios (S/P). Sample to
positive ratios of less than 0.2 are considered negative. Samples with S/P ratios greater than 0.2
indicate the presence of antibody and a history of exposure to the agent in question.
CALCULATIONS
Provided are examples of the calculations used for S/P ratio and titer determinations.
3. Sample to Positive Ratio (S/P)
1. Negative Control Mean NCx=
(0.058-0.062)
2
= 0.060
2. Postive Control Mean PCx=
(0.580+0.540)
2
= 0.560
Sample to Positive Ration (S )=
(Sample Mean -NCx) =
(1.100 −0.060) = 2.08
P (PCx-NCx) (0.560 − 0.060)

98. 98
4. Calculation of Titer at 1:500 Dilution
LogB
10B Titer = 1.09 (logB
10B S/P) + 3.36
" = 1.09 (logB
10B 2.08) + 3.36
" = 1.09 (0.318) + 3.36
" = 3.70
Titer = Antilog 3.70
= 5012
Samples with ODB
490B > 2.001 may be diluted further and retested for more accurate titer determination.
The final titer is determined by multiplying the titer of the sample by the dilution factor in proportion
to the 1:500 standard.
i.e., for a 1:4000 dilution,
So multiply titer by a factor of 8 for final titer determination.
TECHNICAL TIP
Avoiding Contamination of Test Kit Reagents
Proper handling of test kit reagents is important to get optimal test kit performance. A sudden drop in
optical densities could indicate a problem such as contamination of a reagent. Contamination, especially
of the test kit conjugate, can happen in many ways—either through introduction of serum or other kit
reagents, dirty reagent reservoirs or pouring back unused reagent into the bottle. To avoid
contamination and obtain optimal test kit performance until the expiration of the test kit, follow some
simple laboratory guidelines.
• Measure all reagents using sterile or clean vessels. Be careful to measure only what is needed for the number of plates
being run. This will help to maintain the integrity of the reagents.
• Do not return reagents to the original stock bottles.
• We strongly recommend using disposable pipettes and reservoirs when handling reagents to minimize the risk of
contamination. However, if you choose to reuse any disposable device, use a separate reservoir for each reagent and be
sure to label them. Also, wash and thoroughly rinse the wells with deionized or distilled water after each use.
• Never use the same reservoir for conjugate and substrate, even if it has been washed.
Change and discard the disposable reservoirs as frequently as possible.

99. 99
References
Skeeles, J.K., 1985. ELISA's role in the serological monitoring of poultry flocks. Vineland Update,
Vineland, N.J. No. 12, March.
Snyder, D.B., W.W. Marquardt, E.T. Mallison, D.A. Allen, and P.K. Savage. An Enzyme-Linked
Immunosorbent Assay Method for the Simultaneous Measurement of Antibody Titer to
Multiple Viral, Bacterial or Protein Antigens. Veterinary Immunology and Immunopathology
9:303-317, 1985.
Snyder, D.B., W.W. Marquardt, E.T. Mallinson, P.K. Savage, and D.C. Allen. Rapid Serological
Profiling by Enzyme-Linked Immunosorbent Assay. III. Simultaneous Measurements of
Antibody Titers to Infectious Bronchitis, Infectious Bursal Disease, and Newcastle Disease
Viruses in a Single Serum Dilution. Avian Dis. 28:12-24. 1985.
Thayer, S.G., 1986. "Enzyme-Linked Immunosorbent Assay (ELISA) For Avian Serum Antibody or
for Antigen." In a Laboratory Manual for Avian Virus Diseases. P. Villegas, Ed. University
of Georgia, Athens, GA. pp. 48-51.
UTable of Contents

100. 100
D: Immunosuppression in Poultry
Introduction
Control of infectious diseases depends on flock immunity. Reduced immune responsiveness
leading to increased disease losses can seriously damage the poultry industry. Often a laboratory is
called on to determine if a poor performing flock has experienced some form of immunosuppression.
Immunosuppression describes a variety of disease problems. Vaccine failures and disease outbreaks
are blamed on immunosuppression. This chapter will define immunosuppression, describe assays to
detect immunosuppression, review immunosuppressive agents and their effects on components of the
immune system, and give methods to prevent immunosuppression.
Definition
Immunosuppression is a state of temporary or permanent dysfunction of the immune response
resulting from damage to the immune system. This leads to increased susceptibility to disease agents
and decreased responsiveness to vaccination. Immunosuppressive agents damage the immune system.
Immunodysfunction may be caused by infectious and non-infectious agents. Infectious causes include
bacteria, viruses and internal parasites. Non-infectious causes include chemicals, hormones,
antibiotics, toxins, environmental stresses and lack of dietary ingredients.
Evaluation of immunosuppression
The location, development and function of the immune system are necessary to understand the
relationship between immunosuppressive agents and their effects or economic loss. The immune
system is dependent on lymphoid tissues and is divided into central and peripheral. Central lymphoid
tissues are the bursa and the thymus. Peripheral lymphoid tissue includes the spleen, cecal tonsil, bone
marrow and gland of Harder. The central lymphoid tissues become invaded by stem cells derived from
the bone marrow or yolk sac, which undergo differentiation and migration as cells destined to form
bursal lymphocytes (B-cells) or thymal lymphocytes (T-cells). As chickens age, there is “seeding” of
the peripheral lymphoid tissues with centrally derived B and T-cells. When the chicken is mature, the
bursa and thymus become vestigial and immunocompetence is dependent on the peripheral immune
system. B-cells, when exposed to antigen, divide to produce plasma cells, which secrete antibody
(AB), and “memory” cells. Antibodies neutralize antigen; whereas, memory cells retain recognition
code to the antigen. On subsequent exposure to the same antigen, memory cells divide to produce
more plasma cells, which make antibody during the anamnestic response. T-cells do not produce
antibodies. They are involved in cell-mediated immunity (CMI) (effector T-cells), in destruction of
infected cells (cytotoxic T-cells), and cells which promote the production of antibody by B-cells
(helper T-cells). Memory cells are also produced by T-cells. Macrophages are present early in the
development of the immune system and survive for a long time. They become activated during an
inflammatory process and replicate under the influence of growth factors produced by lymphocytes.
Macrophages are involved in chemotaxis, phagocytosis, microbial killing, intracellular digestion,
extracellular killing, and secretion of monokines, interferon, interleukins and hormones. Macrophages
also process and present antigen to B- and T-cells.
Immunosuppressive agents can affect all types of immunity, thereby, nonspecifically increasing
susceptibility to pathogens. Diseases more severe following immunosuppression are inclusion body

101. 101
P
P
hepatitis, gangrenous dermatitis, aplastic anemia, coccidiosis, MD, E. coli septicaemia, reovirus
“related diseases,” Newcastle Disease virus (NDV), IBV and the “swollen head syndrome.” Criteria to
evaluate immune functions are: gross and microscopic changes in the morphology of central or
peripheral lymphoid tissues, changes in antibody levels, reduction in the CMI response, interference
with vaccination, and exacerbation in the course of disease caused by other agents. Atrophy of
lymphoid organs and depletion of lymphoid follicles often result from immunosuppressive agents.
Changes in lymphoid organs such as the thymus and bursa of Fabricius, therefore, are indicative of
immunosuppression. To detect gross changes, weights of lymphoid organs and body weights from
infected and control groups can be determined and analyzed statistically. Bursa weight to body weight
ratios (B/B) (weight of bursa divided by weight of body of 20 birds per flock x 1,000) can be
correlated with immunosuppression. Birds between three-to-six-weeks-of-age normally have B/B
ratios from two to four. B/B ratios of one or less are indicative of immunosuppression and are seen in
clinically ill birds and birds condemned at processing. Thymus diameter to shank diameter ratios x 10
(T/S ratios) can also be done. T/S ratios of less than one are indicative of atrophy and
immunosuppression. Histological changes in lymphoid tissues can be made by microscopic
comparisons between infected and control birds.
Antibody response
Most commercial poultry in the world are vaccinated from one to two times against NDV. It is
one of the most common and costly diseases of poultry. Therefore, producers are continually
monitoring antibody responses in birds as one determination of their immune status against NDV as
well as their functioning capability of the immune system.
The HI response has traditionally been a rapid easy test for measuring antibody against NDV.
6 9
Normal immunized chickens should produce HI titers of at least 2P
P
or 2P
P
by ELISA. Antibody
responses against NDV vaccines can be evaluated using the HI or ELISA as described in previous
chapters. Non immunized birds can be either injected with sheep red blood cells (S-RBC’s) or tested
for natural agglutinins against rabbit red blood cells (R-RBC’s). For S-RBC’s, poultry are injected
twice intramuscularly with 1.0 ml/injection of a 10% volume/volume suspension of S-RBC’s at 2 week
intervals. At 2 weeks after the injection, birds are bled and serum collected and complement
inactivated as stated prior in this book. Sera are tested using a microdilution technique. Sera are
diluted in twofold dilutions with PBS in a 96 round bottom well plate for 10 dilutions. An equal
volume of a 0.5% suspension of S-RBC’s is added to each well and the plates are incubated at room
temperature for 60 minutes. The endpoint titer is the last dilution in which the S-RBC’s are
agglutinated (form a lacy pattern at the bottom of the well). A solid button at the bottom is considered
negative. S-RBC’s are considered a T-cell antigen, since T-cells are needed as helper cells for B-cells
to produced antibody. Normal control chickens should produce titers of around 28
after two injections
of S-RBC’s.
The contrast to the S-RBC test, the R-RBC’s are B-cell antigens, since only B-cells are needed
to make antibody against them. The basis for this test is that an antigen on the surface of the R-RBC is
similar to a bacterial antigen in which all none gnotobiotic birds are exposed. This nonpathogenic
bacterium is probably in the air, water and/or feed of all commercially reared poultry. Therefore, with
this test, birds do not have to be immunized with the R-RBC’s hence the name natural agglutinins.
This test is run and evaluated the identical way as the S-RBC’s. The R-RBC’s are mixed with an equal
volume of the bird’s serum which has been diluted in twofold dilutions with PBS. After incubation the
wells are checked for hemagglutination. With either of the two tests, a reduction in titer of 10 fold is

102. 102
P
P
considered to indicate immunosuppression, when compared to normal control birds. However, it is
best to compare the results of multiple animals (suspect and known non-immunosuppressed birds) and
analyze the results statistically using a students T-test or Analysis of Variance Assay. Normal control
chickens should produce titers of around 26
.
CMI response
A number of tests can be used for measuring CMI. The easiest are a measure of the delayed-
type hypersensitivity (DTH) or cutaneous basophile hypersensitivity (CBH) reactions. In the DTH test
an antigen such as mycobacterium is injected intradermally into the wattle or between the toes of a
previously sensitized bird. The increase in thickness after 24 hours as compared to skin injected with
saline or antigen injected in an unsensitized bird as measured with micrometer is the DTH response.
This DTH is correlated with the T-cell response. Birds are given tuberculin by an intramuscular
injection at two sites (in the breast area) with a total of 0.3 ml of tuberculin from Jensen-Salsberry
Laboratories, Inc. emulsified in 0.7 ml of Freund’s complete adjuvant from Difco Laboratories, Inc.,
Detroit, Mich. At 14 days after sensitization each chick is tested for DTH by injection of 0.1 ml
containing 50 ug of tuberculin into the skin. The interdigital (toe) or wing web skin is used in birds
less than four-weeks-of-age, because their wattles are too small to be injected intradermally. The
opposite wattle, wing or between the toes on the other foot are injected with 0.1 ml of 0.15 NaCl. The
difference in thickness between antigen injected and saline injected skin as measured by calibers is the
measure of DTH. Another control would be to inject antigen into unsensitized birds that did not
receive tuberculin previously. Sensitized nonimmununosuppressed birds will have a skin which
doubles in thickness after 24 hours after receiving tuberculin. Again, it is more accurate to have a
number of samples to do a statistical analysis comparing suspect birds with that of normal non-
suppressed birds.
A more simplified test than DTH is the CBH test. It is done with phytohemagglutinin-M
(PHA-M), a mitogen from Difco laboratories, Detroit, MI. This will cause a cellular reaction in
normal unsensitized, nonimmunosuppressed birds and is also correlated with T-cells and CMI. The
test requires no previous sensitization and is run and calculated the same way as for tuberculin. The
PHA-M is reconstituted and injected in one wattle, wing web, or between the toes. Twenty four hours
after injection, the skin thickness is measured and compared to saline injected skin. Again,
nonimmunosuppressed birds will show a twofold increase in mitogen injected skin compare to saline
injected.
Causes of Immunosuppression
Antibiotics
Antibiotics are capable of depressing the immune response. Therefore, caution must be
observed when prescribing compounds at high levels for extended periods. Chlorotetracycline can
cause adverse effects on the development of gut-associated lymphoid tissue. Immunosuppression can
occur in chicks hatched from eggs dipped in tylosin and gentamycin.
Mycotoxins

103. 103
Aflatoxins increase susceptibility of poultry to Salmonella, Aspergillosis, coccidiosis, MD, E.
coli and IBDV. Effects are dependent of the level of toxin and duration of toxin consumption and age
and genetic strain of bird. Ochratoxins, T-2 toxin and fumonisins cause depression in Ig producing
cells in the lymphoid organs and a decrease in the size of the bursa and thymus.
Diet
Selenium deficiency results in immunosuppression. Diets deficient in valine decrease antibody
to NDV. Diets devoid in B complex, C and E vitamins cause atrophy of the bursa of Fabricius, thymus
and spleen. Consumption of lead, cadmium, mercury and iodine can be immunosuppressive.
Stress
Stress can increase levels of steroids. Steroids decrease lymphoid cell synthesis. Heat stress
causes immunosuppression. Stressed chickens are more susceptible to viral than bacterial infections.
Stress of high egg production induces reactivation of adenovirus infections. Stress of force molting
decreases antibody responses to NDV and IBDV in broiler breeders.
Bacteria
Bacteria such as E. coli and Mycoplasmae produce factors that depress phagocytosis of
neutrophils.
Virus (Table 1.0)
Virus-induced immunosuppression causes alterations in the function of a variety of cells,
especially lymphocytes and mononuclear phagocytes.
Direct immunosuppression occurs by virus attack on lymphoid organs and cells; whereas,
indirect immunosuppression may be by the release of mediators such as hormones, complement and
prostaglandins that have direct immunosuppressive activity or that can activate certain species of
suppressor cells leading to immune defects.
Table 1.0. Immunosuppressive Viruses
Virus Type Target Suppression
IBD Birnavirus B- and T-cells AB and CMI
AL Oncovirus B- and T-cells AB and CMI
MD Herpes T-cells CMI
ND Paramyxovirus T-cells CMI
CAV Circovirus B- and T-cells AB and CMI

104. 104
IBDV causes atrophy of the bursa of Fabricius, and B-cell lymphoid tissue in the cecal tonsil,
gland of Harder and thymus. B/B ratios of IBDV infected broilers may be 0.5 or less at processing.
Infections of IBDV during the first week of age cause a permanent suppression in antibody production.
IBDV renders chickens more susceptible to MD. Avian Leucosis viruses target B-cells and cause
antibody suppression. MDV target T-cells and depress CMI. A consequence of MDV
immunosuppression is increased susceptibility to coccidia and reduced antibody response. CAV
causes immunodepression of B- and T-cells. The virus causes anaemia (paleness of the comb, shanks
and bone marrow). There is degeneration of the bursa and thymus. Hemorrhage of the musculature
and internal organs is also seen.
Prevention of immunosuppression
I Produce high quality chicks free of mycoplasma, ALV, and E. coli, having high maternal
antibody against serologic standard and variant IBDV, and CAV.
II Rear chicks in a clean sanitized environment, with chlorinated water using nipple drinkers, and
an adequate diet fortified with vitamins and minerals and free of mycotoxins, pesticides and
toxic metals.
III Use only approved levels of antibiotics.
IV Reduce stress by using adequate heating and cooling and do not over crowd birds.
V Use effective vaccination methods to control IBDV, MDV, and NDV.
Many agents may damage lymphoid organs, and cause immunosuppression. Poor immune responses
in birds and atrophy of lymphoid organs are seen in many morbid, dead or condemned poultry.
Immunodepression may be permanent or temporary and can interfere with vaccine efficacy and
increase susceptibility to other agents. Humoral responses can be evaluated by measurement of serum
antibody. CMI responses can be evaluated by DTH or CBH reactions in the wattle, wing web or
interdigital skin test. Macrophages can be measured for their ability to phagocytose bacteria or latex
beads. Immunosuppression may be apparent as an increase in respiratory or enteric disease, high
morbidity or mortality, atrophy of lymphoid organs, high condemnations, poor feed conversion, or low
egg production.
Utable of Contents

105. 105
II. MOLECULAR BIOLOGICAL
TECHNIQUES
The development of new methods and techniques in molecular biology over the last two
decades has opened the way for fresh strategies for the development and commercialization of
products and services that are beneficial for mankind. Molecular biology has numerous synonyms
including molecular genetics, recombinant deoxyribonucleic acid (DNA) technology or biotechnology.
Biotechnology is probably the more general and universally used term which includes disciplines such
as microbiology, biochemistry, genetics, and biochemical engineering. Parts of this new technology
include nucleic acids or recombinant DNA technology, and proteins, which includes hybridoma
production, and enzyme and protein engineering. This chapter will describe common laboratory
techniques using both nucleic acids and proteins. Nucleic acid probes and monoclonal antibodies have
improved the sensitivity and specificity as well as speed of diagnostic tests. Procedures such as
nucleic hybridization, sequencing and amplification using the polymerase chain reaction will be
discussed. Use of monoclonal antibodies for antigen capture ELISA tests and immunoperoxidase
assays will also be mentioned. It is certain that almost all new major break-throughs in the years to
come in diagnosis of diseases will come from the field of molecular biology.
5. Nucleic Acids
Introduction
Before discussing nucleic acids or recombinant DNA technology, it is first necessary to
consider the structure of DNA itself as well as the processes of transcription and translation of genetic
information.
Nucleic acids consist of nucleotides. Each nucleotide contains a nitrogenous base, a five-
carbon (pentose) sugar and a phosphate group. There are two types of pentose sugars found in nucleic
acids: 2-deoxyribose in DNA (deoxyribonucleic acid) and ribose in ribonucleic acid (RNA). The
difference is in the absence or presence of a hydroxyl group at position two of the sugar molecule.
The nitrogenous bases are of two kinds: pyrimidines with a six-member ring and purines with
fused five- and six-member rings. The pyrimidines are cytosine, uracil and thymine, and the purines
are adenine and guanine. For convenience, they are often referred to by their initial letters (C, U, T, A
and G). DNA contains adenine, thymine, guanine and cytosine. RNA also has adenine, guanine and
cytosine, but thymine is replaced by uracil. The only difference between thymine and uracil is the
absence of a methyl group in uracil. The base-sugar moiety is called a nucleoside and the base-sugar-
phosphate moiety is called a nucleotide.
The nucleotides are linked together to form polynucleotide chains. In general, RNA consists of
a single polynucleotide chain, whereas DNA (unless denatured) is composed of two polynucleotide

106. 106
chains arranged in a double helix. Otherwise the primary structures of DNA and RNA are the same.
By convention the numbers of the carbon atoms in the pentose sugars in nucleic acids are given a
prime ( ). In the sugar-phosphate backbone of each polynucleotide chain, the 5 position of one
pentose sugar is connected to the 3 position of the next pentose sugar via a phosphate group. The
terminal nucleotide at one end of the chain has a free 5 group while the terminal nucleotide at the
other end has a free 3 group. The two polynucleotide chains in DNA run in opposite directions and
are said to be antiparallel.
http://www.accessexcellence.org/RC/
Projecting inwards from the two sugar-phosphate backbones are the nitrogenous bases which
exhibit specific base pairing: guanine in one chain always pairs with cytosine in the other chain and
adenine always pairs with thymine. The two chains are held together by hydrogen bonds between the
nitrogenous bases.
Because of the specific base pairing, during cell division each strand acts as a template for the
synthesis of a complementary strand. The natural, or so-called B-form of the DNA double helix is
coiled in a clockwise or right-handed direction because the chains turn to the right as they move
upwards. However, local regions of the molecule can have a left-handed helical configuration which is

107. 107
P
P
referred to as Z-form DNA, because of the zig-zag path of the sugar-phosphate backbone in this form
of DNA.
The primary structure of DNA is the linearly arranged double-stranded (duplex) molecule.
However, occasionally it may be circular as in bacteria, plasmids and certain viruses, and it may even
be single-stranded as in some types of phage. However, of particular importance is the arrangement of
the DNA molecule in higher organisms where genetic information is largely concentrated in the
chromosomes within the nucleus. Those organisms where there is no well-defined nucleus and which
are considered to be very primitive are called prokaryotes. They include the bacteria and their close
relatives the blue-green algae. In all other organisms there is a nucleus and these higher forms, which
also include yeasts, are called eukaryotes.
The width of a chromosome is very much greater than the diameter of a DNA helix. Also, the
amount of DNA in each nucleus in man, for example, is such that the total length of DNA in his
chromosomes when extended would amount to several meters. In fact, the total length of the 46
chromosomes in humans is less than half a millimeter. To accommodate all this DNA in such a
compact form demands that the DNA be supercoiled, i.e. additionally coiled in the same clockwise
direction at the intrinsic winding of the DNA helix.
Transcription
Genetic information contained in DNA is transmitted to messenger RNA (mRNA) by a process
referred to as transcription which involves the DNA being used to order complementary sequences of
bases in the mRNA. Genetic information in mRNA is then translated into protein synthesis.
Genes which are responsible for the synthesis of specific enzymes or peptides are referred to as
structural genes in contrast to so-called control genes which modify the effects of structural genes.
Enzymes and peptides are composed of amino acids, and the base composition of a structural gene codes
for each of these amino acids. Genetic information within the DNA molecule is stored in the form of
triplet codes, i.e. a sequence of three nucleotide bases determines the formation of one amino acid. The
triplet of bases which codes for one amino acid is called a codon, and the sequence of codons
responsible for the synthesis of a specific polypeptide is called a cistron. If three bases specify one
amino acid then the possible number of combinations of four bases taken three at a time where their
order matters would be 43
or 64. But there are only 20 ‘primary’ amino acids commonly found in
proteins. Others, e.g. hydroxyproline, are formed by the modification of one of the primary amino
acids. Thus, if there are 64 possible triplet codons for only 20 amino acids, some of the codons must
specify more than one amino acid or have other functions. Firstly, sixty-one of the codons represent
amino acids, all of which, except tryptophan and methionine, have more than one codon. In this regard
the code is said to be degenerate. Secondly, three codons (UAA, UAG and UGA) are responsible for
the termination of protein synthesis, i.e. they are called stop codons. Thirdly, the codon AUG nearest
the 5 end of a gene is responsible for initiating protein synthesis. None of any of the other AUG
codons in a gene can serve as initiation sites but instead code for methionine.
It should be noted that by convention of nucleic acid sequences, whether in DNA or RNA, are
always written in the direction from the 5 end to the 3 end of the molecule, and since the genetic

108. 108
6
code is actually read from the mRNA it is often represented in terms of the four bases in RNA, namely
U, C, A and G.
This genetic code is universal and is found in all living organisms. The only exception is the
genetic code in mitochondrial DNA which differs in detail.
In principle the base sequences in nucleic acids could be translated in any one of three different
reading frames, as they are called, depending on where the decoding process begins. For instance the
sequence:
UAAGCAUAGAU
could be read as:
UAA, GCA, UAG, —
or as:
or as:
AAG, CAU, AGA, —
AGC, AUA, GAU.
However, the genetic code is not overlapping in the majority of organisms including all eukaryotes.
The reading frame is set at the initiation codon and proceeds sequentially, thereafter, continuing until
the stop codon is reached.
Only one DNA strand is copied, and the particular strand used varies throughout the genome
and is gene specific. The indication as to which DNA strand is copied is dictated by the orientation of
what is called a promoter sequence. Orientation of the promoter sequence sets off the RNA
polymerase (RNA-synthesizing enzyme) in a particular direction in any given genetic region and
thereby automatically determines which of the two DNA strands will be read. Since the enzyme RNA
polymerase sequentially adds ribonucleoside monophosphates to the growing 3’-OH end of the RNA
chain, the latter grows in the 5’ to 3’ direction, and the DNA strand serving as template is therefore
traversed from its 3’ to its 5’ end. This means that each RNA molecule will be identical in its
polarity and nucleotide sequence (except for the substitution of U for T) to the DNA strand that is not
transcribed. Thus: Direction of transcription ——————
DNA-5’-----TAA-----CGC-------GTT-------ATA-----------3’
3’------ATT-----GCG------CAA-------TAT-----------5’
RNA-5’------UUA-----CGC-----CUU-------AUA----------3’
Though all functioning genes are transcribed in this way, most genomic DNA appears not to be
transcribed at all. The total amount of nuclear DNA in the human haploid (gametic) genome of man
amounts to 3 x 10P
P
kb. Since in general a gene is about 1 to 2 kb in length, there should be over a
million genes, but in fact only about 3,000 disease loci have been identified. Even taking into account
all the other genes concerned with normal traits, such as height, a large proportion of genomic DNA

109. 109
remains for which at present there is no defined function. This has been variously referred to as ‘junk’
or selfish DNA.
Translation
The process whereby genetic information present in an mRNA molecule directs protein
synthesis is referred to as translation. After migrating out of the nucleus into the cytoplasm, mRNA
becomes associated with the ribosomes, which are the site of protein synthesis. A group of ribosomes
associated with the same molecule of mRNA is referred to as a polysome. In the ribosomes, the mRNA
forms the template for the sequence of particular amino acids and is sometimes called template RNA.
In the cytoplasm there is also another family of RNAs called transfer RNA or tRNA. Each tRNA is
about 70-90 nucleotides in length and is single-stranded, but because of base pairing within
the molecule it adopts a shape like a clover-leaf. Within the middle loop of the clover-leaf, a triplet of
varying sequence forms the anticodon which can base-pair with a complementary triplet in an mRNA
molecule. At the other end of the tRNA molecule is a sequence for attachment to a specific amino
acid. Thus a particular triplet on the mRNA is related through tRNA to a specific amino acid. The
ribosome first binds to a specific site on the mRNA molecule which thus sets the reading frame. The
ribosome then moves along the mRNA molecule in a zipper-like fashion, translating one codon at a
time using tRNA molecules to add amino acids to the growing end of the polypeptide chain.
Of importance to recombinant DNA technology is the so-called post-translational modification of
proteins. Many proteins undergo modification when they are released from the ribosome, and over a
hundred different modifications are now known which may increase or decrease the functional activity
of a particular protein. These modifications may be reversible as in the case of phosphorylation
(brought about by the enzyme protein kinase), adenylation and methylation. Other modifications are
permanent and are required for activity, e.g. the attachment of a coenzyme (e.g. biotin) or the cleavage
by a protease of a larger protein into smaller active proteins as occurs in the production of certain
hormones such as somatostatin, insulin and glucagon. Large precursor proteins or polyproteins may
undergo proteolytic cleavage to produce several active peptides, and different processing pathways of a
precursor protein may occur in different tissues.

110. 110
http://www.accessexcellence.org/RC/
DNA
http://www.accessexcellence.org/RC/

111. 111
References
Emery, A.E.H., 1985. An Introduction to Recombinant DNA. John Wiley and Sons, New York, N.Y.,
pp. 13-27.
Utable of Contents

112. 112
PROPAGATION, PURIFICATION AND QUANTIFICATION OF IBDV RNA
Birnaviridae
Table of Contents
• Viral Characteristics
• Classification
• Avibirnavirus
• Infectious Bursal Disease
• Glossary
This family was created to accommodate those double-stranded RNA viruses that did not fit in
Reoviridae because their genome contained only two segments of linear double-stranded RNA rather
than the ten to twelve segments of the reoviruses. Birnaviridae includes viruses that infect chickens,
insects, rotifers and fish. Infectious bursal disease (IBD) virus is the only significant veterinary
pathogen.
Viral Characteristics
• Non-enveloped, double stranded RNA viruses with icosahedral symmetry approximately 60 nm
in diameter.
• The capsid consists of five major polypeptides (VP1-5) and contains a genome consisting of
two segments of double-stranded RNA.
• Replication takes place in the cytoplasm. The dsRNA serves as a template for the production of
mRNA (+) and progeny genomes.
• Viruses are stable, resisting heat and a wide pH range.
Birnaviridae (approximately 60 nm). Nonenveloped, icosahedral capsid that consists of five major
polypeptides. To view click on figure
Classification
The family Birnaviridae contains three genera:
Aquabirnavirus includes viruses that infect fish, crustaceans and mollusks. Included is the virus that
causes infectious pancreatic necrosis of salmonoid fish.
Entomobirnaviruses includes viruses that infect insects.
Avibirnavirus infects birds. Only one species, the virus causing infectious bursal disease (IBD), is

113. 113
recognized. There are two serotypes of IBD virus: Type 1 strains cause IBD; type 2 strains are not
pathogenic.
Avibirnavirus
Infectious Bursal Disease
(Gumboro disease)
Cause
Infectious bursal disease virus, Avibirnavirus, serotype 1.
Occurrence
Infectious bursal disease is a frequently occurring, worldwide infection of chickens.
Transmission
The virus is shed in the feces and transmission is by direct contact and indirectly by fomites.
Pathogenesis
The route of infection is mainly oral, but also via the conjunctiva and respiratory tract. Shortly after
initial infection, the virus is found in Kuppfer cells of the liver; and in macrophages and lymphoid cells
of the jejunum, duodenum and cecum. Within 12 hours, cells of the bursa of Fabricius are infected.
The principal target cells are B lymphocytes. Following viremia the thymus, the Harderian gland and
spleen are infected. Depletion of the bursa leads to an impaired immune response.
Clinical & Pathologic Features
The disease is highly contagious for young chickens (usually 3 – 14 weeks), and is characterized by
swelling and edema of the bursa of Fabricius. Clinical signs include diarrhea, anorexia, depression,
vent picking, and prostration. Mortality ranges from none to about 20%. The principal loss is mainly
due to poor weight gains of broilers. Although clinical signs are not usually present in very young
birds, the immune system may be permanently impaired. Lesions in lymphoid tissues are
characterized by degeneration of lymphocytes in medullary areas.
Diagnosis
• Clinical specimens: Bursa of Fabricius, liver, spleen, kidney, lungs and blood.
• IBD is suspected in cases of swollen and hemorrhagic bursa of Fabricius in young chickens.

114. 114
• Confirmation of a diagnosis can be made by detecting viral antigen in macerated bursa by an
ELISA or agar gel immunodiffusion procedure. Immunofluorescence can be used to detect
viral antigen in frozen sections of the bursa.
• The virus can be propagated on the chorioallantoic membrane of chicken embryos obtained
from flocks free of IBD. Death of embryos usually occurs in 3 – 5 days. Identification is made
by virus neutralization.
Prevention
• Exposure can be reduced by thorough cleaning and disinfection of poultry houses.
• Killed virus vaccines used in breeders.
• Attenuated live virus vaccines embryo origin are administered by eye instillation or drinking
water to chicks during the first 1 – 2 weeks of age, but vaccination may not be effective if
passively acquired immunity is high.
• Commercial ELISA kits are available for monitoring the immune status of flocks.
Glossary
bursa of Fabricius:
This sac-like lympho-epithelial structure, unique to birds, is associated with the cloaca.
Maturation of B lymphocytes takes place in this organ.
Harderian gland:
An accessory lacrimal gland located on the inner side of the orbit in reptiles and birds.
5. Virus propagation
Infectious bursal disease virus (IBDV) can be propagated in three-week-old specific-pathogen-free
leghorn chicks or cell culture. Each bird is inoculated intra-nasally and/or subconjunctivally with 50 ul
of a virus suspension containing at least 10 chicken infected doses per ml. The birds should be housed
in modified Horsfall-Bauer isolation units maintained with filtered air under negative pressure. Three
days post-inoculation the birds are killed and their bursa of Fabricius removed. The bursae are
immediately placed in NET buffer, then freeze-thawed three times rapidly at -700
C. Cells are
harvested from a crude suspension prepared by homogenizing the entire bursae in buffer in a tissue
blender. Cellular debris can be removed by centrifugation at 2,000 rpm for 10 min. The cell
suspensions can be frozen at -200
C until needed.
IBDV isolates can also be propagated in primary chicken fibroblasts (CEF) or cell lines such as
VERO cells or BGM-70 cells upon adaptation. The CEF’s are grown as previously listed in Section 3c
of this book then infected with the virus. Upon development of 70-80% cytopathic effect (CPE), the
monolayers are harvested by three rapid freeze-thaw cycles, aliquoted, and frozen at -20
C until
purified.

115. 115
B. Virus purification
Bursal homogenates or pooled CEFs infected with the IBDV isolates are concentrated by
centrifugation at 50,000 xg for 3 hours or 100,000 xg for 1 hour at 4
C over a 40% sucrose
cushion. Pellets are suspended in NET buffer and are Freon (1,1,2, trichlorotrifluoroethane) or
chloroform extracted (figure 1.0) to release intact virions. An equal volume of Freon is mixed with
virus and agitated. A second centrifugation at 100,000 xg for 3 hr. is performed to concentrate the
virus before extraction of the nucleic acid.
Figure 1.0. Pellet formed after chloroform extraction
Controlling Ribonuclease Activity
To obtain good preparations of RNA, it is necessary to minimize the activity of RNAases
liberated during cell lysis by using inhibitors of RNAases or methods that disrupt cells and inactivate
RNAases simultaneously as discussed below. Consequently, it is also important to avoid the
accidental introduction of trace amounts of RNAase from other potential sources in the laboratory. A
number of precautions can be used to avoid problems with RNAases.
If proper care is not taken, preparations of RNA can be contaminated with RNAases from
outside sources including:
Glassware, plasticware, and electrophoresis tanks. Sterile, disposable plasticware is
free of RNAases and can be used for the preparation and storage of RNA without
pretreatment. General laboratory glassware and plasticware, however, are often
contaminated with RNAases and should be treated by baking at 180 C for 8 hours or
more (glassware) or by rinsing with chloroform (plasticware). Some workers fill
beakers, tubes, and other items that are to be used for the preparation of RNA with
diethyl pyrocarbonate (DEPC) (0.1% in water), which is a strong, but not absolute,
inhibitor of RNAases. After the DEPC-filled glassware or plasticware has been allowed
to stand for 2 hours at 37
C, it is rinsed several times with sterile water and then heated
to 100C for 15 minutes or autoclaved for 15 minutes at 15 lb/sq. in. on liquid cycle.

116. 116
These treatments remove traces of DEPC what might otherwise modify purine residues
in RNA by carboxymethylation.
Electrophoresis tanks used for electrophoresis of RNA should be cleaned with detergent
solution, rinsed in water, dried with ethanol, and then filled with a solution of 3%
HB
2BOB
2B. After 10 minutes at room temperature, the electrophoresis tank should be rinsed
thoroughly with water that has been treated with 0.1% DEPC.
One should set aside items of glassware, batches of plasticware, and
electrophoresis tanks that are to be used only for experiments with RNA to mark them
distinctively, and to store them in a designated place.
Caution: DEPC is suspected to be a carcinogen and should be handled with
care. Use gloves, bulb pipettes and work under a fume hood when handling this
compound.
! Contamination by workers. A potentially major source of contamination with RNAase
is in the hands of the investigator. Disposable gloves should be worn during the
preparation of materials and solutions used for the isolation and analysis of RNA and
during manipulations involving RNA. Because gloves remain RNAase-free only if they
do not come into contact with “dirty” glassware and surfaces, it is usually necessary to
change gloves frequently when working with RNA or rinse them with 70% ethanol.
! Contaminated solutions. All solutions should be prepared using RNAase-free
glassware, autoclaved water, and chemicals reserved for work with RNA that are
handled with baked spatulas. Wherever possible, the solutions should be treated with
0.1% DEPC for at least 12 hours at 37C and then heated to 100
C for 15 minutes
or autoclaved for 15 minutes at 15 lb/sq. in. on liquid cycle. DEPC reacts rapidly
with amines and cannot be used to treat solutions containing buffers such as Tris.
Inhibitors of Ribonucleases
The following specific inhibitors of RNAases are widely used:
! Protein inhibitor of RNAases. Many RNAases bind tightly to a protein isolated from human
placenta, forming equimolar, non-covalent complexes that are enzymatically inactive. In vivo,
the protein is probably an inhibitor of angiogenin, an angiogenic factor whose amino acid
sequence and predicted tertiary structure are similar to those of pancreatic RNAase. The
inhibitor, which is sold by several manufacturers under various trade names, should be stored at
-20
C in 50% glycerol solutions containing 5 mM dithiothreitol. Preparations of the inhibitor
that have been frozen and thawed several times or stored under oxidizing conditions should not
be used; these treatments may denature the protein and release bound RNAases. The inhibitor
is therefore not used when denaturing agents are used to lyse mammalian cells in the initial
stages of extraction of RNA. However, it should be included when more gentle methods of
lysis are used and should be present at all stages during the subsequent purification of RNA.

117. 117
C) RNA Extraction
The most basic of all procedures in molecular biology is the purification of nucleic acids. The
key step, the removal of proteins, can be carried out by extracting aqueous solutions of nucleic acids
with phenol:chloroform and chloroform. Such extractions are used whenever it is necessary to
inactivate and remove enzymes. However, additional measures are required when nucleic acids are
purified from complex mixtures of molecules such as cell lysates. In these cases, it is usual to remove
most of the protein by digestion with proteolytic enzymes such as pronase or proteinase K, which are
active against a broad spectrum of native proteins, before extracting with organic solvents.
The standard way to remove proteins from nucleic acid solutions is to extract first with
phenol:chloroform and then with chloroform. This procedure takes advantage of the fact that
deproteinization is more efficient when two different organic solvents are used instead of one.
Furthermore, although phenol denatures proteins efficiently, it does not completely inhibit RNAase
activity. This problem can be circumvented by using a mixture of phenol:chloroform:isoamyl alcohol
(25:24:1). The subsequent extraction with chloroform removes any lingering traces of phenol from the
nucleic acid preparation.
5. Add an equal volume of phenol:chloroform to the nucleic acid sample in a polypropylene tube.
When using hot phenol (56
C), most of the DNA will end up in the phenol-organic phase.
2. Mix the contents of the tube until an emulsion forms.
3. Centrifuge the mixture at 12,000 x g for 15 seconds in a microfuge (or at 10,000 x g for 10
min) at room temperature. If the organic and aqueous phases are not well-separated, centrifuge
again for a longer time or at a higher speed. Normally, the aqueous phase forms the upper
phase. However, if the aqueous phase is dense because of salt (>0.5 M) or sucrose (>10%), it
will form the lower phase.
5. Use a pipette to transfer the aqueous phase (supernatant) to a fresh tube. For small volumes
(<200 l), use an automatic 117rthoreov fitted with a disposable tip. Discard the
interface
(contains-white-protein) and organic phase.
5. Repeat steps 1 through 4 until no protein is visible at the interface of the organic and aqueous
phases.
5. Add an equal volume of chloroform and repeat steps 2 through 4.
7. Recover the nucleic acid by precipitation with ethanol.
IBDV RNA extraction is done by suspending 1 ml of the pellet from the second centrifugation
of crude cell suspension in a 10 ml of RNA extraction buffer containing proteinase K, which is added
at a concentration of 0.1 mg/ml for cell culture and 0.2 mg/ ml for bursal material and incubated for 1 h

118. 118
PP
at 37
C. Phenol:chloroform:isoamylalcohol (25:24:1) extractions are performed until all white protein
materials at the interphase of the organic and aqueous phases are gone (Figures 1.0a and 1.1).
Figure 1.0a. Vortexing of phenol-chloroform Figure 1.1 Removing RNA from DNA-protein
interface
D. RNA Concentration
The most widely used method for concentrating nucleic acids is precipitation with ethanol. The
precipitate of nucleic acid, which is allowed to form in the presence of moderate concentrations of
monovalent cations, is recovered by centrifugation and redissolved in an appropriate buffer at the
desired concentration. The technique is rapid and quantitative.
IBDV RNA is precipitated by adding 2 ½ volumes of suspension of 100% cold ETOH and 1/10
of the total volume of ETOH and RNA with 3M NaOac. 3M NaOac should be added first. Precipitate
the nucleic acids overnight at -70C. Spin at 13,000 rpm at 4
C for 30 min using clear tubes to see the
pellets. Discard ETOH carefully. If pellet is hard, invert tube to remove excess ETOH. Gently dry
bottom of tube with nitrogen gas or place in a vacuum to remove ETOH. Resuspend RNA pellet in
DEPC treated water.
E. RNA Purification
Electrophoresis through agarose or polyacrylamide gels is the standard method used to
separate, identify, and purify nucleic acid fragments. The technique is simple, rapid to perform, and
capable of resolving fragments of nucleic acid that cannot be separated adequately by other procedures,
such as density gradient centrifugation. Furthermore, the location of nucleic acid within the gel can be
determined directly by staining with low concentrations of the fluorescent intercalating dye, ethidium
bromide. Bands containing as little as 1 – 10 ng of nucleic acid can be detected by direct examination
of the gel in ultraviolet light. If necessary, these bands of nucleic acid can be recovered from the gel
and used for a variety of purposes.

119. 119
Agarose and polyacrylamide gels can be poured in a variety of shapes, sizes, and porosities
and can be run in a number of different configurations. The choices within these parameters depend
primarily on the sizes of the fragments being separated. Polyacrylamide gels are most effective
for separating small fragments of DNA (5 – 500 bp). Their resolving power is extremely high, and
fragments of nucleic acid that differ in size by as little as 1 bp can be separated from one
another. Although they can be run very rapidly and can accommodate comparatively large quantities
of nucleic acid, polyacrylamide gels have the disadvantage of being more difficult to prepare and
handle than agarose gels. Polyacrylamide gels are run in a vertical configuration in a constant electric
field.
Agarose gels have a lower resolving power than polyacrylamide gels but have a greater
range of separation. Nucleic acid from 200 bp to approximately 50 kb in length can be separated on
agarose gels of various concentrations. Agarose gels are usually run in a horizontal configuration in
an electric field of constant strength and direction. Larger nucleic acids up to 10,000 kb in
length, can be separated by pulsed-field gel electrophoresis, in which the direction of the electric
flux is changed periodically.
Agarose Gel Electrophoresis
Agarose gels are cast by melting the agarose in the desired buffer until a clear, transparent
solution is achieved. The melted solution is then poured into a mold and allowed to harden.
Upon hardening, the agarose forms a matrix, the density of which is determined by the
concentration of the agarose. When an electric field is applied across the gel, nucleic acid, which is
negatively charged at neutral pH, migrates toward the anode. The rate of migration is determined by
the molecular weight.
Several different buffers are available for electrophoresis of nucleic acids. These
contain EDTA (pH 8.0) and Tris-acetate (TAE), Tris-borate (TBE), or Tris-phosphate (TPE) at a
concentration of approximately 50 mM (pH 7.5 – 7.8) (Table 1.0). Electrophoresis buffers are
usually made as concentrated solutions and stored at room temperature (Figure 1.2).
TAE is the most commonly used buffer (Table 1.0). However, its buffering capacity is
rather low, and it tends to become exhausted during extended electrophoresis (the anode becomes
alkaline, the cathode acidic). Replacement of the buffer or recirculation between the two reservoirs
is therefore advisable when carrying out electrophoresis for long periods of time at high current.
Both TPE and TBE are slightly more expensive than TAE, but they have significantly higher
buffering capacity. Double-stranded linear nucleic acid fragments migrate approximately 10%
faster through TAE than through TBE or TPE, but the resolving powers of these systems are almost
identical.

120. 120
TABLE 1.0 Commonly Used Electrophoresis Buffers
Buffer Working Solution Concentrated stock solution (per liter)
Tris-acetate
(TAE)
Tris-phosphate
(TPE)
Tris-borate
(TBE)
1x:0.04 M Tris-acetate
5.9 M EDTA
1x:0.09 M Tris-phosphate
0.002 M EDTA
0.5x:0.045 M Tris-borate
0.001 M EDTA
50x:242 g Tris base
57.1 ml glacial acetic acid
100 ml 0.5 M EDTA (pH 8.0)
10x:108 g Tris base
15.5 ml 85% phosphoric acid (1.679 g/ml)
40 ml 0.5 M EDTA (pH 8.0)
5x:54 g Tris base
27.5 g boric acid
20 ml 0.5 M EDTA (pH 8.0)
Figure 1.2. Automatic pipetting of fluids
Determine quantity of nucleic acid using UV absorbance
Preparation of an Agarose Gel
5. Seal the edges of a clean, dry, glass plate (supplied with the electrophoresis apparatus) with
autoclave tape so as to form a mold. Set the mold on a horizontal section of the bench (check
with a level).
2. Prepare sufficient electrophoresis buffer (usually 1 x TAE or 0.5 x TBE) to fill the
electrophoresis tank and to prepare the gel. Add the correct amount of powdered agarose to a
measured quantity of electrophoresis buffer in an Erlenmeyer flask or a glass bottle with a
loose-fitting cap. The buffer should not occupy more than 50% of the volume of the flask.

121. 121
It is important to use the same batch of electrophoresis buffer in both the electrophoresis tank
and the gel. Small differences in ionic strength of pH create fronts in the gel that can greatly
affect the mobility of the fragments.
3. Loosely plug the neck of the Erlenmeyer flask with tissue paper such as Kimwipes®. When
using a glass bottle, make sure the cap is loose. Heat the slurry in a boiling-water bath or a
microwave oven until the agarose dissolves.
Wearing an oven mitt, gingerly swirl the bottle or flask from time to time to make sure that any
grains sticking to the walls enter the solution. Take care—the agarose solution can become
superheated and may boil violently if it has been heated for too long in the microwave oven.
Undissolved agarose appears as small “lenses” floating in the solution. Check that the volume
of the solution has not been decreased by evaporation during boiling; replenish with water, if
necessary.
4. Cool the solution to 60C, and, if desired, add ethidium bromide (from a stock solution of 10
mg/ml in water) to a final concentration of 0.5 g/ml and mix thoroughly.
Caution: Ethidium bromide is a powerful mutagen and is moderately toxic. Gloves should be
worn when working with solutions that contain this dye. Stock solutions of ethidium bromide
should be stored in light-tight containers (e.g., in a bottle completely wrapped in aluminum
foil) in the refrigerator.
5. Position the comb 0.5 – 1.0 mm above the plate so that a complete well is formed when the
agarose is added. If the comb is closer to the glass plate, there is a risk that the base of the well
may tear when the comb is withdrawn, allowing the sample to leak between the gel and the glass
plate.
5. Pour the warm agarose solution into the mold. The gel should be between 3 mm and 5 mm
thick. Check to see that there are no air bubbles under or between the teeth of the comb.
7. After the gel is completely set (30 – 45 minutes at room temperature), carefully remove the
comb and autoclave tape and mount the gel in the electrophoresis tank.
8. Add just enough electrophoresis buffer to cover the gel to a depth of about 1 mm.
9. Mix the samples of RNA with the desired gel-loading buffer (Table 1.1). Slowly load the
mixture into the slots of the submerged gel using a disposable micropipette, an automatic
micropipettor, or, if you have a very steady hand, a Pasteur pipette.
The maximum volume of solution that can be loaded is determined by the dimensions
of the slot. A typical slot [0.5 cm x 0.5 cm x 0.15 cm] will hold about 37.5 l. However, to
reduce the possibility of contaminating neighboring samples, it is best to make the gel a little

122. 122
thicker or to concentrate the nucleic acid by ethanol precipitation rather than to fill the slot
completely.
For most purposes, it is not necessary to use a fresh pipette tip for every sample as long
as the tip is thoroughly washed with buffer from the anodic chamber between samples (Figure
1.3). However, if the gel is to be analyzed by hybridization or if bands of nucleic acid are to be
recovered from the gel, it is sensible to use a separate pipette tip for every sample.
Marker DNAs and RNAs of known size (which can be purchased from commercial
sources) should be loaded into slots on both the right and left sides of the gel. This makes it
easier to determine the sizes of unknown nucleic acids if any systematic distortion of the gel
should occur during electrophoresis. Since DNA and RNA of the same molecular weight can
migrate differently through the gel, you should have separate markers depending on which
nucleic acid you are testing for accurate size determination.
10. Close the lid of the gel tank and attach the electrical leads so that the nucleic acid
will migrate toward the anode (red lead). Apply a voltage of 1 – 5 V/cm (measured
as the distance between the electrodes). If the leads have been attached correctly,
bubbles should be generated at the anode and cathode (due to electrolysis) and,
within a few minutes, the bromo-phenol blue should migrate from the wells into the
body of the gel. Run the gel until the bromophenol blue and xylene cyanol FF
have migrated the appropriate distance through the gel.
During electrophoresis, the ethidium bromide migrates toward the cathode
(in the direction opposite to that of the nucleic acid). Extended electrophoresis
can remove much of the ethidium bromide from the gel, making detection of
small fragments difficult. If this occurs, restain the gel by soaking it for
30 – 45 minutes in a solution of ethidium bromide (0.5 g/ml) as previously described.
Figure 1.3a. Loading samples in the gel Figure 1.3b. Photography of gel

123. 123
Table 1.1 Gel Loading Buffers
Buffer type 6X Buffer Storage temperature
0.625% bromophenol blue
I 0.25% xylene cyanol FF
40% (w/v) sucrose in water
40
C
0.25% bromophenol blue
II 0.25% xylene cyanol FF
15% Ficoll (Type 400; Pharmacia) in water
room temperature
III
0.25% bromophenol blue
0.25% xylene cyanol FF
30% glycerol in water
40
C
IV 0.25% bromophenol blue
40% (w/v) sucrose in water
40
C

124. 124
P
P
These gel-loading buffers serve three purposes: They increase the density of the sample,
insuring that the DNA drops evenly into the well; they add color to the sample, thereby
simplifying the loading process; and they contain dyes that, in an electric field, move
toward the anode at predictable rates. Bromophenol blue migrates through agarose gels
approximately 2.2-fold faster than xylene cyanol FF, independent of the agarose
concentration. Bromophenol blue migrates through agarose gels run in
0.5x TBE at approximately the same rate as linear double-stranded DNA 300 bp in
length, whereas xylene cyanol FF migrates at approximately the same rate as linear
double-stranded DNA 4 kb in length. These relationships are not significantly
affected by the concentration of agarose in the gel over the range of 0.5% to 1.4%.
The presence of ethidium bromide (Etbr) allows the gel to be examined by
ultraviolet illumination at any stage during electrophoresis. However, some
people feel that sharper bands of nucleic acid are obtained when the gel is run in
the absence of ethidium. In this case, after electrophoresis is completed, stain the
gel by soaking it for 30 – 45 minutes in a solution of
ethidium bromide (0.5 g/ml) as described.
11. Turn off the electric current and remove the leads and lid from the gel tank. If Etbr
was present in the gel and electrophoresis buffer, examine the gel by ultraviolet
light and photograph the
gel. Otherwise, stain the gel with Etbr as described, and then photograph.
Photography
Photographs of gels may be made using transmitted or incident ultraviolet light
(UV). Most commercially available UV light sources emit UV light at 302 nm (Figure
1.3b). The fluorescent yield of Etbr:DNA complexes are considerably greater at this
wavelength than at 366 nm and slightly less than at short-wavelength (254 nm) light.
However, the amount of nicking of the nucleic acid is much less at 302 nm than at 254
nm.
The most sensitive film is Polaroid Type 57 or 667 (ASA 3000). With an
efficient ultraviolet light source (>2500 W/cm2
), a Wratten 22A filter, and a good
lens (ƒ=135 mm), an exposure of a
few seconds is sufficient to obtain images of bands containing as little as 10 ng of DNA.
With a long exposure time and a strong ultraviolet light source, the fluorescence emitted
by as little as 1 ng of nucleic acid can be recorded on film. For detection of extremely
faint bands, a lens with a shorter focal length (ƒ=75 mm) should be used in combination
with conventional wet-process film (e.g., Eastman Kodak No. 4155). This allows the
lens to be moved closer to the gel, concentrates the image on a smaller area of film, and
allows for flexibility in developing and printing the image. A cheaper more mobile
photographic set up is available from International Biotechnologies, Inc., attached to a

125. 125
light shield which fits directly over the gel. The system is called Quick Shooter Model
QSP. It uses polaroid 667 film.
Caution: UV radiation is dangerous, particularly to the eyes. To minimize
exposure, make sure that the ultraviolet light source is adequately shielded and
wear protective goggles or a full safety mask that efficiently blocks UV light.
Agarose Separation of IBDV RNA
1) Prepare a minigel (30 ml) containing 1 TBE buffer with 0.8% agarose
and Etbr (300 ml for minigel and 2 liters for a big gel). Add 75 ul Etbr
for 30 ml gel and 500 ul Etbr for 200 ml gel. Add Etbr to a final
concentration of 0.5 mg/ml.
2) Load 5 ul of RNA sample with ul of loading buffer
3) Load molecular weight marker lambda phage cut with Hind III enzyme
with loading buffer.
4) Run the minigel at 40 to 60 volts for 2½ hrs.
5) Examine the gel under UV light.
6) The lane with the IBDV RNA should contain two double stranded bands
(segments) of approximately 3.2 kb and 2.8 kb (Figure 1.3), respectively.
Genome segment A (3,200 bp) encodes a precursor polyprotein that is processed
into mature VP2, VP3, and VP4. The VP2 contains the antigenic regions responsible for
neutralizing antibodies, and for serotype and subtype specificity. The genome segment B
(2,800 bp) encodes VP1, the putative double stranded (DS) RNA polymerase (Muller and
Nitschke, 1987).
Most often, IBDV RNA require further purification especially if they are to be used
for reverse transcription and PCR. When contaminated by DNA, proteins, cellular RNA’s
salts, etc. as indicated by extra bands or smear, are apparent, various procedures such as
DNAase treatment, differential precipitation in lithium chloride, Gelase treatment or Rnaid
Purification (Bio 101, Inc. La Jolla, CA) may be done. The genome of reovirus contains 10
double stranded RNA segments. (Figure 1.4)

126. 126
DNAase Treatment of IBDV RNA
5. Assemble the following mixture: 40 ul RNA sample, 5 ul 10x DNAase buffer, 5 ul
DNAase
2. Incubate for 15 min at 37C
3. To the 50 ul sample mixture, add 50 ul equilibrated phenol, and 50 ul
chloroform-isopropyl alcohol
5. Shake for 5 min at room temperature (vortex), then centrifuge for 10 min at 12,000
x g
5. Remove aqueous phase and to it add 2½ volumes of 100% ethanol and 1/10
total volume 3M NaOac, which should be added first.
5. Precipitate at -20C for 30 min.
7. Centrifuge at 12,000 x g for 30 min at 4C.
8. Wash pellet with 70% alcohol.
9. Air dry or Nitrogen dry the pellet.
10. Suspend in 40 ul of DEPC sterile water.
IBDV Genome
Figure 1.3. IBDV Genome

127. 127
RNA Purification using Rnaid Kit (Bio 101)
Reoviridae
Table of Contents
• Viral Characteristics
• Classification
• Orthoreovirus
 Avian Orthoreovirus Infections
• Glossary
Viruses of the family Reoviridae (reo = respiratory, enteric, orphan) infect vertebrates, invertebrates,
higher plants, fungi and bacteria. They are unique in that they possess a linear, double-stranded,
segmented RNA genome. A number are important veterinary pathogens.
Viral Characteristics
• Reoviruses are naked double-stranded RNA viruses (60 – 80 nm in diameter) with an outer
shelled (outer shell and core) icosahedral capsid containing 10, 11 or 12 segments of double-
stranded RNA).
• They replicate conservatively in the cytoplasm, have a core-associated transcriptase and some
(especially orthoreoviruses) produce large cytoplasmic perinuclear inclusions with a
characteristic beehive pattern.
• Following entry into a host cell, the virion is partially uncoated. Unique to the Reoviridae,
replication occurs within partially uncoated virions as all of the enzymes necessary for
replication are present within the capsid. The dsRNA is transcribed to form +sense RNA, some
of which is sent into the cytoplasm for translation by ribosomes. The remainder is packaged into
partially assembled virions. Within the virions, the complementary –sense RNA is synthesized
resulting in a dsRNA genome within the newly formed virions.
• Some serotypes share a common complement fixation antigen, but can be distinguished by
hemagglutination inhibition and neutralization techniques.
• They vary in stability; the orthoreoviruses and rotaviruses retain infectivity over a wide pH
range. Mammalian orthoreoviruses are resistant to a number of common disinfectants.

128. 128
Orthoreovirus
Avian Orthoreoviruses
These non-mammalian orthoreoviruses share a common group antigen. The eleven serotypes produce
syncythia in cell cultures and infections in chickens and turkeys. A variety of infections are produced
depending upon the particular 128rthoreovirus involved. They include arthritis, tendonitis,
gastroenteritis, hepatitis and myocarditis with weight loss. The infections are common in commercial
flocks.
Virus isolation and identification, although strait forward, is not usually feasible. The viruses are
readily identified by the fluorescent antibody staining of cryostat sections of tissues.
Good management practices with thorough cleaning and disinfection of quarters helps reduce losses.
Active immunization is complicated by the involvement of different serotypes of virus.
Figure 1.4. 10 segments of Reovirus genome and 2 segments of IBDV genome
Isolation of RNA from solution
5. Add 3 volumes of RNA Binding Salt and mix well.
2. Continue with step 3 below.
Isolation of RNA from agarose
5. Excise desired RNA band from Etbr stained gel and determine approximate volume by its
weight. Place gel slice in microcentrifuge tube.

129. 129
2. Add 3 volumes of RNA binding salt (i.e. to 0.1g gel slice add 0.3 ml of RNA Binding Salt).
Mix and incubate at room temperature for 10 min to dissolve agarose. Alternatively, place tube
in 45-55
C water bath to dissolve agarose more rapidly. Continue with step 3 below.
Isolation of RNA from polyacrylamide
5. Excise band from Etbr stained gel and determine approximate volume by weight. Place into
microcentrifuge vial. If gel concentration is 10% or higher, crush or cut into small pieces. Add
3 volumes of RNA binding salt. Soak for 20 min at 60
C. Remove liquid with small
bore pipette tip avoiding gel pieces, and transfer to new vial.
2. Add 2ul of 10% acetic acid per every 0.5 ml of liquid to change pH to 5.0-5.5. This will
increase recovery efficiency.
3. Estimate the amount of RNA expected and add 1ul of RNAMATRIX for every ug of RNA.
Add a minimum of 5 ul of RNAMATRIX. Mix well and allow binding of RNA to the matrix
for at least 5 min at room temperature. Mix occasionally to keep RNAMATRIX in suspension
during absorption.
5. Spin for 1 min in microcentrifuge at maximum speed to pellet RNA/RNAMATRIX complex.
Remove supernatant to save aside; if supernatant contains residual RNA, more RNAMATRIX
can be added for complete recovery. Spin pellet again briefly and remove residual liquid with
small bore pipette tip.
5. Add 500 ul of RNAWASH solution and resuspend pellet completely by mixing with pipette tip.
Spin for 1 min in microcentrifuge at maximum speed and remove supernatant.
5. Repeat washing step 5. One or two times. After last wash, spin tube again briefly and remove
residual liquid with small bore pipette tip.
7. Resuspend pellet in RNAase free water. Use 10-20ul per 5ul RNAMATRIX. Mix thoroughly
with pipette tip and elute RNA by incubating at 45-550
C for 5 min. Remove supernatant
containing RNA to sterile vial.
Cellular RNA’s can be separated from IBDV RNA using differential precipitation in
Lithium Chloride according to Diaz-Ruiz and Kaper, 1978. In this procedure, the small
molecular weight RNA’s are soluble in 4M LiCl, after 2 hours in ice, whereas the double-
stranded IBDV RNA is precipitated after centrifugation at 15,000 x g for 20 minutes at 0
C.
The IBDV can again be checked for purity by running in a gel (figures 1.4 and 1.7).
Spectrophotometric Determination of the Amount of RNA
For quantitating the amount of DNA or RNA, readings should be taken at wavelengths of 260
nm and 280 nm (Figure 1.5). The reading at 260 nm allows calculation of the concentration of

130. 130
nucleic acid in the sample. An OD of 1 corresponds to approximately 50 g/ml for double-
stranded DNA, 40 g/ml for single-stranded DNA and RNA, and 20 ug/ml for single-stranded
oligonucleotides. The ratio between the readings at 260 nm and 280 nm (ODB
260B/ODB
280B)
provides an estimate of the purity of the nucleic acid. Pure preparations of DNA and RNA
have ODB
260B/ODB
280B values of 1.8 and 2.0, respectively. If there is contamination with protein or
phenol, the ODB
260B/ODB
280B will be significantly less than the values given above, and accurate
quantitation of the amount of nucleic acid will not be possible.
Figure 1.5. Spectrophotometric quantitation of RNA
Rapid Method for the Isolation of IBDV RNA
The previously mentioned technique for the isolation of IBDV RNA is rather long and
laborious. This method takes nearly 1.5 days, requires at least 15 bursae, and several
ultracentrifugations. A faster less expensive method has recently been developed. This method
requires, less than 1 day, only 1 bursae, and no ultracentrifugation. However, it produces only a small
amount of RNA, which then must be transcribed into cDNA and the amplified using the polymerase
chain reaction (PCR). The PCR method will be described in detail in a later section.
The bursae (as little as 1) are taken from infected birds and placed immediately in NET buffer
(100 mM NaCl, 1mM EDTA, 10 mM Tris (ph 8.0)) and then stored at -70 C until needed. Bursae are
homogenized with an equal volume of RNA extraction buffer (100 mM MaC1, 1mM EDTA, 10 mM
Tris, 02% SDS), and then frozen at -70C for 5 minutes. The samples are centrifuged at 4,000 rpm for
15 minutes. The supernatant is digested with 100 ul of proteinase K (10 mg/ml) at 37C for 1 hour.
RNAs are extracted with equal volume of phenol:choloform:isoamylethanol (25:24:1) and precipitated
with 0.6 volume of isopropanol. With this method no visible RNA pellet will be seen and may require
two separate PCR runs before a nucleic acid band is seen in an electrophoresis gel. The second PCR is
called a nested PCR which uses a second set of internal primers and will be described later.

131. 131
Figure 1.5. Roller Bottle Apparatus for cell culture
RAPID METHOD FOR IBDV RNA EXTRACTION
MATERIALS:
Bursae from chicken (infected and control) or roller bottles (figure 1.5) containing infected cell culture.
RNA extraction buffer
100 mM NaCl (58.45 MW: 5.8 g/L)
1 mM EDTA (202.25MW: 0.29 g/L)
10 mM Tris (pH 8.0) (157.60 MW: 1.58 g/L)
0.2 % SDS (2 g/L)
-70 C freezer
Centrifuge
Proteinase K (10 mg/ml)
Phenol:chloroform:isoamylalcohol (25:24:1)
100% ETOH
70% ETOH

132. 132
DEPC H20
Homogenizer
PROCEDURE:
5. Homogenize 1 or 2 bursae with equal volumes of RNA extraction buffer
2. Freeze the sample at 70
for 5 min
3. Thaw samples and centrifuge at 4000 rpm for 15 min
4. Pour off supernatant and digest with 100 l of Proteinase K at 37 C for 1 h
5. Add an equal volume of phenol:chloroform:isoamylalcohol (25:24:1)
5. Centrifuge at 12000 X G for 15 min
7. Aspirate off the supernatant containing RNA and transfer to a new tube
8. Precipitate RNBA by adding 2.5 volumes of 100% ETOH and 1/10 volume of 3M NaoAc
9. Place tubes at -70 C for 30 min (at this point, RNA can be precipitated overnight)
10. Remove from freezer and centrifuge at 12000 X G for 30 min
11. Carefully remove the supernatant with a sterile pipette
12. Wash the pellet with 70% ETOH by adding ETOH and aspirating it off again with a pipette
13. Dry the pellet under a stream of NB
2B
14. Resuspend the pellet in 10 l of DEPC treated water
15. The RNA is now ready for RT-PCR

133. 133
Figure 1.7. Gel loading buffer, pouring gel, and photographing gel.
References
Diaz-Ruiz, V. and J.M. Kaper, 1987. Isolation of viral double stranded RNA genome. Prep. Biochem.
8:1-17.
Muller, H. and R. Nitschke, 1987. Molecular weight determination of two segments of double-
stranded RNA of infectious bursal disease virus, a member of the birna virus group. Med.
Microbial. Immuno 1.176:113-121.
Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989. “Gel Electrophoresis of DNA,” “Extraction,
Purification, and Analysis of Messenger RNA from Eukaryotic Cells,” “Appendix E:
Commonly used techniques in molecular cloning” In Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Pp. 6.3-6.19, 7.3-7.5
and E.5-E.17.
Utable of Contents

134. 134
RESTRICTION FRAGMENT LENGTH POLYMORPHISM
Introduction
Examination of DNA fragment patterns by electrophoresis in agarose gels following digestion
with restriction endonucleases is a sensitive method for distinguishing between strains of
microorganisms. The technique has been described for numerous bacteria, mycoplasma and DNA
viruses. If workers use the enzymes, which cut DNA in specific sites, the result of DNA fragments are
separated by electrophoresis in a gel. Differences in the number and the length of the fragments can be
used to distinguish between closely related organisms. This technique is commonly referred to as
restriction endonuclease analysis, restriction fragment length polymorphism (RFLP), or DNA finger
printing. Before one can utilize these techniques, the concept of restriction enzyme should be
thoroughly understood.
An important tool used by the molecular biologist in manipulating DNA, is restriction
enzymes. Over the years, the number and uses of these enzymes have increased as new molecules
have been discovered, our understanding of the details of the enzymatic reactions has improved, and
many commercial manufacturers of products have emerged to guarantee the widespread availability of
these reagents. With these advances, the task of the molecular biologist has been both simplified and
expanded in scope. In this section, we describe many of the properties and uses of these important
components in various procedures.
Restriction enzymes bind specifically to and cleave double-stranded DNA at specific sites
within or adjacent to a particular sequence known as the recognition sequence. These enzymes cut the
DNA at the recognition site and then dissociate from the substrate. These enzymes are referred to as
restriction endonucleases. Other enzymes may modify the DNA such as DNA methylation enzymes.
In addition to cutting the DNA, they may change it with a separate methylase that modifies the
recognition site. Restriction enzymes may recognize specific sequences that are four, five or six
nucleotides in length.
Different manufacturers of restriction enzymes recommend different digestion conditions, even
for the same restriction enzyme. Because most manufacturers have optimized the reaction conditions
for their particular preparations, it is recommended to follow the instructions on the information sheets
supplied with the enzymes. Some manufacturers also supply concentrated buffers that have been
tested for efficacy with each batch of purified enzyme. These buffers should be used whenever
possible.
Buffers for different restriction enzymes differ chiefly in the concentration of NaCl that they
contain. When DNA is to be cleaved with two or more restriction enzymes, the digestions can be
carried out simultaneously if both enzymes work well in the same buffer. If the enzymes have
different requirements, two alternatives are possible: (1) The DNA should be digested first with the
enzyme that works best in the buffer in lower ionic strength. The appropriate amount of NaCl and the
second enzyme can then be added and the incubation continued. (2) A single buffer (potassium
glutamate buffer [KGB]) can be used for virtually all restriction enzymes.

135. 135
http://arbl.cvmbs.colostate.edu/hbooks/genetics/biotech/index.html
Pouring, loading, and running an agarose gel.
Setting Up Digestions with Restriction Enzymes
The following procedure is for a typical reaction containing 0.2—1 µg of DNA.
For digestion of larger amounts of DNA, the reaction should be scaled appropriately.
5. Place the DNA solution in a sterile microfuge tube and mix with sufficient water to give a volume
of 18 ul.
2. Add 2 ul of the appropriate 10 x restriction enzyme digestion buffer. (2 x KGB may also be used if
the solution volumes are adjusted appropriately.) Mix by tapping the tube.
2 x KGB
200 mM potassium glutamate
50 mM Tris-acetate (pH 7.5)
20 mM magnesium acetate
100 µg /ml bovine serum albumin (Fraction V; Sigma)
1 mM -mercaptoethanol
3. Add 1-2 units of restriction enzyme, and mix by tapping the tube.

136. 136
One unit of enzyme is defined as the amount required to digest 1 ug of DNA to completion in 1 hour
in the recommended buffer and at the recommended temperature in a 20-ul reaction.
5. Incubate the mixture at the appropriate temperature for the required period of time.
5. Stop the reaction by adding 0.5 M EDTA (pH 8.0) to a final concentration of 10 mM.
5. If the DNA is to be analyzed directly on a gel, add 6 ul of gel-loading buffer, mix by vortexing
briefly, and load the digest into the gel slot.
7. The mixing of the sample with loading buffer, preparation of loading and running buffers,
preparation of the gel and electrophoresis tank, adding of the sample to the gel, running, staining and
photographing of the gel, will be as previously described earlier in this chapter for IBDV RNA.
8. Restriction enzymes are expensive! Costs can be kept to a minimum by following the advice given
below.
• Many restriction enzymes are supplied by the manufacturer in concentrated form. Often, l g
of many enzyme preparations is sufficient to digest 10 g of DNA in 1 hour. To remove small
quantities of enzyme from the container, briefly touch the surface of the fluid with the end of a
disposable pipette tip. In this way, it is possible to remove as little as 0.1 l of the enzyme
preparation.
• Concentrated solutions of restriction enzymes may be diluted immediately before use in 1 x
restriction enzyme buffer. Never dilute an enzyme in water, since it may denature.
• Restriction enzymes are stable when stored at -200
C in a buffer containing 50% glycerol.
Restriction enzymes should not be stored in a self thawing freezer, which several times a day
raises the temperature to keep the freezer from forming ice crystals. When carrying out
restriction enzyme digestions, prepare the reactions to where all reagents except the enzyme
have been mixed. Take the enzyme from the freezer, and immediately place it on ice or in a
commercially available cooler rack. It is also a good idea to store the enzymes in the cooler
rack in case the freezer raises temperature for any reason. Use a fresh, sterile pipette every time
you dispense enzyme. Contamination of an enzyme with DNA or another enzyme can be costly
and can create time-consuming problems. Work as quickly as possible, so that the enzyme is
out of the freezer for as short a period of time as possible. Return the enzyme to the freezer
immediately after use.
• Keep reaction volumes to a minimum by reducing the amount of water in the reaction as much
as possible. However, make sure that the restriction enzyme contributes less than 0.1 volume
of the final reaction mixture other wise, the enzyme activity may be inhibited by glycerol.
• Often, the amount of enzyme can be reduced if the digestion time is increased. This can result
in considerable savings when large quantities of DNA are cleaved. Small aliquots can be
removed during the course of the reaction and analyzed on a minigel to monitor the progress of
the digestion.When digesting many DNA samples with the same enzyme, calculate the total
amount of enzyme (plus a small excess to allow for the losses involved in transferring several
aliquots) that is needed. Remove the calculated amount of enzyme solution from the stock, and
mix it with the appropriate volume of 1 x restriction enzyme buffer. Dispense aliquots of the
enzyme buffer mixture into the reaction mixtures.

137. 137
Restriction enzyme analysis for Mycoplasma gallisepticum
Mycoplasmae are important pathogens of poultry. M. gallisepticum (MG) is a common cause of
clinically respiratory disease in chickens and turkeys, whereas M. synoviae (MS) infections frequently
occurs as a subclinical upper respiratory disease that may become systemic and result in infectious
synovitis, an acute to chronic disease of chickens and turkeys. MS may also cause lameness, retarded
growth, and increase condemnation. It is important with either organism to isolate and identify the
pathogens as quickly as possible.
Restriction enzyme analysis has been used to compare field isolates of MG and MS. This helps
to identify the epidemiology of the organisms to learn about the source and spread of the organisms in
poultry flocks. RFLP’s has also been used with MG isolates to differentiate them from commonly used
vaccine strains.
Preparation of DNA
Broth cultures of cloned mycoplasma strains are propagated in 200 to 500 ml volumes of (Frey)
broth medium prepared as described in the earlier section of mycoplasma. Broth cultures are harvested
by centrifugation at 20,000 x g for 30 min, resuspended in 10 ml phosphate buffered saline (0.1 M
phosphate, 0.33 M NaCl, pH 7.4) and centrifuged as above. The pellet is suspended in 5.0 ml of 10
mM TrisCl, pH 8.0, 10 mM EDTA, 10 mM NaCl. The organisms are lysed by adding 100 l 25%
(w/v) SDS and Proteinase K to a final concentration of 100 g/ml, and the mixture incubated
overnight at 37
C. RNAse A (Boehringer Mannheim), pre-treated at 100C for 15 min, is added to a
concentration of 100 g/ml, and RNAse TB
1B (Sigma) is added to a concentration of 2 g/ml, and the
mixture incubated at 37
C for 3 min.
The lysate is extracted sequentially with 5 ml volumes with the following: (I) Redistilled phenol
equilibrated with 500 mM TrisCl, pH 8.0, 10 mM EDTA, 10 mM NaCl. (ii) 50% phenol, 50% 24:1
(v/v) chloroform/isoamyl alcohol. (iii) 24:1 (v/v) chloroform/isoamyl alcohol. (iv) The reaction
mixtures are mixed mechanically for 10 min at 20C, are centrifuged at 500 g for 10 min, and the
organic phase removed with a pipette. 2.5 M sodium acetate is added to make a final concentration of
0.25 M, and the DNA is precipitated with two volumes of ice cold absolute ethanol and left overnight
at -20 C. The precipitated DNA is wound on to a Pasteur pipette with a fire sealed tip and placed in
1 to 2 ml of TE (10mM TrisCl. pH 8.0, 1.0 mM EDTA) and allowed to dissolve at 37C for 2 to 3 h and
stored in aliquots at -20 C.
DNA digestion
Digestion mixtures contained 2 l (10 to 50 units) of restriction endonuclease (Pharmacia), 2
l of 10x digestion buffer recommended by the manufacturer for the enzyme, and sufficient DNA to
produce clear DNA bands (usually 3 to 12 l of the DNA as prepared above). HB
2BO is added to make
a total digestion volume of 20 l. Incubation is at 37 C for 2 to 4 h. Five ul loading buffer (0.25%
bromophenol blue, 0.25% xylene cyanol, 15% Ficoll type 400) are then added.
Electrophoresis of digested DNA
Electrophoresis is conducted in a 20 x 20 cm horizontal slab gel electrophoresis apparatus using
TPE (0.02 M Tris-phosphate, 0.002 M EDTA) buffer. Gels are poured to a depth of 4 mm with 0.7%
agarose (Agarose NA, Pharmacia) in TPE. The DNA digestion mixtures, including two flanking lanes

138. 138
with lambda DNA double cut with EcoRI and HindIII as molecular weight markers, are added (20) and
electrophoresis conducted at 50 V (1.6 V/cm) for 16 to 17 h at 200
C. After electrophoresis, the gels are
stained for 1 h at 200
C with 500 g ethidium bromide in 1 liter H O. They are destained for 30 min in 1B
2B
liter of HB
2BO and exposed for 45 s with UV light from a transilluminator camera with a Wrattan filter.
Restriction enzyme analysis for Mycoplasma synoviae
Procedures for MG and MS are similar with a few modifications. MS is propagated in Frey’s
broth medium with 12% swine serum. Cells are harvested by centrifugation and washed three times in
phosphate –buffered saline (pH 7.2, 150 mM), and pellets stored at -700
C.
Preparation of DNA
Cell pellets in microcentrifuge tubes are resuspended in 1.0 ml of TNE buffer (25 mM Tris-Cl
[pH 7.4], 150 mM NaCl, 2 mM EDTA) and transferred to 15 ml glass centrifuge tubes. Cells are lysed
by adding 1.0 ml 5% sodium dodecyl sulfate (SDS) and incubating at room temperature for 5 minutes.
DNA is extracted with 2.0 ml TNE-saturated phenol-chloroform (350 g redistilled phenol, 70 ml
chloroform, 50 ml m-cresol, 0.4 g 8-hydroxyquinoline) by vortex mixing, and then incubating for 10
minutes on ice. The aqueous phase is collected after centrifugation. DNA is precipitated by addition
of two volumes of cold (-20 0
C) 95% ethanol. Precipitate collected by centrifugation at 15,000 x g for
15 minutes, decanting the supernatant, and allowing the tube interior to dry. Precipitated DNA is
resuspended in 1.0 ml distilled water containing Rnase A (50 µg /ml, Sigma Chemical Co., St. Louis,
Missouri), incubated 2 hr at 37 0
C, and stored at -20 0
C.
DNA Digestion
Digestion mixtures contained 1 ul (10 units) of restriction endonuclease (RE), BglII, EcoRI, or
HindIII (Bethesda Research Laboratories, Gaithersburg, MD), 3ul of 10 x digestion buffer, and
sufficient DNA (usually 15 to 25 ul) to produce clear DNA bands. Distilled water is added to make a
total digestion volume of 30 ul, and the mixture incubated for 1.5 hr at 37 C. Six ul of loading buffer
(0.25% bromophenol blue, 0.25% xylene cyanol, 15% Ficoll type 400) is added.
Electrophoresis of digested DNA
Electrophoresis of digested DNA is conducted in a 15 x 20-cm horizontal slab gel
electrophoresis apparatus. Gels are poured to a depth of 5 mm with 0.7% agarose (Agarose NA;
Pharmacia AB, Uppsala, Sweden) in TBE (89 mM Tris [pH 8.3], 89 mM boric acid, 2 mM EDTA)
buffer (Sigma). Gels are submerged in TBE; DNA digestion mixture (20 to 30 ul) is added, and
electrophoresis conducted at 36 V (1.2 V/cm) for 15 hr. Gels are stained for 30 minutes with 750 µg
ethidium bromide (Sigma) in 500 ml deionized water, destained for 20 minutes in 500 ml deionized
water, exposed with ultraviolet light from a transilluminator and photographed.
This technique is rapid, highly sensitive and provides useful data for comparing and differentiating
mycoplasma strains in epidemiological studies.

139. 139
A relatively new technique for staining DNA in gels has evolved (Bassam, et al., 1991). This
method uses silver staining and is highly sensitive in the nanogram range. It does not require the use
of Etbr or UV light and produces a permanent copy of the gel. The draw back of the procedure is that
item can only be used with polyacrylamide gels (PAGE) and requires a long period for staining and
destaining.
A procedure for set up of a mini PAGE apparatus is listed in pages 246-251 under SDS-PAGE
electrophoresis. A formula for preparing a PAGE gel is listed below (Table 3.0). SDS is not needed
when working with DNA.
Table 3.0. Preparation of Polyacrylamide Gel (2)
Urea 4.2 g
10x TBE 1.0 ml
40% polyacrylamide/
Bis Solution
(29:1. 3.3% C) 1.2 ml
DEPC water 4.2 ml
Stir till urea completely dissolves.
Add 90 ul of 10% Ammonium persulfate and 10 ul TEMED simultaneously. Stir for a few seconds
and then fill the gel cell.
The following describes a procedure for preparation of the running buffer.
MINI-PROTOCOL
PCR Purity Plus™ Verification Kit
Note: TAE or TTE buffer can be substituted for TBE buffer in this protocol.
5. For each 10 ml of gel solution (enough to fill one cassette), mix:
U1 mm 0.7 0.5U
PCR Purity Plus Gel Solution 5 ml 3 2
(2X Concentrate)
10X TBE 1 ml 0.6 0.4
Deionized Water 4 ml 2.4 0.6
2. Add: 7 l TEMED, mix gently 4.2 2.1
70 l 10% APS (fresh), mix gently 42 l 28 l
3. Pour into cassette slowly without introducing bubbles. Fill to top of smaller plate.
5. Insert a LayFlat™ comb with ridge touching shorter plate, clamp and place cassette in a horizontal
position.
5. Wait 20 minutes, remove comb and rinse wells with 1X TBE buffer. Do not remove bottom
spacer.

140. 140
5. Mount cassette on electrophoresis apparatus. Fill buffer chambers with 1X TBE buffer.
7. Add 1 l 6X loading buffer to each 5 l PCR sample and mix.
8. Add 1 l 6X loading buffer to a 5 l aliquot of BioMarker™ EXT Plus.
9. Load 5 l sample and marker mixtures in wells.
10. Electrophorese at 70-200 V until the dye front reached the end of the gel.
11. Detach cassette from apparatus, cut through tape and clear seal at bottom of side spacers, separate
plates with a spatula. Cut gel and bottom spacer away from glass side spacers. Leave the bottom
spacer attached to the gel.
Nucleic acid samples were applied to the gels in 5 l samples containing 5 M UREA and
0.0008% xylene cyanol and electrophoresis was at 70 V until the dye front reached the end of the gel.
The steps were done in plastic containers and liquids were removed by suction. The developer
and silver nitrate solutions were prepared immediately before use. Impregnation with silver nitrate
was under normal overhead fluorescent room lighting. The developer solution was replaced if a dark
precipitate formed during development.
Preservation of gels was by drying onto polyester backing film (GelBond PAG; FMC
BioProducts, Rockland, ME) or between plastic sheets (BioGelWrap; BioDesign Inc., Carmel, NY).
Polyester backed gels were first soaked in 50% ethanol for 10 min then dried at room temperature or in
an oven between 37 and 50C. Gels dried between plastic sheets were first soaked for 10 min in
distilled water. None of these treatments produced detectable image loss. Preserved gels suffered no
apparent fading even after 6-8 months although it is conceivable that trace thiosulfate in preserved gels
may eventually result in some image loss after several years. Extra washing of the gels prior to the
drying step should circumvent this potential problem.
Nitric acid was obtained from MalincKroft Inc., sodium thiosulfate and potassium dichromate were
from Sigma Inc., silver nitrate was from EM Science, and sodium carbonate was from Eastman Kodak
Inc. All solutions were prepared in deionized water (Table 3.1).
Gels polymerized onto polyester backing films are handled easily during staining, and when
dried produce a permanent record.

141. 141
P
P
B
2B B
3B
a,b
b
Table 3.1. Procedures for Silver Staining of Nucleic Acids
Step Improved procedure
1. Fix 10% acetic acid; 20 min
2. Wash —
3. Pretreat —
4. Rinse HB
2BO; 2 min, 3 times
5. Impregnate AgNOB
3B (1 g/liter), 1.5 ml 37% HCOH/liter; 30 min
6. Rinse (HB
2BCOB
3B 20 s, optional)
7. Developa
Na CO (30 g/liter), 1.5 ml 37% HCOH/liter,
NaB
2BSB
2BOB
3Bx5HB
2BO (2 mg/liter); 2—5 min
8. StopP
a
P
10% acetic acid, 5 min
P P
the step was done at 10C if gel was cast on polyester film.
P P
after step 8, gels were either stored in acetic acid at 4C or preserved by drying.
References
Bassam, B.J., Gustavo Caetana-Anollis, and Peter M. Gresshoff, 1994. Fast and sensitive silver
staining of DNA in polyacrylamide gels.
Ley, D.H. and A.P. Avakian, 1992. An outbreak of mycoplasma synoviae infection in North Carolina
turkeys: comparison of isolates by sodium dodecyl sulfate—polyacrylamide gel electrophoresis and
restriction endonuclease analysis. Avian Diseases 36:672-678.
Kleven, S.H., G.F. Browing, D.M. Bulasch, E. Ghiacas, C.J. Morrow, and K.G. Whithear, 1988.
Examination of mycoplasma gallisepticum strains using restriction endonuclease DNA analysis and
DNA — DNA hybridization. Avian Pathology, 17:559-570.
Sambrook, J., E.F. Fritsch and T. Maniatis, 1989. “Restriction and DNA methylation Enzymes,”
“Digestion of DNA with restriction enzymes.” In Molecular Cloning A Laboratory Manual. Cold
Spring Harbor Laboratory Press. Pp 5.3, 5.28-5.31.
Table of Contents

142. 142
Hybridization
Introduction
Nucleic acid sequences can be assessed in terms of either similarity or complementarity.
Similarity between two sequences is given by the proportion of bases (for single-stranded sequences)
or base pairs (for double-stranded sequences) that is identical (Figure 4.0).
Complementarity is determined by the rules for base pairing between A•T and G•C. In a perfect
duplex of DNA, the strands are precisely complementary. If we compare two different but related
double-stranded molecules, therefore, each strand of the first molecule will be similar to one strand of
the second molecule and will be (partly) complementary to the other strand of the second molecule.
Complementarity can be measured directly by the interaction between single-stranded nucleic acids. If
double-stranded molecules are denatured into single strands, the complementarity between the single
strands can indicate similarity between the original duplex molecules.
It is possible to measure complementarity because the denaturation of DNA is reversible. The
ability of the two separated complementary strands to reform into a double helix is called
renaturation.
Renaturation depends on specific base pairing between the complementary strands. The
reaction takes place in two stages. First, single strands of DNA in the solution encounter one another
by chance; if their sequences are complementary, the two strands base pair to generate a short double-
helical region. Then the region of base pairing extends along the molecule by a zipper-like effect to
form a duplex molecule.
Renaturation describes the reaction between two complementary sequences that were separated
by denaturation. However, the technique can be extended to allow any two complementary nucleic
acid sequences to anneal (bind) with each other to form a duplex structure. The reaction is described
hybridization when nucleic acids from different sources are involved. The ability of two nucleic acid
preparations to hybridize constitutes a precise test for their complementarity since only
complementary sequences can form a duplex structure.
Hybridization reaction exposes two single-stranded nucleic acid preparations to each other and
then measures the amount of double-stranded material that forms. There are two ways of performing
the reaction: solution (liquid) hybridization and filter hybridization.
In liquid hybridization the preparations of single-stranded DNA are mixed in solution. When
large amounts of material are involved, the reaction may be followed by the change in optical density.
With smaller amounts of material, one of the preparations may carry a radioactive label, whose entry
into duplex form is followed by determining the amount of double-stranded DNA containing the label.
Double-stranded DNA can be assayed either by using chromatography to separate duplex DNA from
single strands or by degrading the single strands that have not reacted and measuring the amount of
material that remains.
Solution hybridization is not accurate for investigating the relationship of two preparations if
one or both consist of duplex DNA. The problem is that if two duplex DNA preparations are

143. 143
denatured and then the single strands are mixed, two reactions may occur. The original
complementary single strands can renature, or each single strand can hybridize with a complementary
sequence in the other DNA. The competition between the two reactions makes it difficult to assess
hybridization.
This difficulty can be overcome by immobilizing one of the DNA preparations so that it cannot
renature. Nitrocellulose or nylon filters have the useful property of absorbing single strands of DNA,
and once a filter has been used to absorb DNA, it can be treated to prevent any further absorption of
single strands.
A DNA preparation is first denatured and the single strands are absorbed to the filter. Then a
second denatured DNA (or RNA) preparation is added. This material absorbs to the filter only if it can
base pair with the DNA that was absorbed. In this experimental procedure, a labeled RNA or DNA
preparation is added to the filter, allowing the extent of reaction to be measured as the amount of label
retained by the filter.
The extent of hybridization between two single-stranded nucleic acids can be taken in principle
to represent their degree of complementarity. Two sequences need not be perfectly complementary to
hybridize; if they are closely related, but not identical, an imperfect duplex may be formed in which
base pairing is interrupted at positions where the two single strands do not correspond.
The amount of binding of two strands can be controlled by altering the stringency of the
hybridization reaction and washing of the hybridized filter. The stringency can be controlled by
altering the temperature and ionic strength of the solution. High temperatures in the hybridization
reaction or washing step, and high salt concentrations will result in a high stringency situation and will
allow binding of only closely related molecules. Low temperature and low salt concentrations cause
low stringency and will promote partial binding of less closely related molecules.
Figure 4.0. Hybridization

144. 144
Types of Filter Hybridizations
The following are commonly used techniques which incorporate filter hybridization:
Southern Transfer. A DNA hybridization technique that is universally used today is Southern
transfer. In the most commonly used version of Southern transfer, DNA is digested with restriction
endonuclease (RE) enzymes, separated according to size by electrophoresis in an agarose gel,
denatured to give single-stranded fragments, and transferred to either a nylon or nitrocellulose
membrane. A labeled DNA or RNA probe is added to the immobilized DNA on the filter and
incubated for varying amounts of time depending on the concentration and strength of the probe and
target (filter bound) nucleic acid. Next, the unhybridized labeled probe is washed off and the
membrane is exposed to a sheet of X-ray film if the probe is radioactive. The dark bands on the
developed film indicate the positions of DNA that are complementary to the probe. With this
procedure, it is possible to detect single-copy genes in 10 µg of genomic DNA. If the probe is
nonradioactive an enzymatic reaction is allowed to take place resulting in a colored dot or band on the
filter.
Dot Blots. DNA dot blotting involves similar technologies where samples of nucleic acid are
spotted at different dilutions on the same membrane. A labeled probe is hybridized to the nucleic acid
on the membrane using the same procedure as in a Southern transfer. The separation of nucleic acid
prior to hybridization, as is done in Southern transfers, is skipped in dot blot hybridizations.
Consequently, the dot blot hybridization signal is a result of the sum of all nucleic acid hybridizing to
the probe and the amount of information obtained from dot blot hybridizations is less than from a
Southern blot. However, dot blots are simple and many samples can be processed at the same time. In
addition, if a series of known quantities of nucleic acid are applied as standards to the same filter, a
comparison of the signal intensities can be used to quantitate nucleic acid. Pico-gram quantities of
specific nucleic acid can be detected with dot blotting.
Northern Blots. A procedure to electrophoretically separate RNA and transfer it to a
membrane for hybridization to a probe similar to the Southern transfer is called Northern transfer.
Northern transfers differ from Southern transfers in several respects. Prior to electrophoresis, strong
denaturants such as glyoxal, methylmercuric hydroxide, or formaldehyde must be used to disrupt the
secondary structure of RNA. It is also crucial that all solutions and glassware be ribonuclease free. In
addition, RNA is degraded more rapidly at high temperatures and in alkaline solutions. Therefore,
hybridizations are normally performed at the lowest possible temperature in slightly acidic buffers.
In situ Hybridizations. Nucleic acids occupy specific sites within cells and tissues. This
information on the location of RNA and DNA is lost when nucleic acids are extracted from cells. In
situ hybridization techniques were developed to circumvent this problem and permit the direct probing
of cytological preparations. The usual procedure is to fix and section tissues in a manner that provides
good histological detail. The labeled DNA or RNA probes are added directly to slides containing the
tissue sections. After incubation, the non-hybridized probed is washed off and replaced with a thin
layer of photographic emulsion. The coated slides are incubated in the dark for several days to several
weeks and developed if a radiolabeled probed is used, but if a nonradioactive probe is used and
enzymatic color reaction can occur after a few hours of incubation of appropriate reactants. Under a
light microscope, colored particles correspond to the sites where the probe hybridized. Under optimal

145. 145
35
P P
32
conditions, in situ hybridizations are sensitive enough to detect virus-infected cells in a heterogeneous
population.
A simple derivation of in situ hybridization is tissue print hybridization. This elegant, fast
technique involves the imprinting of tissues directly onto nitrocellulose filters. It circumvents the
fixing, processing and sectioning of tissues on to slides. This procedure saves approximately two days
of time and reagents. However, the cellular morphology with this procedure cannot approach that of
standard processing of tissues for routine histopathologic and in situ procedures. Nevertheless, filter
paper containing tissue imprints can be processed for hybridization in a similar manor to dot blots.
This technique has been used mostly for rapid assay for the presence of virus in plant and animal
tissues.
HYBRIDIZATION PROBES
Any nucleic acid can suffice as a probe if it can be suitably labeled. However, the key to
successful hybridizations is associated with the preparation of a highly specific and strong nucleic acid
3 125
probe. In earlier hybridizations, nearly all the DNA and RNA probes were radiolabeled with P
P
H, P
P
I,
P
P
S, or P
P
P isotopes. Today, the concerns with safety and the problems of low-level radioactive isotope
disposal have resulted in increasing numbers of researchers switching to non-radioactive probes. Some
of the more common means of labeling nucleic acids will be described.
Nick Translation. In this procedure, Dnase I is used to introduce random single-stranded nicks
in double-stranded DNA. The enzyme DNA polymerase I is then used to remove stretches of single-
stranded DNA starting at the nicked site. The same enzyme simultaneously replaces the deleted
nucleotides with radioactively labeled nucleotides. This simple procedure results in a randomly
labeled DNA probe with high specific activity. DNAs with specific activities of 3 x 108
dpm/µg
DNA can routinely be obtained. One disadvantage is that nick translation generates short single-
stranded pieces of DNA.
Random Primed Labeling. The double-stranded DNA probes are denatured into single-
stranded DNAs and annealed to a mixture of random six-base pair long DNA fragments. Beginning at
the hexanucleotide bases, the complementary strand is synthesized using the Klenow enzyme. The
large or Klenow fragment of DNA polymerase I has DNA polymerase and 3’ -> 5’ exonuclease
activities, and is widely used in molecular biology. The function of DNA polymerases is to
synthesize complementary strands during DNA replication. Performing that task in the lab is integral
to such processes as synthesizing the second strand DNA in cDNA cloning and generating radioactive
probes for hybridization reactions.
DNA polymerases require a primer to provide a free 3’ hydroxyl group for initiation of synthesis. The
primers used for most in vitro polymerization reactions are single-stranded DNAs, typically 6 to 20
bases in length, called oligonucleotides. The oligonucleotides must be 145rthoreovirus to some section
of template DNA. To use Klenow to synthesize a complementary strand of DNA, one simply mixes
single-stranded template (usually denatured double-stranded DNA), primers and the enzyme in the
presence of an appropriate buffer (most restriction enzyme buffers work well). During second-strand
synthesis, radioactive deoxynucleoside triphosphates present in the reaction mixture are incorporated

146. 146
P
P
into the DNA. The result is a strong DNA probe that is uniformly labeled. In a 30 minute reaction,
specific activities can exceed 2 x 109
dpm/µg of DNA.
End-labeling with the Klenow Fragment. Double-stranded DNA is either digested with an
RE that generates a 5’ overhang or is briefly treated with exonuclease III. In the presence of
radioactive deoxynucleoside triphosphates, the Klenow fragment is used to fill in the newly created 5’
overhangs. Following denaturation, the result is a single-stranded DNA probe specifically labeled only
at the 3’ end. Disadvantages of this procedure are that the DNAs are usually not as strong as probes
generated by nick translation or random priming. This procedure will not work on DNAs with 3’
overhangs.
Polymerase Chain Reaction. A powerful technique for labeling vector-free DNA probes is
the polymerase chain reaction (PCR). PCR is developed and adapted to a variety of applications
including amplification, sequencing, cloning, and probe synthesis. Probes can be labeled by
modification of either the two primers or the deoxynucleoside triphosphates used for polymerization.
The PCR is catalyzed by the thermostable enzyme Taq DNA polymerase isolated from the
thermophilic eubacterium Thermus aquaticus. The whole amplification reaction consists of up to 60
sequential temperature cycles and is performed as follows:
5. Denaturation of the target DNA into single strands by heat (90-95C);
2. Hybridization of two flanking antiparallel primers to the DNA single strands (40-60C); and
3. Copying the two single strands by elongation of the primers using the heat-stable Taq DNA
polymerase (70-75C).
Since both single strands are copied simultaneously, the result is an exponential amplification of the
target sequence. If RNA is the starting material, a reverse transcription step has to precede the
amplification reaction to produce cDNA, which is then amplified by the PCR process.
In the first labeling approach, nonradioactively labeled PCR probes are generated by the use of
5’-terminal labeled primers. The most commonly employed 5’-terminal labels are biotin and a variety
of fluorescent dyes.
In the alternative labeling approach, the modification group is incorporated into the PCR
product by modified deoxynucleoside triphosphates, resulting in homogeneously labeled vector-free
hybridization probes. This approach has been described for biotin as well as for digoxigenin. With
this alternative approach g amounts of vector-free probes can be synthesized in a few hours. In the
case of biotin, the optimal ratio between dTTP and bio-dUTP is 3:1, the respective ratio between dTTP
and DIG-dUTP is 2:1.
Both labeling procedures can be used to generate probes of cloned inserts in which the
sequence of the insert is still unknown. In this case primers directly flanking the cloning site have to
be used. Applying biotin-or digoxigenin-labeled PCR probes, sub-pg- amounts of target sequences can
be detected on blots.

147. 147
32
35
cDNA probes. The enzyme reverse transcriptase (RNA-dependent DNA polymerase) can be
used with either single-stranded DNA or RNA templates bearing a 3’-hydroxy’ group to make probes
for use in hybridization studies. The enzyme is typically used to transcribe RNA into cDNA and
during the reaction it can incorporate a labeled nucleotide into the growing cDNA chain in the 5’ to 3’
direction. An oligonucleotide (small single strand of nucleic acid) must be used to prime the reaction.
The oligonucleotide can be of random sequence or one of specific sequence, usually from 18 to 30 bps
in length.
RNA Probes from in vitro Transcription. The use of single-stranded RNA probes can result
in a dramatic increase in hybridization efficiency over comparably labeled DNA probes. To prepare
RNA probes, a DNA fragment, containing the probe sequences of interest, are first cloned into special
plasmid vectors such that the clone is immediately downstream from a strong SP6, T7, or T3 bacterial
promoter. In the presence of polymerase and labeled ribonucleotide triphosphates, transcription
proceeds from the promoter through the probe sequence, generating a strong single-stranded RNA
probe. RNA probes offer advantages over DNA probes. RNA probes can anneal to both RNA and
DNA, forming more stable complexes than DNA-DNA hybrids. Thus, RNA probes often generate
stronger hybridization signals than can be generated with DNA probes. Since RNA-DNA hybrids are
resistant to Rnase it is possible to use Rnase to effectively remove any non-specifically bound probes
and thereby reduce background counts.
Radioactive Probes
32 33
Radioactive probes were the first type used in molecular biology. Such isotopes as P
P
P, P
P
P,
35 3 14 125
P
P
S, P
P
H, P
P
C, and P
P
I were the isotopes of choice over the past 20 years.
P
P
P-labeled NTP or dNTP precursors can be purchased at various specific activities. In general,
-labeled precursors are purchased at 400 to 800 Ci/mmol, whereas -labeled precursors are purchased
at
32
3000 to 7000 Ci/mmol. P
PP is preferred for preparation of highly radioactive probes and for most
33
autoradiographic procedures. Recently P
P
P has become available from Dupont, Inc., Wilmington, DE.
This isotope produces a stronger signal, which results in less exposure time and is safer to use.
32
However, it is considerably more expensive than P PP. The new ready view® form also has a colored
dye which allows it to be viewed without a 147rthor counter. The diluent is also stable at 4C so that it
doesn’t have to be stored in an ultra cold freezer. The labeled nucleotides are not exposed to constant
freezing and thawing which cause degradation.
P PS-labeled nucleoside triphosphates have a thio moiety replacing one of the oxygens that is
covalently bound to the phosphate. This is a significant perturbation that inhibits many enzymes.
35
Because the lower energy of P
P
S does not cause extensive damage to nucleic acids, it is used for the
35
preparation of more stable, but lower specific activity, probes. P
P
S is the preferred isotope for the
dideoxy sequencing procedure, because its lower energy results in sharper images in autoradiography.

148. 148
P PThe emission of 3
H is too weak for most autoradiographic procedures, although it is used for in
situ hybridizations. Its primary use is for quantitative analysis of nucleic acid synthesis and
14 125
degradation. For some specific purposes, P
P
C and P
P
I are used for radiolabeling nucleic acids.
CAUTION: Investigators should wear gloves for all procedures involving radioactivity. All
32
experiments involving P
32
P
P should be performed behind 148rthor screens to minimize exposure.
When
working with P
P
P, investigators should check themselves and the working area for radioactivity with a
hand-held minimonitor. When finished, radioactive waste should be placed in designated areas.
Measuring Radioactivity in DNA and RNA by Acid Precipitation
The amount of radioactivity for a known amount of DNA is called the specific activity (usually
given in units of cpm/ g of nucleic acid). The most common method for the measurement of
radioactivity in nucleic acids is based on the fact that DNA or RNA molecules greater than 20
nucleotides in length are quantitatively precipitated in strong acids, whereas dNTP or NTP precursors
remain in solution.
Materials
500 µg /ml sonicated salmon sperm DNA in TE buffer
Acid precipitation solution, ice-cold
100% ethanol
Glass microfiber filters (2.4-cm diameter, Whatman GF/A)
Filtration device
Scintillation fluid and vials
1. Add known volume (typically 1 l) of a reaction mixture containing radioactive precursors to
a disposable glass tube containing 100 l of 500 g/ml salmon sperm DNA in TE buffer.
Spot 10 l of the mixture onto a glass microfiber filter.
2. To the remaining 90 l, add 1 ml of ice-cold acid precipitation solution and incubate 5 to 10
min on ice.
3. Collect precipitate by filtering solution through a second glass microfiber filter. Rinse tube
with 3 ml acid precipitation solution and pour through filter. Wash filter four more times with
3 ml acid precipitation solution, followed by 3 ml ethanol.
5. Air dry both filters and place them in separate vials containing 3 ml of a toluene-based scintillation
fluid. Measure radioactivity in a liquid scintillation counter.
5. Determine incorporation of radioactivity into nucleic acid from ratio of cpm on second filter
(which measures radioactivity in nucleic acid) to cpm on first filter (which measures total
radioactivity in sample).

149. 149
Spin-Column Procedure for Separating Radioactivity Labeled DNA from Unincorporated dNTP
Precursors
In this method, the packing and running of the column is accomplished by centrifugation. Spin
columns can be purchased commercially at moderate expense.
CAUTION: Use extreme care that the centrifuge and work area do not become contaminated with
32
radioactivity. Whenever possible, place P
P
P samples behind a 149rthor shield.
Additional Materials
5-ml disposable syringe
5. Plug bottom of a 5-ml disposable syringe with clean, silicanized glass wool. Fill syringe with an
even suspension of the column resin, and place in a polypropylene tube that is suitable for
centrifugation in a desktop centrifuge. Centrifuge 2 to 3 min at a setting of 4 in order to pack the
column.
2. Dilute radioactive sample with TE buffer to 100 l and load in the center of the column. Place
syringe in a new polypropylene tube, and centrifuge 5 min at a setting of 5 to 6.
3. Save liquid at bottom of tube containing the labeled DNA. Dispose of all radioactive waste
properly.
Nonradioactive Labels
The majority of the substances used as nonradioactive labels for nucleic acid hybridization
probes have been tested previously in immunoassays. Nonisotopic labels have been the focus of
32
development because of the limitations of radioactive labels such as P
P
p. These limitations are
principally (1) a short half-life that restricts the shelf life of labeled probes and hence hybridization
assay kits, (2) health hazards during preparation and use of the labeled nucleic acid, and (3) disposal of
radioactive waste. The ideal label for a nucleic acid hybridization probe would have most of the
following properties.
5. Easy to attach to a nucleic acid using a simple and reproducible labeling procedure;
2. Stable under nucleic acid hybridization conditions, typically temperatures up to 80C, and exposure
to solutions containing detergents and solvents such as formamide;
3. Detectable at very low concentrations using a simple analytical procedure and noncomplex
instrumentation;
5. Non-obstructive in the nucleic acid hybridization reaction;
5. Applicable to solution or solid-phase hybridizations. In a solid-phase application,

150. 150
e.g., membrane-based assay, the label must produce a long-lived signal (e.g., enzyme label
detected chemiluminescentlyor by time-resolved fluorescence);
5. Nondestructive. The label must be easy to remove for successive reprobing of membranes.
32
Generally, reprobing is not problematic for P
P
phosphorus labels, but it is less straightforward for
some nonisotopic labels (e.g., insoluble diformazan product of 5-bromo-4-chloro-3-indolyl-
phosphate (BICP) nitro blue tetrozolium (NBT)-alkaline phosphatase reaction has to be removed
from a membrane with hot formamide);
7. Stable during storage, providing longer shelf-life for commercial hybridization assay kits.
8. Compatible with automated analysis. Widespread and large-scale applications of hybridization
assays will lead to the need for automated analyzers. The label and the assay for the label must be
compatible with a high throughput analyzer (rapid detection using the minimum number of
reagents and analytical steps.)
None of the labels developed so far fulfills all of these criteria and, just as in the case of
immunoassays, there is still no agreement on the most appropriate nonisotopic label. Enzymes, such as
horseradish peroxidase and alkaline phosphatase, have become particularly popular in recent years as a
range of sensitive detection methods has evolved. Alkaline phosphatase, for example, can be detected
using chemiluminescent, bioluminescent, and time-resolved fluorescent methods.
Several methods of non-radioactively labeling DNA have been developed (Table 4.0). The
most widely used technique involves using procedures such as nick translation to incorporate
biotinylated nucleotides into the probe DNA. Following hybridization, the hybridization membrane is
incubated with avidin or streptavidin which has been chemically coupled to either alkaline phosphatase
or horseradish peroxidase. After adding the appropriate substrate, the biotinylated DNA appears as a
colored band on the membrane. Unlike isotope probes that often require days to develop a strong
signal, nonradioactive probe detection usually takes few hours. There are also disadvantages with this
system: the colored bands fade over time and the colored dye cannot be removed from the membrane.
Thus, the membranes can only be probed once.
To overcome these disadvantages, a new nonradioactive probe technique was recently
introduced. The most promising technique utilizes digoxigenin, a plant steroid found only in digitalis,
a drug commonly used for patients with heart disease. Using any of the procedures described
previously, digoxygenin-labeled bases can be incorporated into DNA or RNA probes. After
hybridization to the membrane-bound target nucleic acid, the hybrids are detected with an anti-
digoxigenin antibody conjugate. Several variations of this procedure are available. The anti-
digoxigenin antibodies can be conjugated to alkaline phosphatase, peroxidase, fluorescein, or
rhodamine. If a LumiPhos® (Lumigen, Detroit, MI) substrate is used with the alkaline phosphatase
conjugates, then light is emitted at the site of hybridization and the signal can be recorded by exposing
the membrane to X-ray film. The resulting image is virtually identical to an autoradiograph. In less
than an hour of exposure, 0.1 pg of DNA can be detected. Finally, the membranes are easily stripped
and re-probed.

151. 151
Table 4.0 List a number of commercially available nonradioactive nucleic acid detection systems. The number
continues to expand at a rapid rate.
Mode of labeling
Mode of
detection
Sensitivity [pg]/
copy number PaP
Development/availability
Systems on
polynucleotide basis
Enzymatic modification
Biotin-dUTP/Nick
translation
Streptavidin-AP 10/1 x 10P6P
Enzo Chemical lab., Inc.
Biotin-dUTP/Tailing Streptavidin-AP 10/1 x 10P6P
Enzo
Biotin-dATP/Nick 4P
translation
Streptavidin-AP 0.5/5 x 10P
Digoxigenin-
Life Technologies
dUTP/Random
Priming
Digoxigenin-
Anti-
Digoxigenin-AP
Anti-
1.1/1 x 10P4P Boehringer Mannheim,
Inc.
4P Boehringer Mannheim,
rUTP/Transcription
AP = Alkaline phosphatase
Digoxigenin-AP
0.1/1 x 10P
Inc.
Dot and Slot Hybridization
Dot hybridizations are performed by spotting a small sample of the nucleic acid preparation onto dry
32
nitrocellulose, which was then dried, hybridized with a specific P PP-labeled DNA or RNA probe, and
exposed to X-ray film. Although accurate quantitation was not feasible because of the large and
variable size of the spots, it was possible to obtain an idea of the intensity of specific gene expression
in tissues or cultured cells. Recently, this technique has been improved:
Filtration manifolds have been designed to accept a large number of samples and to deposit the nucleic
acids onto the nitrocellulose in a fixed pattern that allows the results to be quantitated by scanning
densitometry. The filtration manifold consists of a Lucite block containing a number of slots into which
the samples are applied. The manifold fits onto a suction platform containing a sheet of nitrocellulose
onto which the samples are deposited. These manifolds are available commercially
(e.g., Minifold II, Schleicher and Schuell; Fisher Scientific, Springfield, NJ).
Slot Hybridization of RNA
5. Wet a piece of nitrocellulose (0.45-u pore size) in water and soak in 10 x SSC for 10 minutes.
Meanwhile, clean the manifold carefully with 0.1 N NaOH and then rinse it with sterile water.
2. Place two sheets of heavy, absorbent paper, previously wetted with 10 x SSC, on the top of the
vacuum unit of the apparatus. Place the wet nitrocellulose on the bottom of the sample wells
cut into the upper section of the manifold. Smooth away air bubbles trapped between the upper

152. 152
section of the manifold and the nitrocellulose. Clamp the two parts of the manifold together,
and connect the vacuum unit to a vacuum line.
3. Fill all of the slots with 10 x SSC, and apply gentle suction until all the fluid has passed through
the nitrocellulose. Turn off the vacuum and refill the slots with 10 x SSC.
4. Mix the RNA (dissolved in 50 l of 20 x SSC) with 50 ul of denaturing solution.
Denaturing solution
formaldehyde (37%) 4 ml
20 x SSC 6 ml
Incubate the mixture for 15 minutes at 65C, and then cool on ice.
Caution: Formaldehyde is carcinogenic and should be handled with care in a chemical hood
using gloves.
Many batches of reagent-grade formamide are sufficiently pure to be used without further
treatment. However, if any yellow color is present, the formamide should be deionized by
adding Dowex XG8 mixed-bed resin and stirring on a magnetic stirrer for 1 hour and filtering
twice through Whatman No. 1 paper.
Formaldehyde (MB
rB = 30.03) is usually obtained as a 37% solution (12.3 M) in water. Check
that the pH of the concentrated solution is greater than 4.0.
From 1 to 5 g of RNA may be applied to each slot of the manifold.
The RNA may be denatured with methylmercuric hydroxide or glyoxal instead of
formaldehyde.
5. Add 2 volumes of 10 x SSC to each of the samples.
5. Apply gentle suction to the manifold until the 10 x SSC in the slots passed through the
nitrocellulose filter. Turn off the suction.
7. Load the samples into the slots, and then apply gentle suction (Figure 4.0). After all of the
samples have passed through the filter, rinse each of the slots twice with 1 ml of 10 x SSC.
8. After the second rinse has passed through the filter, continue suction for 5 minutes to dry the
nitrocellulose filter.
9. Remove the nitrocellulose filter from the manifold, and allow it to dry completely. Bake the
filter for 2 hours at 80C in a vacuum oven to fix the nucleic acid to the filter.
10. Prehybridize and hybridize the filter to a labeled probe.
11. Prehybridization solution:
formamide 2.5 ml

153. 153
polyA 2.5 ul
tRNA 200 ul
20 x SSC 1.25 ml
50 x Denhardts 200 ul
HB
2BO 700 ul
1 mTris, pH 7.5 50 ul
20% SDS 25 ul
1.8 mg/ml Sperm DNA 50 ul
12. Prehybridize solution for 1 hr at 42C with shaking
13. Replace prehybridization solution with hybridization solution. This solution is the same
formula as the prehybridization but contains 50 ul of denatured labeled probe. The probe is
denatured by 5 min in a boiling water bath.
14. Hybridize overnight with shaking at 42C.
15. Wash the hybridized filter in 2 x SSCC in 0.1% SDS for 10 min at room temperature (20C).
Wash again with 0.1 x SSC/0.1 SDS for 15 min at 65C.
16. Use the appropriate detection system.
Figure 4.0. Filling Dot Blot Apparatus
Hybridization of Radiolabeled Probes to Dot Blotted Nucleic Acids
There are many methods available to hybridize radioactive probes in solution to nucleic acids
immobilized on solid supports such as nitrocellulose filters or nylon membranes. These methods differ
in the following respects:
• Solvent and temperature used (e.g., 68C in aqueous solution or 42C in 50% formamide)

154. 154
• Volume of solvent and length of hybridization (large volumes for periods as long as 3 days or
minimal volumes for periods as short as 4 hours)
• Degree and method of agitation (continuous shaking or stationary)
• Use of agents such as Denhardt’s reagent or BLOTTO to block the non-specific attachment of
the probe to the surface of the solid matrix
• Concentration of the labeled probe and its specific activity
• Use of compounds, such as dextran sulfate or polyethylene glycol that increase the rate of
reassociation of nucleic acids
• Stringency of washing following the hybridization
Among the various methods available are the following:
5. Hybridization reactions in 50% formamide at 42C are less harsh on nitrocellulose filters than is
hybridization at 68C in aqueous solution.
2. The smaller the volume of hybridization solution, the better. In small volumes of solution, the
kinetics of nucleic acid reassociation are faster and the amount of probe needed can be reduced
so that the DNA on the filter acts as the driver for the reaction.
3. Continual movement of the probe solution across the filter is unnecessary, even for a reaction
driven by the DNA immobilized on the filter. However, if a large number of filters are
hybridized simultaneously, agitation is advisable to prevent the filters from adhering to one
another.
5. Several types of agents can be used to block the nonspecific attachment of the probe to the surface
of the filter. These include Denhardt’s reagent, and nonfat dried milk (Table 4.1). Frequently,
these agents are used in combination with denatured, fragmented salmon sperm or yeast DNA and
detergents such as SDS. Virtually complete suppression of background hybridization is obtained
by prehybridizing filters with a blocking agent consisting of 5 x
Denhardt’s reagent, 0.5% SDS, and 100 g/ml denatured, fragmented DNA.
5. Blocking agents are included in both the prehybridization and hybridization solutions when
nitrocellulose filters are used. However, when the nucleic acid is immobilized on nylon
membranes, the blocking agents are often omitted from the hybridization solution, since high
concentrations of protein are believed to interfere with the annealing of the probe to its target.
5. In the presence of 10% dextran sulfate or 10% polyethylene glycol, the rate of hybridization is
accelerated approximately tenfold because nucleic acids are excluded from the volume of the
solution occupied by the polymer and their effective concentration is therefore increased. However,
they can sometimes lead to high backgrounds, and hybridization solutions containing them are
difficult to handle because of their viscosity.

155. 155
Table 4.1 Blocking Agents Used to Suppress Background in Hybridization Experiments
Agent Recommended uses
Denhardt’s reagent Northern hybridizations
hybridizations using RNA probes
single-copy Southern hybridizations
hybridizations involving DNA immobilized on
nylon membranes
Denhardt’s reagent is made up as 50 x stock solution, which is filtered and stored at -20C. The
stock solution is diluted tenfold into prehybridization buffer (usually 6 x SSC or 6 x SSPE
containing 0.5% SDS and 100 ug/ml denatured, fragmented, salmon sperm DNA). 50 x
Denhardt’s reagent contains 5 g of Ficoll (Type 400, Pharmacia) 5 g of polyvinylpyrrolidone,
5 g of bovine serum albumin (Pentex Fraction V), and HB
2BO to 500 ml.
BLOTTO Southern hybridizations other than single-copy
Dot blots
1 x BLOTTO (Bovine Lacto Transfer Technique Optimizer) is 5% non-fat dried milk
dissolved in water containing 0.02% sodium azide. It should be stored at 4C and diluted 25-
fold into hybridization buffer before use. BLOTTO should not be used in combination with
high concentrations of SDS, which will cause the milk proteins to precipitate. If background
hybridization is a problem, NP-40 may be added to the hybridization solution to a final
concentration of 1%. BLOTTO should not be used as a blocking agent in northern
hybridizations because of the possibility that it might contain unacceptably high levels of
RNAase.
Denatured, fragmented salmon sperm
DNA
Southern and northern hybridizations
Salmon sperm DNA (Sigma type III sodium salt) is dissolved in water at a concentration of 10
mg/ml. If necessary, the solution is stirred on a magnetic stirrer for 2-4 hours at room
temperature to help the DNA to dissolve. The solution is adjusted to 0.1 M NaCl and
extracted once with phenol and once with phenol:chloroform. The aqueous phase is recovered
and the DNA is sheared by passing it 12 times rapidly through a 17-gauge hypodermic needle.
The DNA is precipitated by adding 2 volumes of ice-cold ethanol. It is then recovered by
260
centrifugation and redissolved at a concentration of 10 mg/ml in water. The ODP
P
of the
solution is determined and the exact concentration of the DNA is calculated. The solution is
then boiled for 10 minutes and stored at -20C in small aliquots. Before use, the solution is
heated for 5 minutes in a boiling-water bath and then chilled quickly in ice water. Denatured,
fragmented salmon sperm DNA should be used at a concentration of 100 g/ml in
hybridization solutions.

156. 156
P
P
7. To maximize the rate of annealing of the probe with its target, hybridizations are usually
carried out in solutions of high ionic strength (6 x SSC or 6 x SSPE) at a temperature
that is 20-25C below the melting temperature (TB
mB). The TB
mB is calculated as follows:
TB
mB = 81.5C – 16.6 (logB
10B[Na+]) + 0.41 (%G+C) – 0.63 (% formamide) – (600/l)
where 1 = length of the molecule in base pairs. Both solutions work equally well when
hybridization is carried out in aqueous solvents. However, when formamide is included
in the hybridization buffer, 6 x SSPE is preferred because of its greater buffering power.
8. The washing conditions should be as stringent as possible (i.e., a combination of
temperature and salt concentration should be chosen that is approximately 12-20C
below the calculated TB
mB of the hybrid under study).
9. To minimize background problems, it is best to hybridize for the shortest possible time
using the minimum amount of probe. Typically, hybridization is carried out for 6-8
hours using 1-2 ng/ml radiolabeled probe (sp. act. = 109
cpm/ g or greater).
Hybridization of Radiolabeled Probes to Nucleic Acids Immobilized on Nitrocellulose Filters
or Nylon Membranes
Although the method given below deals with RNA or DNA immobilized on
nitrocellulose filters, only slight modifications are required to adapt the procedure to nylon
membranes. These modifications are noted at the appropriate places in the text.
5. Prepare the prehybridization solution. Approximately 0.2 ml of prehybridization
solution will be required for each square centimeter of nitrocellulose filter or nylon
membrane. The prehybridization solution should be filtered through a 0.45-micron
disposable cellulose acetate filter (Schleicher and Schuell Uniflow syringe filter No.
57240 or equivalent).
Prehybridization solutions
For detection of low-abundance sequences:
Either
6 x SSC (or 6 x SSPE)
5 x Denhardt’s reagent
0.5% SDS
100 g/ml denatured, fragmented salmon sperm DNA
or
6 x SSC (or 6 x SSPE)
5 x Denhardt’s reagent

157. 157
9
0.5% SDS
100 g/ml denatured, fragmented salmon sperm DNA
50% formamide
For detection of moderate- or high-abundance sequences:
Either
6 x SSC (or 6 x SSPE)
0.05 x BLOTTO
or
6 x SSC (or 6 x SSPE)
0.05 x BLOTTO
50% formamide
2. Float the nitrocellulose filter or nylon membrane containing the target DNA on the
surface of a tray of 6 x SSC (or 6 x SSPE) until it becomes thoroughly wet from
beneath. Submerge the filter for 2 minutes.
3. Slip the wet filter into a heat-sealable bag (e.g., Sears Seal-A-Meal® or equivalent).
Add 0.2 ml of prehybridization solution for each square centimeter of nitrocellulose
filter or nylon membrane.
Squeeze as much air as possible from the bag. Seal the open end of the bag with the heat
sealer. Incubate the bag for 1-2 hours at the appropriate temperature (68C for aqueous
solvents; 42C for solvents containing 50% formamide). The bag can be placed on a
shaker or circular (Ferris wheel-like) device in an incubator. Hybridization ovens which
contain cylindrical tubes for housing the filters are also available. These cylinders are
also turned in a in a circular (Ferris-wheel-like) fashion.
5. If the radiolabeled probe is double-stranded, denature it by heating for 5 minutes at
100C. Single-stranded probes need not be denatured. Chill the probe rapidly in ice
water.
5. Working quickly, remove the bag containing the filter and open it by cutting off one corner
with scissors. Add the denatured probe to the prehybridization solution, and then squeeze as
much air as possible from the bag. Reseal the bag with the heat sealer so
that as few bubbles as possible are trapped in the bag. To avoid radioactive
contamination of the water bath, the resealed bag should be sealed inside a second,
noncontaminated bag.
When using nylon membranes, the prehybridization solution should be completely
removed from the bag and immediately replaced with hybridization solution. The probe
is then added and the bag is resealed.
Typically, hybridization is carried out for 6-8 hours using 1-2 ng/ml radiolabeled probe
(sp. act. – 10P
P
cpm/µg or greater) (Figures 4.1 to 4.4).

158. 158
Hybridization solution for nylon membranes
6 x SSC (or 6 x SSPE)
0.5% SDS
100 µg /ml denatured, fragmented salmon sperm DNA
50% formamide (if hybridization is to be carried out at 42C)
Nylon filters have the properties that probes can be readily removed from the filter, the
filter can be reprobed, and they have a greater affinity for many nucleic acids. However,
the material is more expensive than nitrocellulose.
5. Incubate the bag at the appropriate temperature for the required period of hybridization.
7. Wearing gloves, remove the bag from the water bath and immediately cut off one corner.
Pour out the hybridization solution into a container suitable for disposal, and then cut the
bag along the length of three sides. Remove the filter and immediately submerge it in a
tray containing several hundred milliliters of 2 x SSC and 0.5% SDS at room
temperature.
Important: Do not allow the filter to dry out at any stage during the washing procedure.
8. After 5 minutes, transfer the filter to a fresh tray containing several hundred milliliters
of 2 x SSC and 0.1% SDS and incubate for 15 minutes at room temperature with
occasional gentle agitation.
9. Transfer the filter to a flat-bottom plastic box containing several hundred milliliters of
fresh 0.1 x SSC and 0.5% SDS. Incubate the filter for 30 minutes to 1 hour at 37 C
with gentle agitation.
10. Replace the solution of fresh 0.1 x SSC and 0.5% SDS, and transfer the box to a water
bath set at 68C for an equal period of time. Monitor the amount of radioactivity on the
filter using a hand-held minimonitor. The parts of the filter that do not contain DNA
should not emit a detectable signal.
11. Briefly wash the filter with 0.1 x SSC at room temperature. Remove most of the liquid
from the filter by placing it on a pad of paper towels.
12. Place the damp filter on a sheet of Saran Wrap. Apply adhesive dot labels marked with
radioactive ink to several asymmetric locations on the Saran Wrap. These markers serve
to align the autoradiograph with the filter. Cover the labels with Scotch Tape. This
prevents contamination of the film holder or intensifying screen with the radioactive ink.

159. 159
32
Radioactive ink is made by mixing a small amount of P
P
P with waterproof black
drawing ink. It is convenient to make the ink in three grades: very hot (>2000 cps on a
hand-held minimonitor), hot (> 5000 cps on a hand-held minimonitor), and cool (> 50
cps on a hand-held minimonitor). Use a fiber-tip pen to apply ink of the desired hotness
to the adhesive labels. Attach radioactive-warning tape to the pen, and store it in an
appropriate place.
13. Cover the filter with a second sheet of Saran Wrap, and expose the filter to X-ray film
(Kodak XAR-2 or Omat East Kodak, Rochester, NY) to obtain an autoradiographic
32
image. The exposure time should be determined empirically. However P
P
P
radiolabeled probes, can usually be detected after 16-24 hours of exposure at -70C with
an intensifying screen, unless the probe signal or target concentration is very low.
Screens are available from Cronex; Dupont, Wilmington, DE.
Figure 4.1. Immunological detection of blott
Figure 4.2. Removal of blott from hybridization fluid

160. 160
Figure 4.3. Harvesting probe
Figure 4.4. Dot Blot Hybridization
Removal of Radiolabeled Probes from Nitrocellulose Filters and Nylon Membranes
Probes become irreversibly bound if nitrocellulose filters and nylon membranes are allowed to
dry. Therefore, every effort should be made to ensure that the solid supports remain wet at all
stages during hybridization, washing, and exposure to X-ray film. Probes can be removed from
either type of filter and probes used again for another hybridization. However, only nylon
filters can be reprobed.
Removing probes from Nitrocellulose filters
5. Heat several hundred milliliters of 0.05 x SSC, 0.01 M EDTA (pH 8.0) to boiling.
Remove the fluid from the heat and add SDS to a final concentration of 0.1%. Immerse
the filter in the hot elution buffer for 15 minutes.

161. 161
2. Repeat step 1 with a fresh batch of boiling elution buffer.
3. Rinse the filter briefly in 0.01 x SSC at room temperature. Remove most of the liquid
from the filter by placing it on a pad of paper towels.
5. Sandwich the damp filter between two sheets of Saran Wrap, and apply it to X-ray film
to check that all of the probe has been removed.
5. The filter may now be dried, wrapped in aluminum foil, and stored under vacuum at
room temperature until needed.
Removing Probes from Nylon Membranes
5. Immerse the membrane in 50% formamide, 2 x SSPE for 1 hour at 65C.
2. Rinse the membrane briefly with 0.1 x SSPE at room temperature. Remove most of the
liquid from the membrane by placing it on a pad of paper towels.
3. Sandwich the damp membrane between two sheets of Saran Wrap, and apply it to X-ray
film to check that the entire probe has been removed.
5. The membrane may now be dried, wrapped in aluminum foil, and stored under vacuum
at room temperature until needed.
5. The filter may now be dried, wrapped in aluminum foil, and stored under vacuum at
room temperature until needed.
Detection of Infectious Bursal Disease Virus RNA Using Dot Blot and a Non-Radioactive DNA
Probe
Because of the highly contagious and destructive nature of the virus, it is desirable to rapidly
identify infected birds. There are a variety of diagnostic assays used for IBDV detection. The antigen-
capture enzyme-linked immunosorbent assay, an immunoperoxidase tissue-staining assay, and
immunofluorescent techniques are examples of IBDV detection methods. Each test has merit; but
time, complexity, and suitability affect their usefulness. An assay that is sensitive, fast, and capable of
large-scale testing is needed for routine avian diagnostics.
Developments in nucleic acid technology offer a detection system for IBDV with both increased
speed and sensitivity. Nucleic acid probes are being utilized for diagnostic purposes. Dot- blot
hybridizations using nucleic acid probes are one means of testing that can be adapted for large sample
numbers without sacrificing speed and accuracy. Radiolabeled IBDV cDNA probes have been
developed to detect IBDV in tissue samples and offer greater sensitivity than immunofluorescence or

162. 162
P
P
agar gel precipitation assays. Nonetheless, radiolabeled probes have disadvantages that limit their
usefulness; radioisotopes present a safety hazard, are relatively expensive, and have a short shelf-life.
These problems can be overcome by utilizing non-radioactive labeled probes. One source of
non-radioactive label is digoxigenin (DIG), a steroid hapten and a derivative of the cardiac glycoside
drug digilanide C. Digoxigenin is linked by an 11-base spacer arm to the nucleotide deoxyuridine
triphosphate (dUTP). Probes containing digoxigenin-dUTP can be visualized by specific
immunoenzymatic staining using anti-digoxigenin antibodies conjugated to alkaline phosphatase.
Previous research found Digoxigenin-dUTP-labeled probes to be as reliable and sensitive as
radioactive ones.
IBDV viruses are propagated in primary CEFs. Upon development of 50-70% cytopathic
effect, the monolayers are harvested by three rapid freeze-thaw cycle and frozen at -20C until needed.
Virulent IBDV strains which are not cell-culture-adapted are propagated in three-week-old specific-
pathogen-free white leghorns. Each chicken is inoculated intra-nasally and subconjunctivally with 50
l of a virus suspension containing at least 105
chicken infective doses per ml. The birds are housed
in separate modified Horsfall-Bauer isolation units maintained with filtered air under negative
pressure. Three days post-inoculation, the birds are killed and bursae removed. The bursae are
immediately placed in NET buffer (10 mM Tris [pH 8.0], 100 mM NaCl, 1 mM EDTA). Cells are
harvested from intact bursae either by scraping a cut surface of the organ or from a crude suspension
prepared by homogenizing an entire bursa in buffer. The cell suspension is then frozen at -20C until
needed.
RNA extraction. Bursal homogenates or pooled CEFs infected with the IBDV strains are
concentrated by centrifugation at 50,000 x g for 3 hr at 4 C over a 40% sucrose cushion. Pellets are
suspended in NET and Freon-extracted (1,1,2-trichlorotrifluoroethane; Sigma Chemical Co., St. Louis,
Missouri) to release intact virions (12). A second centrifugation at 50,000 x g for 3 hr is performed to
concentrate the virus before extraction of the nucleic acid. The viral RNA is extracted by suspending
the pellet from the second centrifugation in an extraction buffer containing 10 mM Tris (pH 7.5), 10
mM NaCl, 10 mM EDTA, 0.2% sodium dodecyl sulfate (SDS), and 0.1% diethylpyrocarbonate and
incubating for 1 hr at 37 C. Proteinase K (Sigma) is added at a concentration of 1 mg/ml and
incubated for an additional 30 minutes at 37 C. Two consecutive hot phenol:chloroform (1:1)
extractions are performed, and the double-stranded RNA recovered from the aqueous phase by ethanol
precipitation. Further purification of the viral RNA can be determined after examination by agar gel
electrophoresis and spectrophotometric analysis. If needed it can be accomplished by LiCl precipitation
as previously described.
Preparation of digoxigenin-labeled cDNA probe. The cDNA probe is prepared and labeled in
a one-step process using M-MLV reverse transcriptase (Bethesda Research Laboratories, Inc.,
Gaithersburg, MD) and digoxigenin-11-dUTP (Boehringer-Mannheim Biochemicals, Indianapolis,
Ind.). An 18-base oligonucleotide, 5’TGGAGCATAGCCATAGAC-3’, is synthetically synthesized
and used as a specific primer to initiate cDNA synthesis. The sequence is complementary to the
positive strand of the VP-4 region of the viral genome, bases 1821-1839, of an Australian strain of
IBDV.

163. 163
P
P
Briefly, 1-5 g of purified IBDV RNA and 0.5 g specific primer per g of viral RNA are
mixed together in a microcentrifuge tube, heat-denatured for 10 minutes in a boiling-water bath, and
then rapidly chilled. This is added to a labeling mix containing 200 M each of cytosine
triphosphate, 325 M thymidine triphosphate, and 175 M digoxigenin-11-dUPT. The remainder of
the solution consists of reaction buffer composed of 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 10 mM
dithiothreitol, and 3 mM MgClB
2B. All solutions and reactants are prepared using diethylpyrocarbonate-
treated water. Once all the reactants are combined and mixed, 200 units of M-MLV reverse
transcriptase per ug of RNA are added, and the solution incubated for 2 hr at 37 C. The labeled cDNA
probe can be used for hybridization without further purification; however, purification by centrifugation
through Sephadex G-25 spun columns is advised. (For procedure see section under preparation of
radiolabeled probes).
Dot-blot hybridizations. Twofold dilutions of infected or control cells are prepared in 10 x
SSC (1.5 M NaCl, 0.15 M sodium citrate) using a 96-well plate. The cells are denatured by adding six
parts formaldehyde and four parts 20 x SSC to each well and incubated for 15 minutes at 65C. The
denatured samples—25 l of cell suspension in 100 l total volume—are filtered onto nitrocellulose
(Bio-Rad Laboratories, Richmond, CA) using a vacuum blot apparatus (Fisher Scientific, Springfield,
NJ). After filtration of the samples, the filters are air-dried and vacuum-baked for 2 hr.
The sensitivity of the digoxigenin-labeled cDNA probe is determined by preparing twofold
dilutions of purified IBDV RNA in 10 x SSC. One ml of purified RNA is serially diluted in 10 x SSC
before denaturation.
The membranes are prehybridized for 1 hr at 65 C in a solution containing 5 x SSPE (0.75 M
NaCl, 50 mM NaB
2B HPOB
4B[pH 7.0]. 1 mM EDTA), 5 x Denhardt’s solution (0.1% [wt:vol] Ficoll, 0.1%
[wt:vol] polyvinylpyrrolidone, 0.1% [wt:vol] bovine serum albumin), 0.02% SDS, 0.1% N-
lauroylsarcosine, 50 g/ml denatured salmon sperm DNA, and 0.5% [wt:vol] blocking reagent
(Boehringer Mannheim) using 100 l per cm2
of nitrocellulose. For hybridization, the
prehybridization buffer is removed, and fresh buffer is added with probe at a concentration of 100—
500 ng/ml of buffer. The filters are prehybridized and hybridized in polypropylene bags with mild
agitation. Hybridization is performed overnight at 42 C. Hybridized filters are washed twice in 2 x
SSC/0.1% SDS for 10 minutes at room temperature and twice in l.0 x SSC/0.1% SDS for 15 minutes at
65 C.
Immunological detection. Detection of bound probe is performed according to the method
described by Boehringer Mannheim Corp. for the Genius Nonradioactive DNA Labeling and Detection
Kit®, utilizing an anti-digoxigenin antibody conjugated to alkaline phosphatase (AP) and the
substrates:nitroblue tetrazolium salt (75 mg/ml in 70% dimethylformamide) and 5-bromo-4-chloro-3-

164. 164
P P
indolyl phosphate, toluidinium salt (50 mg/ml in 70 dimethylformamide). All buffers and reagents as
well as procedures are found in the Kit®.
All the following incubations are performed at room temperature and except for the color
reaction with shaking or mixing. The volumes of the solutions are calculated for a filter size of 100
cm2
and should be adjusted to other filter sizes.
5. Wash filters briefly (1 min) in buffer 1.
2. Incubate for 30 min with about 100 ml buffer 2.
3. After the blocking step, wash briefly in buffer 1.
5. Dilute <DIG>AP—conjugate to 150 mU/ml (1:5000) in buffer 1. Diluted antibody conjugate
solutions are stable only for 12 hr at +4C.
5. Incubate filters for 30 min with about 20 ml of diluted antibody-conjugate solution.
5. Remove unbound antibody conjugate by washing 2 x 15 min each with 100 ml of buffer 1.
7. Equilibrate membrane for 2 min with 20 ml of buffer 3.
8. Incubate filter with 10 ml freshly prepared color-substrate solution sealed in a plastic bag or in
a suitable box in the dark. The color precipitate starts to form within a few minutes and the
reaction is usually complete after 12 hr. Do not shake or mix while color is developing.
9. When the desired spots or bands are detected, stop the reaction by washing the membrane for 5
min with 50 ml of buffer 4.
RESULTS
The probe binds to the IBDV-infected cells and can be detected visually by color development
in the associated wells. In most instances, bound probe can be detected within 3 hr. A positive signal
is identified by the appearance of a well-defined purple-to-blue color. See Figure 2.6.
Background is minimal with the digoxigenin-labeled probe, even at high probe concentrations.
In those instances where background occurred, it can be easily distinguished; the signals from the
positive wells are darker, almost black in appearance, whereas the negative wells are a shade of gray
only slightly darker than the filter paper alone.
The sensitivity of the probe is examined by determining its ability to detect purified RNA
filtered onto nitrocellulose. A positive signal is observed in the 1:128 dilution of the RNA, which
equates with approximately 1.7 ng of RNA.

165. 165
The assay is repeatable and time-saving; the filters can be prepared, hybridized, and visualized
in less than 36 hr. The time needed for hybridization can be further decreased by increasing probe
concentration in the hybridization. Because of the multiple washings in the immunological detection
of the probe, we used less probe and hybridized overnight, continuing with the remaining steps the
following day. This procedure saves probe and allows samples to be collected, processed, and
evaluated within 2 days. In addition, multiple filters can be hybridized at one time by increasing the
volume of buffer alone, with no observed difference in signal intensity or clarity. Because non-
radioactive probes are stable over long periods of time, the probe is available for repeated testing by
freezing the hybridization buffer and heat-denaturing it before use. The cDNA probes can be used
successfully for more than 12 months without loss of signal intensity.
Table of Contents

166. 166
SOUTHERN BLOT
The Transfer of DNA From Agarose Gels To Solid Supports is Called Southern Blot.
There are three methods that can transfer fragments of DNA from agarose gels to solid
supports:
5. Capillary transfer. In this method, DNA fragments are carried from the gel in a flow of liquid and
deposited on the surface of the solid support. The liquid is drawn through the gel by capillary
action that is established and maintained by a stack of dry, absorbent paper towels. The rate of
transfer of the DNA depends on the size of the DNA fragments and the concentration of agarose in
the gel. Small fragments of DNA (< 1 kb) are transferred almost quantitatively from a 0.8%
agarose gel within 1 hour; larger fragments are transferred more slowly and less efficiently. For
example, capillary transfer of DNAs greater than 15 kb in length requires at least 18 hours, and
even then the transfer is not complete.
The efficiency of transfer of large DNA fragments is determined by the fraction of
molecules that escape from the gel before it becomes dehydrated. This problem
of dehydration can be partially alleviated by partial hydrolysis of the DNA prior to
capillary transfer. The DNA in the gel is exposed to weak acid (which results in
partial depurination), followed by strong base (which hydrolyzes the
phosphodiester backbone at the sites of depurination). The resulting fragments of
DNA (1 kb in length) can then be transferred rapidly from the gel with high
efficiency. However, it is important not to let the depurination reaction proceed too
far; otherwise, the DNA is cleaved into small fragments that are too short to bind
efficiently to the solid support.
For capillary transfer of DNA from agarose gels, buffer is drawn from a reservoir
and passed through the gel into a stack of paper towels. The DNA is eluted from the
gel by the moving stream of buffer and is deposited on a nitrocellulose filter or
nylon membrane. A weight applied to the top of the paper towels helps to ensure
a tight connection between the layers of material used in the transfer system.
2. Electrophoretic transfer. This method is not practical when nitrocellulose is used because of
the high ionic strengths of the buffers that are required to bind nucleic acids to these filters.
These buffers conduct electric current very efficiently, and it is necessary to use large volumes
to ensure that the buffering power of the system does not become depleted by electrolysis. In
addition, extensive external cooling is required to overcome the effects of ohmic heating.
Electrophoretic transfer has undergone resurgence with the advent of charged nylon
membranes. Nucleic acids as small as 50 bp will bind to these membranes in buffers of very
low ionic strength.
Although single-stranded DNA and RNA can be transferred directly, fragments of
double-stranded DNA must first be denatured in situ. The gel is then neutralized and soaked in
electrophoresis buffer (1 x TBE) before being mounted between porous pads aligned between

167. 167
parallel electrodes in a tank of buffer. The time required for complete transfer depends on the
size of the fragments of DNA, the porosity of the gel, and the strength of the applied field.
However, because even high-molecular-weight nucleic acids migrate rapidly from the gel,
depurination/hydrolysis is unnecessary and transfer is complete within 2-3 hours. Because
electrophoretic transfer requires comparatively large electric currents, it is often difficult to
maintain the electrophoresis buffer at a temperature compatible with efficient transfer of DNA.
Many commercially available electrophoretic transfer machines are equipped with cooling
devices, but others are effective only when used in a cold room.
3. Vacuum transfer. DNA and RNA can be transferred rapidly and quantitatively from gels under
vacuum. Several vacuum transfer devices are available in which the gel is placed in contact
with a nitrocellulose filter or nylon membrane supported on a porous screen over a vacuum
chamber. Buffer, drawn from an upper reservoir, elutes nucleic acids from the gel and deposits
them on the filter or membrane.
Vacuum transfer is more efficient than capillary transfer and is extremely rapid; DNAs
that have been partially depurinated and denatured with alkali are quantitatively transferred
within 30 minutes from gels of normal thickness (4-5 mm) and normal agarose concentration
(<1%). Vacuum transfer can result in a two- to threefold enhancement of the hybridization
signal obtained from Southern transfers.
All of these apparatuses work well as long as care is taken to ensure that the vacuum is
applied evenly over the entire surface of the gel. Care should be taken with the wells of
horizontal agarose gels, which tend to break during preparation of the gel for transfer. It is also
important not to apply too much vacuum during transfer.
Southern Capillary Transfer of DNA to Nitrocellulose Filters
5. After agarose gel electrophoresis to separate DNA fragments, transfer the gel to a glass baking
dish and trim away unused areas of the gel with a razor. Cut off the bottom left-hand corner of the
gel to orient the gel during the succeeding operations.
2. Denature the DNA by soaking the gel for 45 minutes in several volumes of 1.5 M NaCl, 0.5 N
NaOH with constant, gentle agitation (e.g., on a rotary platform).
If the fragments of interest are larger than approximately 15 kb, transfer may be
improved by nicking the DNA by brief depurination prior to denaturation with base. After step
1, soak the gel for 10 minutes in several volumes of 0.2 N HCl and then rinse briefly with
deionized water.
3. Rinse the gel in deionized water, and then neutralize it by soaking for 30 minutes in several
volumes of a solution of 1 M Tris (pH 7.4), 1.5 M NaCl at room temperature with constant,
gentle agitation. Change the neutralization solution and continue soaking the gel for a further
15 minutes.

168. 168
5. While the gel is in the neutralization solution, wrap a piece of Whatman 3MM paper around a piece
of Plexiglas or a stack of glass plates to form a support that is longer and wider than the gel. Place
the wrapped support inside a large baking dish. Fill the dish with transfer buffer (10 x SSC or 10 x
SSPE) until the level of the liquid reaches almost to the top of the support.
When the 3MM paper on the top of the support is thoroughly wet, smooth out all air bubbles
with a glass rod.
20 x SSC or 20 x SSPE can also be used as the transfer buffer. The binding of DNA to
nitrocellulose depends on the ionic strength of the transfer buffer. The smaller the fragments of
DNA, the higher the ionic strength required for their efficient retention on the nitrocellulose
filter. For Southern transfer of fragments of DNA less than 500 nucleotides in length, 20 x
SSC or 20 x SSPE should be used. Alternatively, nylon membranes, which bind small DNA
fragments more efficiently than nitrocellulose filters, may be used.
5. Using a fresh scalpel or a paper cutter, cut a piece of nitrocellulose filter (Schleicher and Schuell
BA85 or equivalent) about 1 mm larger than the gel in both dimensions. Use gloves and blunt-
ended forceps to handle the filter.
5. Float the nitrocellulose filter on the surface of a dish of deionized water until it wets completely
from beneath, and then immerse the filter in transfer buffer for at least 5 minutes. Using a
clean scalpel blade, cut a corner from the nitrocellulose filter to match the corner cut from the
gel.
7. Remove the gel from the neutralization solution and invert it so that its underside is now
uppermost. Place the inverted gel on the support so that it is centered on the wet 3MM papers.
Make sure that there are no air bubbles between the 3MM paper and the gel.
8. Surround, but do not cover, the gel with Saran Wrap. This serves as a barrier to prevent liquid
from flowing directly from the reservoir to paper towels placed on top of the gel.
9. Place the wet nitrocellulose filter on top of the gel so that the cut corners are aligned. One edge
of the filter should extend just over the edge of the line of slots at the top of the gel. Make sure
that there are no air bubbles between the filter and the gel.
10. Wet two pieces of 3MM paper (cut to exactly the same size as the gel) in 2 x SSC and place
them on top of the wet nitrocellulose filter. Smooth out any air bubbles with a glass rod.
11. Cut a stack of paper towels (5-8 cm high) just smaller than the 3MM papers. Place the towels
on the 3MM papers. Put a glass plate on top of the stack and weigh it down with a 500-g
weight. The objective is to set up a flow of liquid from the reservoir through the gel and the
nitrocellulose filter, so that fragments of denatured DNA are eluted from the gel and are
deposited on the nitrocellulose filter (Figure 4.5).
12. Allow the transfer of DNA to proceed overnight. As the paper towels become wet, they should
be replaced.

169. 169
13. Remove the paper towels and the 3MM papers above the gel. Turn over the gel and the
nitrocellulose filter and lay them, gel side up, on a dry sheet of 3MM paper. Mark the positions
of the gel slots on the filter with a very-soft-lead pencil or a ballpoint pen.
14. Peel the gel from the filter and discard it. Soak the filter in 6 x SSC for 5 minutes at room
temperature. This removes any pieces of agarose sticking to the filter.
To assess the efficiency of transfer of DNA, the gel may be stained for 45 minutes in a
solution of ethidium bromide (0.5 g/ml in water) and examined by ultraviolet illumination.
Note that the intensity of fluorescence will be quite low because the DNA remaining in the gel
has been denatured.
Figure 4.5. Setting up transfer 169rthoreov
15. Remove the filter from the 6 x SSC and allow excess fluid to drain away. Place the filter flat
on a paper towel to dry for at least 30 minutes at room temperature.
16. Sandwich the filter between two sheets of dry 3MM paper. Fix the DNA to the filter by baking
for 30 minutes to 2 hours at 80C in a vacuum oven.
17. Hybridize the DNA immobilized on the filter to a labeled probe as previously described.

170. 170
http://www.accessexcellence.org/RC/
Transfer of DNA from Gels to Nylon Filters by Electroblotting
Electroblotting of gels to Nylon is used because the capillary blotting methods developed to
transfer DNA from agarose gels to Nylon do not succeed. In conjunction with UV cross linking, this
method transfers small DNA fragments and retains them quantitatively on the filter. Complete transfer
and retention is crucial to the success of many procedures.
Additional Materials
50 mM TBE electrophoresis buffer (dilute 10 x stock, so that Tris base and boric acid are each
50 mM)
0.4 M NaOH (if nondenaturing gel is used)
2 x SSPE

171. 171
Apparatus to circulate 4 to 16C HB
2BO through electroblotting apparatus
5. Electrophorese DNA samples and labeled DNA molecular weight markers on a nondenaturing
(double-stranded DNA) or denaturing (single-stranded DNA) gel. Open glass plates, leaving one
plate attached. If a nondenaturing gel was run, stain and photograph gel. Keep gel moist until
ready to transfer.
2. With a pencil, mark nylon filter to indicate which side is to be in contact with gel. Cut
appropriate size filter and soak in 50 mM TBE electrophoresis buffer U>U 30 min before using.
Some manufacturers of nylon filters specify that one side of the filter be in contact with the gel.
It is permissible to have sections of gel not in contact with the filter and vice versa.
3. Cut a sheet of filter paper to approximately the size of gel and place gel, making sure there are no
air bubbles between the paper and gel. Lift paper and remove gel from glass plate onto filter
paper. Lay gel, filter paper side down, on a piece of plastic wrap.
5. Wet gel with a thin layer of 50 mM TBE electrophoresis buffer. Place nylon filter on gel, making
sure there are no air bubbles between filter and gel. Assemble remainder of blot sandwich, except
use two pieces of filter paper on each side prior to placement of Scotch-Brite pads.
If the gel is nondenaturing, no denaturation step is required until after transfer.
5. Fill tank with 50 mM TBE electrophoresis buffer. Place blot sandwich into a plastic support
and put into electroblotting apparatus. Transfer U>U2 hr at 40 V at any temperature from 4 to 16C
(using circulating water).
5. Disassemble blot sandwich. If gel is nondenaturing, denature filter by laying it (DNA side up) on
top of three pieces of filter paper saturated with 0.4 M NaOH for 10 min. If the gel is denaturing,
no denaturation step is necessary.
7. Rinse filter in 250 ml of 2xSSPE for a few minutes to neutralize. Filter can now be UV-
cross linked, instead of baking, under a vacuum.
Figure 4.6. UV Cross-linking of DNA to Nylon or Nitrocellulose Filters

172. 172
P P
UV cross-linking ensures that DNA is retained on filters during hybridization and when the nylon
filters are stripped for reuse (Figure 4.6).
5. Wrap wet filter with one layer of UV-transparent plastic wrap.
Keep filter wet to obtain a low background. Too high an effective UV dose will decrease
subsequent hybridization efficiency.
2. Place filter, DNA side up, under UV light source at a specific distance and for a length of time
to give a dose of 2400 W-min/cm2
, or to give an empirically determined optimum dose.
3. Unwrap the filter. The UV-cross linked nylon filter can be probed, stripped, and reprobed
indefinitely (Figure 4.7).
Figure 4.7 Southern and Dot Blot Hybridization
Utable of ContentsU

173. 173
Northern Blot Hybridization
RNA can be separated during electrophoresis through a gel and then transferred to a filter.
Hybridization of the immobilized target RNA with a labeled probe is referred to as Northern
hybridization. The procedures are generally similar to a Southern Blot. However, RNA must be
denatured during electrophoresis and blotting due to increased secondary structure of RNA compared
to DNA.
RNA is extracted, concentrated and purified as previously stated in this chapter.
I Denaturation of Viral RNA
5. Prepare alcohol ppt of 1-5µg vRNA.
2. Redissolve in denaturation buffer (total of 12ul). Heat at 60C for 5 min. The
denaturation buffer formula was listed in the earlier section on dot blotting of RNA.
3. Add 3ul of gel formaldehyde (Appendix) loading buffer. Load into gel under fume
hood.
II. Preparation of Denaturation gel. This gel is different from previously listed gels to
allow the transfer of RNA from the gel to the filter.
5. Mix 0.5g agarose and 36ml water, then add 5ml 10x running buffer.
2. Heat to dissolve agarose, allow to cool to less than 60C then add 9 ml 35%
formaldehyde (pH4.0).
3. Cast gel in the hood, and allow setting for at least 30 min at room temperature.
10 x Running buffer:
20.93 gm MOPS (pH 7.0)
10 ml 0.5M EDTA
8.33 ml 3M NaOac
*pH 7.0, 3 ml NaOH
*q.s. 500ml
MOPS = 30(N-morpholino) propanesulfonic acid)

174. 174
Diagram of gel apparatus
Cartoon explaining Detection of Northern blot
III. Running the gel
5. Prepare duplicate wells to cut away and stain with ethidium bromide (EtBr) while
transferring to NC filter. This verifies the location of the RNA bands.
2. Run gel at 60 volts for 2 hours under hood. Use 1X MOPS running buffer.
1X MOPS Running buffer:
50 ml 10X buffer
360 ml water
90 ml 35% formaldehyde
3. After electrophoresis, cut and stain half of gel with 0.5µg /ml EtBr in 0.1M Ammonium
acetate for 30-45 min.
IV Transfer to Nitrocellulose (NC) filter
5. After electrophoretic transfer of RNA perform the following:

175. 175
a)
b)
Rinse gel 2X in deionized water.
Wet filter on top of deionized water and then soak in transfer buffer until used.
(Use TAE for transfer buffer. Chill at 4C before using).
c) Wash gel in transfer buffer. Place membrane on top of gel followed by a piece
of prewet gel blot paper. Place between electrode; smooth each layer to prevent
air pockets. Place the gel closest to the anode (+). Apply 40 volts for 3 hours at
40C. Use 1X TAE buffer.
2. Capillary transfer of RNA from the gel to the NC filter.
a) Soak gel in DEPC water for 2 hours with at least two changes to remove
formaldehyde.
b) Wash the gel with 50 mM NaOH/10mM NaCl for 30 min, with 0.1M Tris-HCl,
pH7.5 for 30 min and finally, with 20x SSC for 45 min (Figures 4.7 and 4.8).
c) Prepare and run capillary transfer apparatus as listed for Southern transfer.
d) Peel the gel from the filter. Gel may be stained with EtBr (0.5µg /ml in 0.1M
Ammo. Acetate) for 45 min to access efficiency of transfer. Soak the filter in 6x
SSC for 5 min at room temperature. Place the filter flat on a paper towel to dry
for at least 30 min at room temp.
e) Place the dried filter between 2 pieces of 3MM paper and bake for 2 hours at
80C under vacuum or use UV cross linker at optimum conditions.
Figure 4.7. Preparing Turboblotting of NA from Gel to Filter

176. 176
Figure 4.8. Completed Transfer of NA from Gel to Filter

177. 177
V. Hybridization
5) Prehybridize filter 1 hour to overnight at 42C with shaking, use approximately
10 ml fluid depending of strength of the probe and concentration of the target
RNA.
b) Boil cDNA probe 3-5 min to denature. Place on ice. Add fresh hybridization
fluid and hybridize overnight at 42C with shaking. See preparation of cDNA
probe in next section.
c) Wash in 1X SSC, 0.1% SDS till no excessive radiation is detected. Blot excess
liquid. (increase heat with each wash)
d) Wrap in saran wrap, place in a light-tight X-ray film cassette with film in
between intensifying screen in a dark room. Incubate at -70C overnight.
Mark orientation on filter with radioactive ink or cutting a corner of the film.
e) Develop autoradiograph. X-ray film may be developed in an automatic X-ray
film processor or by hand in a dark room as follows: X-ray developer for 5
minutes, 3% acetic acid stop bath for 1 minute, rapidly fix for 5 minutes and run
water for 15 minutes. The temperatures for all solutions should be 18-20C. Use
the images of the radioactive markers to align the autoradiograph.
2. With Non-radioactive probe (Digoxigenin or Biotin)
5) Bake NC filter between 2 fresh Whatman 3MM filters in vacuum oven at 80C
for 2 hrs. (UV cross linker may be used under optimum conditions).
b) Prehybridize filter in bag for 1 hr (or overnight) at 42C with shaking.
Hybridization soln:
formamide 2.5 ml
poly A 25 ul
t RNA 200 ul
20x SSC 1.25 ml
50x Denhardts 200 ul
DDHB
2BO 700 ul
1M tris, pH7.5 50 ul
20% SDS 25 ul
1.8 mg/ml sperm DNA 50 ul
c) Replace the solution with 2.5 ml hybridization soln containing 50 ul of freshly

178. 178
denatured labeled DNA (Figures 4.9and 4.11.).
d) Hybridize at 42C overnight.
e) Wash hybridized filters in 2x SSC in 0.1% SDS for 10 min at room temperature
(2x).
f) Wash again with 0.1x SSC/0.1% SDS for 15 min at 65C.
g) Immunological Detection (follow procedures outlined for digoxigenin in
Boehringer Mannheim’s kit or for biotin from Bethesda Research Lab Kit)
(Figures 4.10, 4.12, and 4.13).
Figure 4.9. Manual Pipetting of reagents for typical molecular technique
Figure 4.10 Northern Hybridization of IBDV RNA

179. 179
Figure 4.11. Adding probe to membrane
Figure 4.12. Hybridizing probe to membrane
Figure 4.13. Red color reveals bands

180. 180
32
P
P
P labeled cDNA Synthesis
(Amersham cDNA Synthesis kit)
I Synthesizing cDNA Probe
1. Prepare RNA-primer*
RNA (0.5 ug)
primer (0.5 ug/ul)
1 ul
1 ul
*primer is a specific 18 to 22 bp synthetic oligonucleotide (single-strand of
DNA) synthesized or a random hexamer primer. The sequence for the specific primer
is taken from the previously published area of the gene in which you want to study. If
the sequence is not known, a random hexamer is chosen which will randomly prime any
gene at various places.
2. Heat 3 min (boiling) to denature. Use Styrofoam float over water bath. Place on ice
when finished.
3. Separate tube on ice, add the following:
5x 1st
strand buffer 10 ul
Na pyrophosphate soln. 2.5 ul
HPRI (Human Placental ribonuclease
from Amersham Lab. Inc.) 2.5 ul
dNTP mix 5 ul
32
[-P
P
P]dCTP(50uCi)
RNA-primer (from #1)
Enzyme* 8 ul
5. Mix gently and spin for a few seconds in a microcentrifuge.
5. Add 20 units of Rtase per ug of mRNA
5. Incubate at 42C for a minimum of 40 min (90 min)
7. Stop reaction by adding 10 ul 250 mM EDTA — quick spin before adding NaOH
25 ul 1N NaOH (hydrolyses RNA)
8. Heat for 30 min at 70C.

181. 181
II cDN
1.
A Extraction Procedure
Add 65 ul (or an equal volume of the reaction mixture) of phenol/chloroform to the
cDNA reaction mixture. This will remove enzyme from the probe.
2. Mix and blend vigorously in a vortex mixer.
3. Spin – 1 min.
4. Remove aqueous phase
5. Repeat steps (1-4)
6. Add one volume of chloroform to the aqueous phase and mix well.
7. Spin for a few seconds.
8. Remove/save aqueous phase.
III Precipitation – to remove unincorporated dNTP’s. This procedure can be done more
rapidly and thoroughly by a Sephadex G50 Spin column as previously described in this
chapter.
5. To the phenol extracted cDNA add 195 (three volumes) of cold 100% EtOH and 130 ul (½
vol of cDNA-EtOH mixture) of 4.0M Ammonium acetate. Add ammonium acetate first.
2. Precipitate-nucleic acids at -70C for 30 min.
3. Spin at 14K for 20 min in the refrigerator.
5. Discard EtOH*
5. Resuspend in TE buffer.
5. Run on spectrophotometer – dilute sample 1/200 read at 260 – 280 – 320.
*check supernatant for radioactivity
*check pellet for radioactivity
*continue till waste is no longer radioactive.

182. 182
32
IV. Gel Electrophoresis
Alkaline gel can be used as a denaturing formaldehyde gel for separating the RNA bands prior
to transfer to a filter.
1. Alkaline gel Buffer
0.3 gm agarose 1.5 ml 10M NaOH
150 ul NaOH 1.2 ml 200 mM EDTA
120 ul EDTA q.s. 300 ml HB
2BO
q.s. to 30 ml
— Run gel at 45 volts 182rthore. 2 hrs
— 5 ul sample 5 ul dye
2. The formaldehyde gel is prepared and run as previously stated and develop the film as
previously stated in prior sections.
3. Figure 2.11 shows P
IBDV.
PP labeled cDNA probe which hybridizes to RNA segments of
In situ assay. cDNA probes are labeled with digoxigenen using the Genius Kit (Boehringer Mannheim
Corp., Indianapolis, Ind.) according to the same procedures in the section for the detection of IBDV
RNA using Dot Blot and a Nonradioactive Probe. The concentration of labeled probe is an
approximately 0.3 ng/ul. A 30 ul volume containing 9.0 ng of probe is placed on each slide for
hybridization (Figure 4.13).
Hybridization. Tissue samples are prehybridized and hybridized in a buffer containing 2 x
SSC, 50% formamide, 1 x Denhardt’s solution (0.02% [wt:vol] ficoll, 0.02% [wt:vol]
polyvinylpyrrolidone, 0.2% [wt:vol] bovine serum albumin), 500 g/ml salmon sperm DNA, 250
g/ml yeast tRNA, and 10% dextran sulfate. A 300-ul volume of prehybridization buffer is added to
each slide, which was then covered with a Paraffin (American National Can, Greenwich, Conn.) cover
slip. Prehybridization is conducted at room temperature for 1 hr in a humid chamber. Following
prehybridization, the slides are rinsed in 2 x SSC, and a 30- l volume of hybridization buffer
containing 9.0 ng of digoxigenin-labeled probe is added to each slide. The slides are covered with
Parafilm coverslips and incubated in a humid chamber at 42 C for 16 hr.
Following hybridization, samples are washed sequentially in 2 x SSC for 1 hr at room
temperature, 1 x SSC for 1 hr at room temperature, 0.5 x SSC for 30 minutes at 37 C, and 0.5 x SSC
for 30 minutes at room temperature. The digoxigenin-labeled probes are then detected using the

183. 183
Genius detection kit (Boehringer Mannheim) according to the manufacturer’s instructions for in situ
hybridization. The only modification to this procedure is that levamisole is not used in the color
solution, which contained 337.5 g/ml nitroblue tetrazolium salt, 175 g/ml 5-bromo-4-chloro-3-
indolyl phosphate toluidinium salt (X-phosphate), 100 mM Tris-HCl (pH 9.5), 100 mM NaCl, and 50
mM MgClB
2B.
Results and Discussion. Stained cells containing IBDV RNA can be detected in areas of
lymphoid depletion. This assay is very sensitive, because a single infected cell can be identified.
Because it employs a non-radioactive probe, this assay may be practical for many diagnostic
laboratories. The limitations of this assay are the number of steps and time required for completion.
Many of these steps could be automated, as most are very similar to those conducted in a typical
histopathology laboratory.
Figure 4.13. Dot Blot of several reoviruses
In situ Hybridization
In situ hybridization is a valuable procedure for the diagnosis of infectious diseases. The
ability to locate viral antigen in the tissues where histologic lesions are present helps in the definitive
diagnosis of disease, where lesions alone are not pathognomonic. This assay coupled with a non-
radioactive probe is highly sensitive and is in the realm of capability of many diagnostic laboratories.
Detection of Infectious Bursal Disease Virus in the Bursa of Fabricius of Infected Chickens Using
In situ Hybridization and a Non-Radioactive Probe
Bursa collection and fixation. Bursae are collected and a small fragment of each is excised
and placed in PLP fixative (0.5% paraformaldehyde, 0.08 M lysine monohydrochloride, 0.04 M
sodium phosphate, and 0.01 M sodium periodate) for 24 hr. The tissues are placed in 70% ethanol and
stored at 4 C before paraffin-embedding. Fixed tissues are dehydrated through graded concentrations of
ethanol, cleaned in xylene, and paraffin-embedded. Hematoxylin-and-eosin-stained bursa sections are
evaluated for histologic lesions.
Preparation of tissue sections. Pretreatment of glass slides. Glass slides are pretreated in 0.1
N HCl for 1 hr., rinsed in deionized water, and soaked over-night in 95% ethanol. The slides are coated
with a solution of 0.5% porcine gelatin containing 1.0 mM chromium potassium sulfate and dried at
room temperature before the addition of tissue sections. Paraffin-embedded tissues are cut into
5-to-7 um sections and placed on the pretreated glass slides.

184. 184
The slides containing tissue sections are heated at 56 C; and paraffin is removed from tissues
by means of two 5 minute incubations in xylene. The tissues are hydrated through graded
concentrations of ethanol followed by a final wash in phosphate-buffered saline (PBS [pH 7.4]).
Proteinase-K pretreatment. Tissues sections are incubated in 0.2 N HCl for 20 minutes, rinsed
in deionized water, and placed in 2 x SSC (1 x SSC = 0.15 M NaCl, 0.015 M sodium citrate [pH 7.4])
for 30 minutes at 70 C. The tissue sections are rinsed in deionized water and placed in a solution
containing 10 mM Tris (pH 7.4), 2 mM CaClB
2B, and 1 ug/ml proteinase K for 15 minutes at 37 C.
Samples are rinsed twice in deionized water and then dehydrated through graded concentrations of
ethanol.
Tissue Printing. Tissue printing is a simplified form of in situ hybridization. This procedure
employs imprinting tissues of infected birds directly onto nitrocellulose and then fixing and
hybridizing the imprinted viral nucleic acid with a labeled probe. This technique is more rapid than
other previously named dot blot procedures which employ isolation of viral nucleic acid from tissues
or fixing and processing of embedded tissue sections on microscope slides as described with the
standard in situ technique. The disadvantage of this procedure is that it can not quantitate the nucleic
acid as with the dot blot procedure and it does not yield the histologic detail of the tissue as with in situ
hybridization using fixed, embedded and sectioned tissue sections. Also, background staining is
considerably more a problem with tissue printing when compared to in situ work with tissue sections
on microscopic slides.
Tissue Print Hybridization
I Blot – fresh or frozen tissues may be used.
5. Thaw out bursae at room temperature.
2. Blot on to nitrocellulose that has been soaked in 20 x SSC and air dried.
3. Place in UV cross linker (Fisher Scientific) and run at optimum factory setting (120
millijoules per unit area).
5. Alkaline denature by soaking in a glass petri dish containing 0.1M NaOH in 1M NaCl
for 15 minutes (2X).
5. Neutralize in 0.1M Tris-HCl, pH 7.4, in 1M NaCl for 15 minutes (2X).
5. Treat blots with proteinase K (20ug/ml) in 1% SDS in 2 X SSC for 30 minutes at room
temperature.

185. 185
P
P
II. Hybridization
5. Prehybridize filter in bag for 1 hour (or overnight) at 42C with shaking
Formamide 25 ml
polyA 25 ul
tRNA 200 ul
20 X SSC 1.25 ml
50 X Den. 200 ul
HB
2BO 700 ul
Tris(1M pH7.4) 50 ul
20% SDS 25 ul
1.8 mg/ml Sperm 50 ul
2. Denature cDNA probe 3—5 min in boiling water bath. Replace prehybridization fluid
with probe. Hybridize at 42 C overnight.
3. Wash hybridized filter in 2X SSC/0.1% SDS for 20 minutes at room temperature.
Repeat this washing 2 times.
5. Wash again with 0.1X SSC/0.1% SDS for 15 min at 65 C (2X) (Figure 4.14)
Figure 4.14 Tissue Print Hybridization
III. Immunological Detection (Boehringer Mannheim)
All the following incubations are performed at room temperature, and except for the color reaction,
with shaking or mixing. The volumes of the solutions are calculated for a filter size of 100 cm2
and
should be adjusted to other filter sizes.
5. Wash filters briefly (1 min) in buffer 1.
2. Incubate for 30 min with about 100 ml buffer 2.
3. After the blocking step, wash briefly in buffer 1.

186. 186
5. Dilute <DIG>AP-conjugate to 150 mU/ml (1:5000) in buffer 1. Diluted antibody conjugate
solutions are stable only for 12 hr at +4 C.
5. Incubate filters for 30 min with about 20 ml of diluted antibody-conjugate solution.
5. Remove unbound antibody conjugate by washing 2 x 15 min with 100 ml of buffer 1.
7. Equilibrate membrane for 2 min with 20 ml of buffer 3.
8. Incubate filter with 10 ml freshly prepared color-substrate solution sealed in a plastic bag or in
a suitable box in the dark. The color precipitate starts to form within a few minutes and the
reaction is usually complete after 12 hr. Do not shake or mix while color is developing.
9. When the desired blots are detected, stop the reaction by washing the membrane for 5 min with
50 ml of buffer 4.
RESULTS AND DISCUSSION
Tissue prints of bursae on nitrocellulose are a simplified means of identifying IBDV. When
hybridized with a non-radioactive probe, the tissue prints from chickens infected with the virulent
viruses can be identified by the rapid appearance of a blue-to-purple pigment appearing in the tissue
impression (Figure 4.13). In contrast, IBDV vaccine produces a less intense color change. The bursae
from uninfected (B) and reovirus (D)-infected birds produce little to no color development; their
location can be recognized by the faint gray outline of the impression.
Tissue-print hybridization is not suggested as a substitute for in situ hybridization, which offers
greater resolution, but rather as an alternative method for examining large numbers of samples or as a
rapid screening for selected tissues. When combined with the non-radioactive probe, the tissue prints
can be easily examined within 36 hr. The probe is simple to prepare, non-toxic, and stable for 12
months when stored frozen. Because this technique uses unprocessed fresh or frozen bursae, the print
can be easily prepared and the tissue can be frozen indefinitely. Bursae producing positive reactions can
be further examined by viral extraction when specific subtype identification is needed. In addition, the
tissue prints can be prepared in advance and stored either in a refrigerator for several weeks or at room
temperature for a few days until needed. These results suggest the suitability of bursal impressions for
IBDV screening.

187. 187
A. Tiss
1)
e section preparation
Deparaffinize tissue sections in fresh xylene three times for 5 minutes each.
2) Rehydrate the sections in graded ethanol (100%, 95%, 70% & 50%) 5 min, 2 times
each. Air-dry.
3) Digest the tissue sections in 100 ul of 20 ug/ul ProteinaseK at 37 C for 15 minutes.
Wash in PBS buffer three times.
4) Inactivate ProteinaseK at 95C for 1 min. in the PCR machine. Add depc-water on the
section area to keep the tissue moisture.
5) Dehydrate in graded ethanol (50%, 70%, 95% & 100%) and air-dry.
6) Digest cellular DNA with Dnasel (20 ul + 2 l Rnase inhibitor) at 37 C for overnight.
Cover sections with a small piece of parafilm and place in moist chamber.
7) Wash in DEPC-water three times then inactivate Dnase at 94 C for 5 min in the PCR
machine (add DEPC-water on sections).
8) Dehydrate in graded ethanol and air-dry.
DIRECT IN-SITU RT-PCR AND HYBRIDIZATION
u
B. Reverse Transcription
1) Put the Hybriwell chamber on the slide and add 100 ul DEPC water containing 100 pM
Primer 4 (2 l of 50 pmoles) through one port of the Hybriwell coverslip. Denature at
94 C for 5 – 10 min on block of PCR machine.
2) Immediately transfer the denatured tissue section on to the even surface of the pre-
chilled (0-4 C) iron block, wash with pre-chilled DEPC-water, and then remove the
excess water on the tissue section.
3) Add 100 l RT mixture on to the tissue section and reverse transcribe at 42 C for 1
hour in the PCR machine.
4) Wash with PBS, dehydrate in ethanol (50% to 100%) and air-dry. Store at -20 C.

188. 188
PCR
1) Add 100 l PCR mixture on to the tissue section and seal the chamber.
2) Put the slide on the PCR block (add oil on the block surface to let the heat conduct efficiently).
Run the PCR program: 95 C-5 min; 94 C-1.0 min, 55 C-1 min, 72C-1.5 min for 30 cycles; 72
C-5 min; hold at 4 C.
Detection (Boehringer Mannheim)
5) Wash in washing buffer then add 1% blocking solution for 30 min at 37 C.
2) Add 1:500 anti-Dig conjugate for 1 hr at 37 C.
3) Wash 2 X 15 min with washing buffer.
4) Equilibrate sections for 2-5 min in detection buffer.
5) Incubate sections in color substrate (200 l NBT/BCIP (9) + 10 ml detection buffer) for 30
min. Stop the reaction by washing with DEPC water.
5. Counterstain with nuclear fast red.
RT Mixture
MgClB
2B 100 l 5 mM
10x PCR buffer 5 l 1 x
dGTP 2.5 l 0.5 mM
dATP 2.5 l 0.5 mM
dCTP 2.5 l 0.5 mM
dTTP 2.5 l 0.5 mM
Rnase inhibitor 2.5 l 2.5 U
Reverse Transcriptase2.0 l
Primer 4 1 l (50 pM)
DDHB
2B0 19.5 l
5.0 U
PCR Mixture
MgClB
2B
4 l 2 mM
PCR buffer 8 l 1 x
dCTP 2 l 200 M
dGTP 2 l 200 M
dATP 2 l 200 M
dTTP 1.9 l 190 M
Dig-11-dUTP 1.0 l 10 M
BSA 1.0 l

189. 189
AmpliTaq 1.0 l 5 U
Rnase Inhibitor 1.0 l 1 U
DEPC water 74.1 l
Primer 3 1.0 l (50 pM) 0.5 M
Primer 4 1.0 l (50 pM) 0.5 M
Figure 4.15. In Situ PCR for IBDV in the bursa
RAPID METHOD OF RNA EXTRACTION AND REVERSE TRANSCRIPTION –NESTED
POLYMERASE CHAIN REACTION (RT-NESTED-PCR)
5. RNA Extraction:
1. Homogenize 1 or 2 bursae with equal volumes of RNA extraction buffer.
2. Freeze the sample at –700
C for 5 min.
3. Thaw samples and centrifuge at 4000 rpm for 15 min.
4. Remove supernatant and digest with 100μL of Proteinase K(10 mg/ml) at 37°C for 1 hour.
5. Add an equal volume (2Ml) of phenol:chloroform:isoamylalcohol (25:24:1).
6. Centrifuge mixture at 12000 X g for 15 min, room temperature.
7. Aspirate off supernatant containing the RNA and transfer to a new tube.
8. Precipitate RNA by adding 2.5 volumes of 100% ETOH and 1/10 volume of 3M NaOac.
9. Place tubes at –70°C for 30 min or overnight.
10. Remove from freezer and centrifuge mixture at 12000 X g for 30 min.
11. Carefully remove the supernatant then wash the pellet with 70% cold ETOH.
12. Dry pellet under a stream of nitrogen gas to remove the ETOH then resuspend in 10-30 μL
DEPC water.
13. Store RNA at -70o
C until use.
II. Reverse-Transcription:
Primers: P1 (18 mer) 5’–TCAGGATTTGGGATCAGC-3’ (100pm/µl)
P2 18 mer) 5’–TCACCGTCCTCAGCTTAC-3’ (100pm/µl)

190. 190
P3 (24 mer) 5’–GCCCAGAGTCTACACCATAACTGC–3’ (50 pm/µl)
P4 (20 mer) 5’–GCGACCGTAACGACAGATCC–3’ (50 pm/µl)
5. Assemble the master mix as follows (using GeneAmp RT-PCR Kit):
Mg Cl2 2 ul
10X PCR Buffer 1 ul
dATP 1 ul
dTTP 1 ul
dCTP 1 ul
dGTP 1 ul
Rnase inhibitor 0.5 ul
Reverse Transcriptase0.5 ul
• Take out enzymes from freezer only when needed, therefore add last.
• Multiply amounts according to number of samples performed
2. Assemble Primer/template into respective tubes:
Primer P1 0.5 ul (100 pmol/ul)
RNA 1.5 ul
3. Boil template/primer (in boiling water bath) for 5 min. Transfer on ice immediately.
4. Add 8 ul of Master mix into each sample tube. Overlay mixture with one drop (75 ul). Spin
tubes 10-15 sec.
5. Run reverse transcription on GTC-1 thermocycler (file #9): 420
C for 15 min; 950
C for 5 min
then hold @ 40
C.
III. 1
st
PCR amplification
1. Assemble master mix:
MgCl2 2 ul
10X PCR buffer 4 ul
Primer P2 0.5 ul (100 pmol/ul)
DEPC water 33 ul
Taq Polymerase 0.5 ul

191. 191
2. Label new tubes (MicroAmp® tubes) with corresponding samples. Dispense 40 ul of master
mix into each tube.
3. Collect 10 ul of RT product (be careful- do not take the oil) then add to corresponding
MicroAmp tube.
4. Spin for 15 sec to mix well.
5. Load unto GeneAmp® PCR machine. Run PCR using program: 950
C 5 min (initial
denaturation); 30 cycles [950
C 1 min, 550
C 1 min, 720
C 1 min]; 720
C 7 min (final extension)
and hold @ 40
C.
IV. Nested PCR
1. Assemble master mix:
MgCl2 4 ul
10X PCR buffer 5 ul
dATP 1 ul
dTTP 1 ul
dCTP 1 ul
dGTP 1 ul
Primer P3 0.5 ul (50 pmol/ul)
Primer P4 0.5 ul (50 umol/ul)
DEPC water 33 ul
Taq Polymerase 0.5 ul
2. Label new MicroAmp® tubes with corresponding samples. Dispense 47.5 ul master mix into
each tube. Add 2.5ul of RT –PCR product to corresponding MicroAmp® tube.
3. Spin for 15 sec to mix.
4. Load unto GeneAmp® PCR machine, then run using the same program as the 1
st
PCR
amplification.
AGAROSE GEL ELECTROPHORESIS
5. Prepare running buffer – 1 X TBE
300 ml – small gel
2 liters – big gel
2. Tape the sides of the chamber, set the comb in place

192. 192
3. Prepare gel (1%)
small – 30 ml 1 X TBE
+ 0.3 g Nu Sieve agarose
big – 200 ml 1 X TBE
2 g agarose
- heat to boiling to dissolve agarose
- cool to warm temperature
- add ethidium bromide
75 l ETBr- 30 ml gel
500 l ET Br- 200 ml gel
5. Pour the gel and allow to solidify – 192rthore 10 min
5. Set up the electrophoresis chamber
5. Remove tape and comb from gel and place in electrophoresis chamber
7. Pour TBE buffer over gel to submerge it
8. Load samples and DNA markers in to wells
5 l RNA/marker
2 l loading buffer
9. Run the gel at 40-60 volts for 2-2.5 h
10. Observe nucleic acid in gel under UV light and photograph
References
1. Ausubel, F.M., R. Brent, R.E. Kingston, D.D. More, J.G. Seidman, J.A. Smith, and K. Struhl,
1992. “Preparation and analysis of DNA.” In short protocols in Molecular Biology, 2nd
ed.
Green Publishing Associates and John Wiley and Sons. New York, NY. Pp 2-29, 2-30, 3-17.
2. Hathcock, T.L. and J.J. Giambrone, 1992. Tissue-print hybridization using a non-radioactive
probe for the detection of infectious bursal disease virus. Avian Dis. 36-202-205.

193. 193
3. Hathcock, T.L. and J.J. Giambrone, 1992. Digoxigenin-labeled nucleic acid probe for the
detection of infectious bursal disease virus in infected cells. Avian Dis. 36:206-210.
5. Jackwood, D.J., D.E. Swayne, and Renee J. Fisk, 1992. Detection of Infectious bursal disease
viruses using in situ hybridization and non-radioactive probes. Avian Dis. 36:154-157.
5. Kleven, S.H., G.F. Browning, D.W. Burlach, E. Chiacas, C.J. Morrow and K.G. Whithear,
1988. Examination of Mycoplasma gallisepticum strains using restriction endonuclease DNA
analysis and DNA-DNA hybridization. Avian Path. 17:559-570.
5. Kricka, L., 1992. “Nucleic acid hybridization test formats: Strategies and applications.”
“Non-radioactive labeling methods for nucleic acids.” In Non-isotopic DNA Probe
Techniques. Academic Press, Inc. New York, NY pp 3-78.
7. Lewin, B. 1990. “DNA as a Store of Information.” “The Dynamic Genome: DNA influx.” In
Genes IV. Cell Press, Cambridge, Mass. Pp. 44-109.
8. Ley, D.H., and A.P. Avakian, 1992. An outbreak of Mycoplasma synoviae infection in North
Carolina Turkeys: comparison of isolates by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and restriction endonuclease analysis. Avian Dis. 36:672-678.
9. Sambrook, J., E.F. Fritish, and T. Maniatis, 1989. “Enzymes Used in Molecular Cloning.”
“Gel electrophoresis of DNA.” “Extraction, purification and analysis of messenger RNA from
Eukaryotic cells” “Construction and Analysis of cDNA Libraries,” In Molecular Cloning.
Cold Spring Harbor Press, Cold Spring Harbor, NY. Pp. 5.10 to 5.58, 6.3 – 6.20, 7.3 – 7.56, 8.3
- 8.9.
10. Silva, R.F., 1992. “Introduction to nucleic acid probes and hybridization.” Symposium entitled
“Improved Diagnosis of Avian Diseases Using Molecular Biology. AM. Ass. Of Avian Path.
Annual Meeting. Boston, MA. August 2 – 5.
Table of Contents

194. 194
THE POLYMERASE CHAIN REACTION
Introduction
The polymerase chain reaction (PCR) is a rapid procedure for in vitro enzymatic amplification
of DNA. The theoretical basis of PCR is presented in Figure 5.0. There are three nucleic acid
segments: the segment of double-stranded DNA to be amplified and two single-stranded
oligonucleotide primers flanking this segment. Additionally, there is a protein component (a DNA
polymerase), appropriate dNTPs, a buffer, and salts.
The primers are added in vast excess compared to the DNA to be amplified. They hybridize to
opposite strands of the DNA and are oriented with their 3’ ends facing each other so that synthesis by
DNA polymerase (which catalyzes growth of new strands in a 5’to3’ direction) extends across the
segment of DNA between them. One round of synthesis results in new strands of indeterminate length
which, like the parental strands, can hybridize to the primers upon denaturation and annealing. These
products accumulate only arithmetically with each subsequent cycle of denaturation, annealing to the
primers, and synthesis. The second cycle of denaturation, annealing, and synthesis produces two
single-stranded products that together compare a discrete double-stranded product which is the length
between primer ends. Each strand of the product is complementary to one of the two primers and can
therefore participate as a template in subsequent cycles. The amount of product doubles with every
20
cycle, accumulating exponentially so that 30 cycles could result in a 2P
amplification of the original product.
P
(270 million fold)
The PCR is based on three steps which are conducted at different temperatures, and are usually
repeated 30 to 40 times. The duration of each step varies, and taken together the steps are referred to as
a cycle. The individual steps are:
5. Denaturation (95C)
2. Primer annealing (30C—40C)
3. Polymerization (72C).
Denaturation. Generally DNA is a double stranded molecule. The strands are not identical,
but are complementary. Double stranded DNA is held together and must be separated before a new
strand can be synthesized. Denaturation refers to the separation of those two strands. In PCR, double
stranded target DNA (the DNA to be copied) is denatured by heating to 95C.
Primer annealing. Specific primers are annealed to the target DNA by lowering the
temperature of the sample. Primers are short pieces of single stranded DNA that defines where the
polymerase enzyme will begin synthesizing a new strand of DNA. Two synthetic primers are used in
the reaction, and each primer anneals to one of the target DNA strands. The primers are designed so
that the region between the two primers will be synthesized.

195. 195
Polymerization. DNA polymerase (Taq polymerase) is an enzyme that synthesizes a new strand of
DNA using DNA as the template and nucleotides (A, C, G, T), the basic building blocks of DNA.
Taq polymerase synthesizes a new strand of DNA, which begins at each primer and extends toward the
binding site of the other primer. By repeating the denaturation, annealing, and polymerization steps
many times; the segment of DNA between the primers is amplified.
Commercial thermal cyclers have been made available to automate PCR. The reaction mixture
containing the DNA template, primers, nucleotides, salts and Taq polymerase is placed in the
programmable cycler and 30 to 40 cycles of denaturation, annealing, and polymerization are conducted
which usually takes approximately 3 to 8 hours to complete. Details for programming the various
thermal cyclers for automating PCR are described in the respective manufacturer-supplied owner’s
manuals.
The amplified product is usually analyzed by agarose gel electrophoresis, purified and used for
sequencing , hybridizations, RFLP’s and other applications which need large amounts of DNA. PCR
amplification products in the 200 to 1000 base pair range can be amplified efficiently. As the size of
the fragment to be amplified increases, the efficiency of the reaction decreases, however; fragments as
large as 10,000 base pairs have been reported in the literature (Figure 5.0).
No single protocol will be appropriate for all DNA and primers. Consequently, each new PCR
amplification will require optimization. Some problems include; no detectable product, non-specific
amplification causing background bands due to mispriming, and mutations due to misincorporation.

196. 196
Figure 5.0. PCR Cartoon
Standard PCR Amplification Protocol for DNA.
While the standard conditions will amplify most target sequences, it can be highly advantageous to
optimize the PCR for a given application, especially repetitive diagnostic or analytical procedures in
which optimal performance is necessary.
1. Set up a 100- l reaction in a 0.5-ml microfuge tube, mix, and overlay with 75 l of mineral
oil:

197. 197
P P
5 6
Template DNA (10P
P
to 10P
P
target molecules*)
20 pmol each primer (TB
mB>55C preferred)
20 mM Tris—HCl (pH 8.3) (20C)
1.5 mM MgClB
2B
25 mM KCl
0.05% Tween 20
100 g/ml of autoclaved gelatin or nuclease-free bovine
serum albumin
50 M each dNTP
2 units of Taq DNA polymerase
*1 g of human single-copy genomic DNA equals 3 x 105
targets; 10 ng of yeast DNA equals
5 5 6
3 x 10P
P
targets; 1 ng of Escherichia coil DNA equals 3 x 10P
P
targets; 1% of an M13 phage equals 10P
P
targets.
2. Perform 25 to 35 cycles of PCR using the following temperature profile:
Denaturation 96C, 15 seconds (a longer initial time is usually desirable)
Primer Annealing 55C, 30 seconds
Primer Extension 72C, 1.5 minutes
3. Cycling should conclude with a final extension at 72C for 5 minutes. Reactions are stopped by
chilling at 4C and/or by adding EDTA to 10 mM.
Enzyme Concentration
A recommended concentration for Taq DNA polymerase is between 1 and 2.5 units (SA = 20
units/p mole).
Deoxynucleotide Triphosphates
Stock dNTP solutions should be neutralized to pH7.0 and concentrations determined
spectrophotometrically. Stocks are diluted to 10 mM, aliquoted, and stored at -20C in a non-self
defrosting freezer. A working stock of 1 mM for each dNTP is recommended. Concentrations
between 20 and 200 um each yield optimum specificity and fidelity.
Magnesium Concentration
Magnesium concentrations affect all aspects of the PCR. PCR’s should contain 0.5 to 2.5 mM
magnesium.
Other Reaction Components
A recommended buffer for PCR is 10 to 50 mM Tris-HCl (between pH 8.3 and 8.8). Up to 50
mM KCl can be included to facilitate primer annealing. Gelatin or bovine serum albumin (100 ug/ml)
and nonionic detergents such as Tween 20 or Laureth 12 (0.5 to 1%) are added to help stabilize
enzyme.

198. 198
Primer Annealing
The temperature and length of time vary with base composition, length, and concentration, but
temperature in the range of 55 to 72C for a few seconds yields good results.
Primer Extension
This depends on length and concentration of the target sequence and temperature. An
extension time of 72C for 1 minute for products up to 2 kb in length is generally ideal.
Denature Time and Temperature
Typical times are 30 seconds at 95C or 15 secs at 97C.
Cycle Number
The optimum number of cycles will depend on the starting concentration of target DNA.
Thirty is a common figure given for most reactions.
Primers
Concentrations between 0.1 and 0.5 um are generally optimal. Typical primers are 18 to 28
nucleotides in length and have 50 to 60% G+C composition. One should avoid complementarity at the
3’ ends of primer pairs or runs of 3 or more of C’s and G’s at the 3’ ends which may
promote mispriming.
RNA PCR
RNA can be amplified using PCR after the RNA has first been transcribed into cDNA using
reverse transcriptase. The cDNA is then amplified using procedures similarly described previously.
Perkin Elmer Cetus produces a PCR kit in which reverse transcription and amplification are done in
the same tube. The following protocol using this kit has been developed and used for IBDV-RNA
amplification.
5. Reverse Transcription
5. Assemble the following mixes:
5) Master mix
MgClB
2B Solution. 4 ul
10 x PCR Buffer II 2 ul
Sterile HB
2BO 1 ul
dGTP 2 ul
dATP 2 ul

199. 199
dTTP 2 ul
dCTP 2 ul
RNAase inhibitor 1 ul
Reverse transcriptase 1 ul
b) Downstream primer 1 ul (84pM or 500ng)
IBDV RNA 1 ul (1.5ug/ul)
HB
2BO 1 ul
2. Put primer/RNA mixture in boiling water for 10 min., transfer immediately on ice and
allow cooling to 37C before adding to 199rthoreov.
3. Overlay RT mixture with 75ul mineral oil.
5. Temperature cycling: 42C for 15 min, 99C for 5 min and 5C for 5 min.
II. PCR
5. Assemble the following mix:
Master mix
MgClB
2B Soln. 4 ul
10 x PCR buffer II 8 ul
Sterile HB
2BO 65.5 ul
Ampli Taq 0.5 ul
Total 78.0 ul
2. Dispense 78 ul of the PCR master mix into each reverse transcription tube.
3. Dispense primer
Upstream primer 1 ul (0.5 ug/ul)
Downstream primer 1 ul (0.5 ug/ul)
Final volume of each tube = 100 ul

200. 200
Figure 5.1. RT-PCR/RFLP of Unknown (left) and IBDV vaccines viruses (right)
5. Spin the tubes for 30 sec.
5. Temperature: 2 min at 95C, [1 min at 95C & 1 min at 60C, 30 cycles], 7 min at 60C, store at
4C.
Nested PCR.
The nested PCR procedure is sometimes needed to further amplify a nucleic acid fragment or as a
method to prove that the fragment amplified was indeed the fragment that was desired. In this
procedure the piece of RNA is first reverse transcribed (RT) to cDNA and then amplified as previously
described. This first PCR product is then re-amplified using a second set of internal primers (located
internal on the gene to the position of the first set of primers). This will result in the production of a
second fragment with a smaller size than the first. This smaller sized fragment should be the exact
length of the number of nucleic acid bases that are found between the second set of primers. If this
second PCR product has the exact predicted size, then it must be the intended fragment that you desire.
Nested PCR protocol for IBDV RNA.
The RTPCR protocol is as previously described. In the second PCR, the sequence of the internal
primers is as follows: P3 (5-GCCCAGAGTCTACACCATAACTGC-3) complementary to positions
654 to 677) and P4 (5-GCGACCGTAACGACAGATCC-3)(complementary to positions 1125 to
1144). Sequence numbering follows that of Kibenge from the standard APHIS virus.
The 100 ul reaction mixture contained 10 ul of 10X PCR buffer II, 2 ul each of 10mM dNTP (dGTP,
dATP, dTTP, dCTP), 1ul each of primer 3 and primer 4, 5ul of RTPCR products, 1ul of Ampli Taq, and
66 ul of ddH2O. The reaction was carried out at 95C for 5 minutes, 30 cycles at 95C for 1 minute,

201. 201
55C for 1 minute, 72C for 1 minute. A final extension was at 72C for 5 minutes and held at 4C. The
nested PCR products are detected in a 1.5% agarose gel with 0.5 ug/ml ethidium bromide.
Purification of Amplified PCR products
Various procedures are available for purification of PCR products. Purification is necessary if
the DNA is to be used for restriction fragment analysis, formation of probes, sequencing or cloning.
Two common procedures are outlined below.
Magic PCR Preps (Promega, Inc., Madison, WI)
5. Separate the DNA by electrophoresis in a low gelling/melting temperature agarose gel (Nusieve-
FMC, Bio Products Rockland, Maine) containing ethidium bromide using standard protocols
(Figure 5.1).
2. Excise the desired DNA band using a clean, sterile scalpel.
Important: The band should be isolated in <300 mg of agarose (201rthore. 300ul).
3. Transfer the agarose slice to a 1.5ml tube and incubate the sample at 70C until the agarose is
completely melted (201rthore. 2 min.).
Important: Thoroughly mix the Magic PCR Preps DNA Purification Resin before removing an
aliquot.
5. For each PCR product, prepare one Magic PCR Preps mini-column. Remove the plunger from a
3ml disposable syringe and set aside. Attach the syringe barrel to the luer-lock extension of each
mini-column.

202. 202
For purification from low gel/melt slices:
5. Add 1ml of Magic PCR Preps DNA Purification resin to the melted agarose slice from step
3 and mix by vortexing for 1 min.
For direct purification from PCR reactions:
a. Aliquot 100ul of direct purification buffer into a 1.5ml tube.
B. Add 30—300 ul of PCR reaction to the tube and mix.
c. Add 1 ml of Magic PCR Preps resin to the tube and briefly vortex 3 times over a 1 min
period.
5. Pipet the Magic PCR Preps DNA purification resin containing the bound DNA into the
syringe barrel. Insert the syringe plunger slowly, and gently push the slurry into the min-
column with the syringe plunger.
5. Wash the min-column with 2ml of Magic PCR preps column wash solution by removing
the mini-column from the syringe and taking up the solution in the syringe using the
syringe plunger, reattaching the syringe to the mini-column and gently pushing the
column wash solution through the mini-column with the syringe plunger.
7. Remove the syringe barrel and transfer the mini-column to a 1.5ml tube. Spin the mini-column
for 20 sec at 14,000 x g in a centrifuge to dry the resin.
Note: Trace amounts of isopropanol may be present in your DNA sample as a result of carry
over from the wash solution. If the presence of residual isopropanol will affect subsequent
manipulations, set the mini-column containing the resin-bound DNA at room temperature for
5-15 min; this will allow the isopropanol to evaporate.
8. Transfer the mini-column to a new tube.
9. To elute the bound DNA fragment, apply 50ul of water or TE buffer to the column and wait 1
min.
10. Spin the tube containing the min-column for 20 sec at 14,000 x g. Remove and discard the
mini-column. The purified DNA may be stored in the tube at 4 or -20C.
GELase Purification (High Activity) Epicentre Technologies
5. Load 10ul/lane in three lanes of 1% LMP-agarose.
2. Cut out the desired band and trim excess agarose (Figures 5.2 and 5.3).
3. Weigh the gel slice in a tarred tube.

203. 203
5. Soak the gel slice in three volumes of 1x GELase Buffer for 1 hour.
5. Carefully remove the excess GELase Buffer with a pipette.
5. Melt the gel slice completely at 70C. Thoroughly melting is essential-allow at least 20 minutes
in 1.5 ml plastic tubes and 10 minutes in glass tubes.
7. Equilibrate the molten agarose to 45C. Allow at least 10 minutes in 1.5 ml plastic tubes and 5
minutes in glass tubes.
8. Add the appropriate amount of GELase (1 unit per 600 mg of 1% LMP-agarose gel) 200 mg–
0.333; 500–0.8333.
9. Incubate for one hour. At 45C.
10. Add one volume of fresh 5M ammonium acetate. Ammonium acetate solutions should be
filter-sterilized, not autoclaved.
11. Add 2 volumes (4x original volume) of room-temperature ethanol. Do not use cold ethanol.
12. Pellet the nucleic acid by centrifugation for 30 minutes at room temperature. Do not use a
refrigerated centrifuge.
13. Carefully remove the supernatant with a pipette.
14. Wash the nucleic acid pellet gently with 70% ethanol.
15. Centrifuge briefly and carefully remove the ethanol wash with a pipette.
16. Re-suspend the pellet in buffer (approximately 10-15 ul).
17. Rerun the purified product on a gel (Figure 5.4.)

204. 204
Figure 5.2. Purification of PCR fragment
Figure 5.3. Cutting PCR Band from the Agarose Gel
Figure 5.4. Purified PCR products

205. 205
Unpurified fragment (left) and purified fragments (right).
Restriction Fragment Length Polymorphism of PCR Generated IBDV-DNA
Closely related organisms such as IBDV are difficult to differentiate using standard non-molecular
procedures such as serology and pathogenicity testing. With more sophisticated DNA techniques
however, even the most closely related organisms can be separated. PCR amplified products can be
digested with restriction endonucleases and separated on gels using electrophoresis. Differences in the
number and sizes of resulting fragments are referred to as DNA fingerprinting or restriction fragment
length polymorphism (RFLPS). Using PCR the amount of starting DNA target is increased which
allows far more restriction endonucleases (RE) to be used. RNA PCR also allows RNA viruses to be
transcribed into cDNA, amplified and digested with RE’s. Differences in RFLP’s between organisms
can then be determined. This procedure can help in the epidemiology of new emerging organisms and
rapidly differentiate between vaccines, pathogens or serologically closely related organisms.
The IBDV viruses are propagated and the RNA’s are extracted using procedures previously
described in the first section in this book on nucleic acid isolation and purification. Various restriction
enzymes can be used including: Pst I, BstE II, Taq I, Sac I, Apa I, and BamH I, Hpa II, Nae I, Stu I,
EcoRII, MboI, SspI, SpeI, and HaeIII. The incubation buffer for each enzyme is supplied by the
manufacturers (Promega Co., Madison, WI, or Sigma, Chemical Co., St. Louis, MO). The SspI site is
only found in the vvIBDVs, which are not found in the US. The SpeI site is absent in nonpathogenic
vaccine strains. The EcoRII site is absent in antigenically standard viruses.

206. 206
A set of primers designed for reverse transcription and PCR was selected according to the
sequence of IBDV genome segment A of strain APHIS reported by Kibenge et al., 1990. The
sequences of primer pairs are as follows: P1 primer, 5’ TCACCGTCCTCAGCTTAC 3’ (corresponds
to positions 587 to 604), and the P2 primer, 5’TCAGGATTGGGATCAGC 3’ (complementary to
positions 1212 to 1229). Two ug of purified dsRNA are denatured in boiling water for 10 min, rapidly
placed on ice for 5 min, and then used as a template for reverse transcription. Fifty pmol of P2 primer
are used to prime the cDNA synthesis with reverse transcriptase using a commercial kit (Perkin Elmer
Co., Norwalk, CT, USA).
Reverse transcription is conducted in a total volume of 20 ul containing 4 ul of 25 mM MgClB
2B,
2 ul of 10x PCR buffer II, 1 ul of DEPC-treated water, 8 ul of mM dNTPs, 1 ul of 20 units/ul Rnase
inhibitor, 1 ul of 50 units/ul reverse transcriptase, 1 ul of P2 primer, and 2 ug of denatured viral RNA.
Reverse transcription is carried out in a thermal cycler (Precision Scientific Inc., Chicago, IL, USA)
programmed as follows: 15 min at 42C; 5 min at 99C and 5 min at 5C.
The PCR is carried out in a total 100 ul volume containing 2 mM MgClB
2B, 1x PCR buffer II,
65.5 ul of DEPC-treated water, 2.5 unit AmpliTaq DNA polymerase (Perkin Elmer Co.), 0.5 uM of
each primer, and 20 ul of sample from the reverse transcription reaction. After addition of 75 ul mineral
oil (Perkin Elmer Co.) to prevent evaporation, the samples are subjected to 30 cycles (denaturation 1
min at 95C; annealing-extension 1 min at 60C) and 1 final cycle extension at 60C for 7 min in the
programmable temperature cyclic reactor.
Magic™ PCR Preps DNA Purification Kit (Promega Co., Madison, W, USA) is used to purify
the PCR products. A volume of 100 ul of direct purification buffer (50 mM KCl, 10 mM Tris-HCl pH
8.8, 1.5 mM MgCl, 0.1% Triton X-100) is combined with 100 ul PCR reactant and then mixed well.
One ml of magic™ PCR preps resin is added into the above mixture and briefly vortexed 3 times over
a 1 minute period. The mixture is placed into a mini-column with syringe plunger and then washed
with 2 ml magic™ PCR preps column wash solution (80% isopropanol). The min-column is
centrifuged for 20 seconds at 14,000 xg and the bound cDNA fragment is eluted with 50 ul DEPC-
treated water for 1 min at room temperature. The purified cDNA is centrifuged and stored at -20C
until needed.
Purified cDNA (2 ug) (Figure 5.5) is separately digested with 4 units of each of the fourteen
restriction enzymes. The digestions are incubated for 2 hours at 37 C in a buffer mixture supplied by
the manufacturer (Promega or Sigma Co.). Two of the fourteen enzymes, Taq I and BstEII require a
higher incubation temperature, 65C and 60C, respectively. The reaction is stopped by adding 3 ul of a
solution containing tracking dye (1 ml of 0.25% solution of bromphenol blue, 3 ml glycerol, and 250 ul
of a 50 mM EDTA).
The digested cDNA is subjected to horizontal gel electrophoresis containing 4% NuSieve
agarose (FMC Bioproducts Co., Rockland, ME, USA) using Tris-borate buffer containing 0.5 ug/ml of
ethidium bromide. The DNA fragments are visualized by UV illumination at 300 nm and
photographed. BioMarker™ (Bioventures, Co., Murfreesboro, TN, USA) bio-engineered DNA is used
as a molecular marker.

207. 207
a
Figure 5.5. Performing PCR test under safety hood
All amplified cDNA show almost identical mobilities on 1.5% agarose gel (Figure 2.19). With
all strains, a cDNA fragment of approximately 643 bp is amplified. These IBDV isolates can not be
differentiated on the basis of the length of their amplified cDNA.
Restriction fragment profiles generated by restriction enzymes NaeI, StuI, TaqI, and SacI, show
differences among isolates (Table 2.18), indicating that this region has a high frequency of genetic
variations among IBDV isolates. Two “variant” isolates in subtype 6 (Delmarva isolates A and E) can
be differentiate by this test, but not by monoclonal antibodies or VN testing. All IBDV isolates show
the same restriction profiles when HpaII, PsiI, BstEII, ApaI, and BamHI enzymes are used. An RFLP
pattern (Table 5.0) represented by Clone Vac D-78® isolate digested by fourteen restriction enzymes is
shown.
Reverse transcription with PCR followed by RE digestion and electrophoresis can detect
genetic variations among isolates of IBDV. This procedure is sensitive, and simpler than sequencing
for detecting genetic variations among isolates that are within the same subtype and can not be
differentiated using monoclonal antibodies or VN testing.
Table 5.0. Reciprocal comparison of cleavage site differences among nine isolates of IBDV
serotype I
Isolate Lukert APHIS BV D-78 BVM 2512 Var-E Var-E GLS-5
Lukert - 2P
P
3 2 1 2 1 2 3
APHIS 2 - 1 2 3 0 3 2 1
BV 3 1 - 3 4 1 4 3 2
D-78 2 2 3 - 1 2 1 2 1
BVM 1 3 4 1 - 4 0 1 2
2512 2 0 1 2 3 - 3 2 1
Var-A 1 3 4 1 0 3 - 1 2
Var-E 2 2 3 2 1 2 1 - 1
GLS-5 3 1 2 1 2 1 2 1 -
a
Number of cleavage site differences.

208. 208
In Situ PCR for IBDV RNA Detection
In Situ PCR is a relatively new technique which combines the advantages of In Situ
Hybridization (localization of nucleic acid in cells) with PCR (amplification of the target for increased
sensitivity). A procedure for In Situ PCR for the detection of IBDV RNA is listed herein. The tissues
are first prepared for the PCR reaction and then hybridized with a nonradiolabeled probe. Tissue
sections are deparaffinized with xylene and then rehydrated by exposure to a series of decreasing
alcohol solutions (100, 95, and 70%). The tissues are then treated with proteinase K as in the In Situ
hybridization test to allow the viral RNA to come in contact with the PCR and hybridization solutions.
The slides are then washed with water and air dried.
The PCR solution contains 20 ul MgClB
2B (25mM), 40 ul 10x PCR buffer II, 10ul each 10mM
dGTP, dATP and dCTP, 5ul dTTP and 2 ul of 1mM DIG-11-dUTP, 2.2 ul of 20 mg/ml BSA, 1 ul of
each primers, 1 ul of Taq and 328 ul of ddHB
2BO. Ten ul of the mixture is added to tissue on the slides,
covered with Probe-clip and placed on Slide Cycler (COY CO). The temperature cycler is
programmed at 95 C for 5 minutes, followed by 30 cycles at 95 C for 1 minute, 55 C for 1 minute, 72
C for 1 minute and final extension at 72 C for 5 minutes. Hold at 4 C.
For the hybridization, the sections are first prehybridized to reduce nonspecific binding of the
probe to the target with carrier nucleic acids and BSA as stated before in the In Situ hybridization
protocol. After this blocking, the tissues are reacted to the same DIG-labeled cDNA probe as stated in
an earlier section. The color detection again follows the Boeinger Manheim Kit with the addition of
X-phosphate and NBT Solution. A blue precipitate will form in a few minutes where the probe binds
to the target when examined under the microscope.
The increased sensitivity of this test results from the PCR amplification of the target. This
should permit earlier or later localization of the viral target than is permitted with only In Situ
hybridization.
Real Time PCR
Introduction
Today, Real Time PCR is widely used in gene expression quantification and detection. This
technology is a breakthrough in the determination of DNA copy number and in mutation analysis
studies. It’s also a method to detect Single Nucleotide Polymorphisms (SNP’s). Due to the
possibilities to perform high-throughput experiments in an easy way and because post-PCR operations
are omitted, real time PCR became an important method in genetic research and diagnosis.
The basic idea behind real time PCR is the measurement of the amount of amplification product during
every cycle of the polymerase chain reaction. Manufacturers have developed instruments to examine
multiple samples in a reliable way. Detection is done by capturing emission signals of the reaction
wells. Different detection chemistries are used, including Intercalating dyes, Hydrolysis probes,
Hybridization probes and Molecular beacons.
According to the PCR background, ‘good’ primers are necessary. The design of primer sets and probes
with sufficient specificity and good working conditions can be very laborious. To by-pass this, we

209. 209
constructed a database containing primer and probe sequences together with additional information
about the gene or SNP such as LocusLink ID, Reference SNP cluster ID (dbSNP), official gene name,
annealing temperature et cetera.
Real Time PCR Development
Before the existence of real time PCR, other more labor intensive PCR methods were used to
quantify nucleic acid sequences. A first method works in a semi-quantitative manner and sampling is
done at the phase of exponential growth of PCR products. During the exponential phase the amount of
PCR product doubles and the reagents aren’t run out. For each individual sample the optimal sampling
time point needs to be determined, which makes this method very time-consuming and unpractical.
In an alternative system, a competitor sequence is added to the reaction. The competitor is
designed in such a way that it binds the same primers and one can distinguish it from the original
template by length or sequence difference. A series of competitive PCR’s with different concentrations
of competitor are performed, to find the competitor concentration which results in bands with equal
intensity on gel electrophoresis. For every target sequence a different competitor needs to be designed.
The above described methods require post-PCR manipulations so the chance of carry-over
contamination is apparent and the measurement range diminishes.
In 1993, the first experiments were conducted of what is today a practical method and which can
be highly automated. The complete polymerase chain reaction was followed in ‘real time’ by detecting
the fluorescence intensity of the intercalating dye ethidium bromide. At the moment of exponential
amplification, the increasing fluorescence is in proportion to the exponentially growing number of
amplification products. The time or PCR cycle where the fluorescence signal significantly increases
above background is in proportion to the initial amount of starting material in the sample well. The
sooner the threshold is crossed, the more starting material was present. Real time quantitative PCR has
a dynamic quantification range of seven log10 values so various sequence concentrations can be
accurately measured.
Detection Strategies
Intercalating Dyes
The simplest detection method in real time PCR requires a dye that emits fluorescent light when
intercalated into double-stranded DNA. The intensity of the fluorescence signal is proportional to the
amount of all double-stranded DNA present in the reaction. The first experiments were performed with
ethidium bromide and YO-PRO-1 as intercalating dyes. Actually, SYBR Green I is the most frequently
used. Other dyes used are: Thiazole Orange (TO), Oxazole Yellow (YO), BO, and BEBO. Because
these dyes don’t make a distinction between the different dsDNA molecules in a PCR reaction, the
formation of non-specific amplicons must be prevented. Therefore, accurate primer design and
optimization of the reaction conditions for the primers are required. After the PCR reaction, an
additional time-temperature program provides a melting curve to detect the presence of high amounts
of non-specific sequences. These non-specific sequences show melting peaks different to the template
sequences. Thanks to this control option, intercalating dyes are reliable.

210. 210
Nevertheless, when considering these precautions, this technique provides a simple and effective
method to monitor PCR’s.
Hydrolysis Probes
The hydrolysis or Taqman probe chemistry depends on the 5’-3’ nuclease activity of Thermus
aquaticus DNA-polymerase. A DNA probe, labeled with a reporter dye and a quencher dye at opposite
ends of the sequence, is designed to hybridize within the amplicon. FAM (6-carboxyfluorescein) and
TAMRA (6-carboxy-tetramethyl-rhodamin) are most frequently used as reporter and as quencher
respectively. In an intact probe, the fluorescence of the reporter is suppressed by the quencher. Once
the probe hybridizes to the template, the polymerase cleaves the probe and the fluorescence of the
reporter increases in proportion to the quantity of amplicons present.
Hybridization Probes
This detection method relies on the fluorescence resonance energy transfer (FRET) principle and
makes use of two oligonucleotide probes. One probe is labeled with a donor fluorochrome
(fluorescein) at the 3’ end and the other probe is labeled with an acceptor dye (Cy5, LC Red 640) at the
5’ end. The probes can hybridize to the target sequences so that they are one base distant and head-to-
tail oriented. In that position, the energy emitted by the donor dyes excites the acceptor dye of the
second probe, which then emits fluorescent light at a longer wavelength. The ratio between donor
fluorescence and acceptor fluorescence increases during the PCR and is proportional to the amount of
target DNA generated.
Molecular
Beacons
Molecular Beacons are stem-and-loop shaped hybridization probes with a fluorescent dye on one
end and a quencher dye on the opposite end. The loop fragment of the probe is complementary to a
sequence of the template and the two ends are complementary to each other, forming a hairpin like
structure. When the probe is not hybridized, the fluorophore and the quencher are in close proximity
resulting in a suppression of fluorescence. Once the conditions are optimal for hybridization, the probe
stretches out and the quenching effect drops, resulting in detectable fluorescence.
Because the hairpin shape is very thermostable, molecular beacons have a high specificity to
hybridize to a target, which enables the detection of single nucleotide differences. This isn’t possible
with the Taqman chemistry. Therefore, molecular beacons are suitable for mutation analysis and single
nucleotide polymorphism detection.

211. 211
Real-time RT-PCR Detection of Avian Influenza Virus
5. Real-time RT-PCR
The real-time reverse transcriptase-PCR (RRT-PCR) is conducted using the Lightcycler® (Roche©
)
instrument utilizing a one-step protocol with specific primers designed to amplify a portion of the
genome that contains a target PCR sequence. Hydrolysis probe assays, conventionally called TaqMan
assays, can technically be described as homogenous 5’-nuclease assays, since a single 3’-non-
extendable hydrolysis probe, which is cleaved during PCR amplification, is used to detect the
accumulation of a specific target DNA sequence. The fluorogenic probes are labeled at the 5’ end with
a reporter dye (FAM) and a quencher dye (Tamra) at the 3’ end. When the probe is intact, the reporter
dye is close enough to the reporter fluorescent signal. When the probe is hybridized to the target, the
5’ nuclease activity of Taq-polymerase will cause hydrolysis of the probe and separation of these two
dyes from each other. This separation results in an increase in fluorescence emission of the reporter
dye, which is detected spectrophotometrically. In the cleaved probe, the reporter is no longer
quenched and emits a fluorescent signal when excited. The amount of fluorescence recorded is
proportional to the amount of target template in the sample.
R: Reporter Dye
Q: Quenching Dye
TaqMan Probe specifically anneal to complementary template DNA

212. 212
2. H5
H5+1456 (Forward): 5’-ACGTATGACTATCCACAATACTCA-3’ (24)
H5-1686 (Reverse): 5’-AGACCAGCTAACATGATTGC-3’ (20)
3. H7
H7+1244 (Forward): 5’-ATTGGACACGAGACGCAATG-3’ (20)
TaqMan Probe is cleaved by Taq Polymerase at extension stage
Adapted from http://www.bio.davidson.edu/Courses/Molbio/MolStudents/spring2003/Pierce/realtimepcr.htm
II. Primers and Probes
5. Matrix
M+25 (Forward): 5’-AGATGAGTCTTCTAACCGAGGTCG-3’ (24)
M+64 (Probe) 5’-{56-FAM}TCAGGCCCCCTCAAAGCCGA{36-TAMSp}-3’ (20)
M-124 (Reverse): 5’-TGCAAAAACATCTTCAAGTCTCTG-3’ (24)
H5+1637 (Probe): 5’-{56-FAM}TCAACAGTGGCGAGTTCCCTAGCA{36-TAMSp}-3’ (24)
H7+1281 (Probe): 5’-{56-FAM}TAATGCTGAGCTGTTGGTGGC{36-TAMSp}-3’
(21)
H7-1342 (Reverse): 5’-TTCTGAGTCCGCAAGATCTATTG-3’ (23)
• Primers
Dilute primers to 200pmol/μl (200μM) in 1x TE (pH 8.3) buffer (Promega®
) for the stock
dilution and 20pmol/μl in Rnase-free water for the working dilution. Dilute stock solution at
1:10 in Rnase-free water to make the working solution.

213. 213
**For each primer (forward or reverse) use 10pmol per 20μl reaction.
• Probes
It is important to avoid expose the probes to direct light, because the covalently bound
fluorescent dye are light sensitive.
Dilute probes to 120pmol/μl (120μM) in 1x TE buffer for the stock solution and 6pmol/μl in
Rnase-free water for the working solution.
A total of 3pmol of the matrix, H5 or H7 probe are used, respectively per 25μl reaction.
**Diluted probe should not be frozen/thawed more than 4 times.
III. One-step RT-PCR Kit
5. Extraction of RNA (Qiagen Rneasy method) from swab specimens.
Pooled tracheal and cloacal swabs (5 swabs/tube) – Total RNA is extracted from specimens using
the Qiagen Rneasy Extraction Kit (cat. 74103 20 preps,#74104 50 preps or #74106 250 preps,
Qiagen, Valencia,CA). The sample volume used for each extraction ranged from 50-350 µl
(depending on availability) and the extracted RNA was resuspended in 30µl of sterile distilled
water.
5) Vortex swab specimen fluid and transfer 500µl of sample into a micro centrifuge.
2) Add 10 µl ß-ME (Sigma, cat. #M6250, St. Louis, MO) per 1 ml RLT lysis buffer (this buffer
will be stable for 1 month after addition of ME – be sure to date this buffer).
4) Place 500 µl of RLT lysis buffer with β-ME into the microcentrifuge tube containing sample.
Vortex for 15 sec. (The LRT buffer can be mixed with the specimen by pipetting up and down
vigorously 4-6 times)
5) Pulse spin. Add 500 µl 70% ETOH and vortex well. Centrifuge lysed swab specimen for 5 min.
at 5000 X g at RT.
6) Transfer the supernatant to a Rneasy Qiagen column. Centrifuge for 15 sec. at 8000 X g at RT.
Check to assure the entire specimen has flowed through the column. Repeat until all of
specimen has been applied to the column.
• Alternatively, a QiaVac manifold can be used to pull the specimen and wash solutions
through the collection columns. This will increase the efficiency and eliminate the need
to centrifuge the columns at the steps 5 to 9.
7) Add 700 µl of RW1 buffer to the column and centrifuge for 15 sec. at 8000g and place the
column in a clean collection tube.

214. 214
8) Add 500µl RPE buffer to the column and centrifuge for 15 sec. at 8000g. Discard flow in the
collection tube.
9) Repeat step 8. Place column in a new 2 ml collection tube.
10) Centrifuge the empty column for 2 min. at full speed and discard the collection tube.
11) Place the column in a 1.5ml microfuge tube and add 50 µl Rnase free H2O to the column. Do
not touch the silica-gel membrane with the 214rthoreov tip. Incubate at room temperature for 1
min. Elute RNA by centrifuging for 1 min. at 10,000rpm. Discard column. Store at 4 or at -20 C
if the sample cannot be tested on RRT-PCR within 24 hours.
II. Trizol LS Extraction for tissue samples.
- Appropriate tissue (lung, spleen, intestine) should be processed by preparing a 10-20% tissue
homogenate. Alternatively, 5mm piece tissues are added to 2.0 ml of brain-heart infusion
broth, frozen solid, thawed and centrifuged. The supernatant from this tissue pool (250 µl) is
extracted using the trizol procedure. Note: Don’t pool tissues from more than one bird.
5) Centrifuge tissue specimens at 1,500 x g for 30 min. Collect 250ul of the tissue supernatant
and transfer to 1.5ml tube. 750ul of Trizol LS is added to the tube and sample is vortexed for
15 sec. Incubate at room temperature for 7 min.
2) Pulse spin.
3) Add 200 ul 100% chloroform to the sample/Trizol homogenate. Vortex for 15 sec. Incubate at
RT for 7 min.
4) Centrifuge at 12,000 x g for 15 min at RT.
5) Transfer 450ul of the upper aqueous layer to a separate tube. Add 500ul of 100% isopropanol.
Invert tube several times to mix. Hold at RT for 10 min.
6) Centrifuge at 10,000 x g for 10 min at 4 C.
7) Decant liquid. Add 1.0 ml of 80% ethanol. Mix gently.
8) Centrifuge at 10,000 x g for 5 min at 4 C.
9) Decant ethanol. Invert tube on a clean tissue wipe and allow to air dry for 10 min. It is
important not to let the RNA pellet over-dry, as this will decrease its solubility.
10) Hydrate pellet in 50ul of Rnase free water and incubate at 4 C for 1 hr or overnight. Briefly
vortex to resuspend pellet before pipetting.

215. 215
Alternatives:
5) Superscript One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen)
2) RNA amplification Kit (Roche Molecular Biochemicals)
IV. Setting-up the PCR Mastermix
5. It is important to keep a “Clean” working environment.
• Two work areas are required for this procedure: a “clean” area (room 324-A) with a dedicated
BSC, freezer and supplies, and a thermal cycling area (room 324-B).
• Never introduce RNA/DNA material into the “clean” area and always change gloves before
entering the “clean” area.
• Set up the reactions with the reaction tubes (nuclease-free) in the cooling block and use aerosol
resistant pipette tips. Use fresh gloves.
• Frequently treat the work areas and instruments (pipettes!) with DNAzap, RNAsezap, and /or
overnight UV-irradiation.
• For all batches of PCRs, calculated the number of samples and prepare a master mix of the
DNA polymerase accordingly. In addition to duplicates of the specimens, add asset of
appropriate control reactions as indicated in the specifics for each PCR.

216. 216
2. The recipe (follow the order of the ingredients)
VOLUME PER REACTION FINAL CONCENTRATION
Rnase-free water (QIAGEN Kit) 6.55μl
5x PCR buffer 4μl 1x
25mM MgCl2
dNTPs (10mM each)
1μl
0.65μl
3.75mM
325μM each dNTP
Forward primer (20pmol/μl) 0.5μl 10pmol/20μl
Reverse primer (20pmol/μl) 0.5μl 10pmol/20μl
Rnase Inhibitor (13.3 U) 0.5μl 6.5U
Enzyme Mix 0.8μl
Probe (6pmol/μl) 0.5μl 0.15mM (3pmol/20μl)
Total 15μl
3. Mix the reagents and centrifuge briefly. (Once the probe has been added to the reaction mix,
minimize exposure to light).
V. Setting-up PCR
5. To each Lightcycler® Capillary, add:
15μl PCR Mastermix
5μl specimen RNA (or control) in elution buffer
2. After closing the Lightcycler® Capillaries with the plastic stopper, load the capillaries into the
carousel and spin at 3000rpm for 5 sec in the specialized LC Carousel Centrifuge.
3. Load the carousel into the Lightcycler® and run the designated stored program.
5. The Lightcycler® is control by a computer program named: Lightcycler®-Software V4.05.3
• The RT step cycling for one-step RT-PCR kit:
RT step 1 cycle 30min 50°C
15min 95°C

217. 217
• The cycling condition for gene specific primer and probes sets:
Probe/ Primer Set # of Cycles Step Time (second) Temperature (°C)
Matrix 45 cycles
Denaturation 0 94
Annealing 20 60
H5 40 cycles
Denaturation 0 94
Annealing 20 55
Extension 5 72
H7 40 cycles
Denaturation 0 94
Annealing 20 58
Extension 5 72

218. 218
..
""
=
=
VI. Results
• Real-time RT-PCR in progress......
Current fluoresoenoe
----- - ---------l
J
=
,..,.
,
Fluoreso•noe History
131>
110
!’”’
“.’.30
“
·’
==== =======l
IUS:S1 CU9..S1 1.01.&1
t--.< -a...u..c--.--::--..........,

219. 219
• A typical detection curve:
••
11
“
II
1 2 3 5 IS 7 8 9 1011121314t51E171818’202122232425
.2
,1
..27
.2
.82930313l3334363SS73131tCJ•t.t2.t34U:54a41t8f950

220. 220
Target Hold Slope Sec Target Step size Step Delay
( C) (hh:mm:ss) (°C/s) (•C) ("C) (cycles) Acquisition Mode
94 00:00:00 20 0 0 0 None
60 00:00:20 20 0 0 0 Single
• A typical final report:
LightCycler Software Version 4.0
,AN Matrix Standard Curve (KG) Mar-29-1
.periment
Creation Date 312912005110:30 PM
Operator Teresa
Sta.rt Time 312912005 1:14:00
PM Run State Completed
Macro
Last Modified Date 3129/2005 2:42:27
PM Ovmer Teresa
End Time 312912005 2:28:20
PM Software Version LCS4 4.0.0.23
Macro Owner
Templates Avian Influenza Matrix Detection 2Run Protocol
RunNotes
Programs
Program Name RT Step
Cycles Analysis Mode None
Target Hold Slope Sec Target Step size Step Delay
(OC) (hh:mm:ss) (“C/s) cc> (“C) (cycles) Acquisition Mode
50 00:30:00 20 0 0 0 None
95 00:15:00 20 0 0 0 None
‘-
Program Name Matrix
Cycles 50 Analysis Mode None
r
Absolute Quantification
Settings
Channel 530
Program Matrix
Results
Inc Pos Name
E’J 1 Negative
E’J 2 Standard 1
E’J 3 Standard 2
El 4 Standard3
El 5 Standard 4
El 6 Standard 5
,.....El 7 Unknown
Color Compensation Off
Method Automated (P’max) Units
Type CP Concentratio Standard
Standard
Standard 24.88 9.16E3 1.00E4
Standard 28.21 1.05E3 1.00E3
Standard 31 61 1.15E2 1.00E2
Standard 37.76 1.00EO 1.00EO
Standard 35.54 8.99EO 1.00E1
Unknown 32.81 5.29E1
AIV Matrix Standard Curve (KG) Mar-29-1 3/29/2005 Page 1of 2

221. 221
l – 1:Negetlve
A.-pllflo•tion Curves
2: Stenclard1 - 3:Stenclard 2 - 4:Standerd 3 - 5:Standard 4 6:
Standard 5
7:lk11mown
22
20
18
16
12
6
6
2
1 2 3 4 5 s 7 6 910111213141S161716192021222:32425262726293031323334353637363940414243444546474849so
C)ldn
s...._,.eurv.
l-Std.curve • Se rp es
r”
_,ror: 0.0178 36·
Efficiency:1.915 37·
36·
35·
34
l 33
26
27
25
0 2 3 4
LouConcentr.tlon
AnalysisNotes
AJV Matrix Standard Curve (KG) Mar-29-1 312912005 Page 2 of 2
Notice:
The experiment included a transcribed RNA (positive control). It should be diluted by the user to a
working dilution that will have a cycle threshold of ap

222. 222
References:
BASSLER, H.A., FLOOD, S.J.A., LIVAK, K.J., MARMARO, J., KNORR, R. & BATT, C.A. (1995). Use
of a Fluorogenic Probe in a PCR-Based Assay for the Detection of Listeria monocytogenes. Applied and
Environmental Microbiology, 61(10), 3724-3728.
BUSTIN, S.A. (2000). Absolute quantification of mRNA using real-time reverse transcription polymerase
chain reaction assays. Journal of Molecular Endocrinology, 25, 169-193.
BUSTIN, S.A. (2002). Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends
and problems. Journal of Molecular Endocrinology, 29, 23-39.
GIESENDORF, B.A., VET, J.A., TYAGI, S., MENSINK, E.J., TRIJBELS, F.J. & BLOM, H.J. (1998).
Molecular beacons: a new approach for semiautomated mutation analysis. Genome Research, 44, 482-486.
HIGUCHI, R., FOCKLER, C., DOLLINGER, G. & WATSON, R. (1993). Kinetic PCR Analysis: Real-time
Monitoring of DNA Amplification Reactions. Bio/Technology, 11, 1026-1030.
ISHIGURO, T., SAITOH, J., YAWATA, H., YAMAGISHI, H., IWASAKI, S. & MITOMA, Y. (1995).
Homogenous Quantitative Assay of Hepatitis C Virus RNA by Polymerase Chain Reaction in the Presence
of a Fluorescent Intercalator. Analytical Biochemistry, 229, 207-213.
LIVAK, K.J., FLOOD, S.J., MARMARO, J., GIUSTI, W. & DEETZ, K. (1995). Oligonucleotides with
fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and
nucleic acid hybridization. PCR Methods and Applications, 4(6), 357-362.
MARRAS, S.A., KRAMER, F.R. & TYAGI, S. (1999). Multiplex detection of single-nucleotide variations
using molecular beacons. Genetic Analysis, 14, 151-156.
MORRISON, T.B., WEIS, J.J. & WITTWER, C.T. (1998). Quantification of Low-Copy Transcripts by
Continuous SYBR® Green I Monitoring during Amplification. BioTechniques, 24(6), 954-962.
TYAGI, S. & KRAMER, F.R. (1996). Molecular beacons: probes that fluoresce upon hybridization. Nature
Biotechnology, 14, 303-308.
UTable of Contents

223. 223
Molecular Techniques for the Isolation and
Detection of Avian Influenza from Wild Birds
OBJECTIVE:
To explore and evaluate methods for detecting avian influenza virus (AIV) in the wild bird
population.
ABSTRACT
Cloacal swabs taken from hunter-killed wild birds were inoculated into eggs for incubation. The
presence of avian influenza virus (AIV) was detected by hemagglutination tests on the harvested
allantoic fluids. The use of the FluDetect Influenza Type A ELISA test kit was evaluated for detecting
avian influenza from swab samples and allantoic fluids. RNA extracted from swab samples (by Trizol
method) and allantoic fluids (by Qiagen method) was tested for AIV by real-time RTPCR (RT-PCR).
Hemagglutination inhibition tests were used to test for Newcastle Disease Virus (NDV) in suspect
samples.
INTRODUCTION
Avian Influenza is caused by type A influenza virus of the Orthomyxoviridae family. Viruses of
the Orthymyxoviridae family are single-stranded RNA viruses. Type A influenza virions are spherical
with hemagglutinin (HA) and neuraminidase (NA) capsid proteins. Hemagglutinins agglutinate red
blood cells, while neuraminidases catalyse the breakdown of glucosides containing neuraminic acid, an
amino sugar. Type A influenza viruses are classified into H and N subtypes based on these proteins.
The most prominent subtypes that cause avian influenza are H5, H7, and H9. H5 subtypes can be high
or low pathogenic and has caused severe illness and death in chickens as well as in humans. H7

224. 224
subtypes can be highly or low pathogenic; infection in humans is rare but has been documented to cause
conjunctivitis and respiratory symptoms. H9 subtypes have only been documented in low pathogenic
form.
Avian flu is endemic in wild bird populations. All of the known HA (16) and NA (9) subtypes
and most H-N combinations have been detected in the wild bird reservoir, predominantly ducks, geese
and shorebirds, which form a reservoir for the influenza A virus. In waterfowl, the virus targets the
gastrointestinal tract, usually without producing visible symptoms. Infected birds can shed virus
particles for as long as 30 days. Severe illness may occur when the virus crosses the species border to
domestic poultry. The migratory nature of these birds increases the risk of infection to humans and
other birds. Other birds contract avian influenza by contact with contaminated saliva, mucous, or feces.
Outbreaks of the virus can be devastating in domestic poultry operations, with highly pathogenic H5 and
H7 subtypes having mortality rates between 90 and 100 percent. Low pathogenic strains usually
decrease egg production or cause low levels of mortality. The risk to commercial poultry operations in
the United States is relatively low, as exposure to the wild bird population is limited. However, in other
countries, small, free-range flocks are easily infected. Swine and poultry raised by the same human
household provide a perfect opportunity for the virus to pass back and forth between the different
species. In the process, different strains of virus could reassort, producing a new strain able to infect
humans. Additionally, reassortment causes antigenic shift – meaning the new virus would have new
surface proteins, reducing the effectiveness of any acquired immunity or existing vaccines.

225. 225
MATERIALS AND METHODS
Note: All procedures should be conducted in according to Biosafety Level Two procedures. (See
Appendix XI)
I. Saing Procedure
5. Cloacal swabs were taken from hunter-killed wild birds and transported to the lab in tubes of
Brain-Heart Infusion Broth with Penicillin and Streptomycin (see Appendix I). Brain-Heart
Infusion Broth is a general transport medium, while the antibiotics limit bacterial contamination.
The types and gender of each duck, along with sampling date and location, were recorded for
each cloacal swab (see Appendix II). Taking the samples from healthy hunter-killed birds
decreases the likelihood that highly pathogenic strains will be isolated; however, finding and
sampling sick wild birds would be a difficult effort.
Figure 1: Obtaining cloacal swabs from hunter-killed wild ducks. Picture taken by Mr. J. W.
Teaford

226. 226
Samples were transported back into the lab and then processed to remove most of the solid debris
(see Appendix III). During this process, it is important to remove the samples from the warm water bath
as soon as they are thawed, and also to limit the number of times the samples are thawed and refrozen,
as this can decrease virus titer. The broth from each sampling tube was stored in two vials. The A vial
was used for inoculation into eggs, and the B vial was stored for other tests.
II. Inoculation and Culture
Fluid from the swab sample vials were inoculated into ten day old embryonated eggs to allow
any virus present to replicate. Eggs were obtained from Auburn University’s special pathogen-free
(SPF) facility. Using SPF eggs prevents contamination of the virus culture; however, if enough SPF
eggs are not available, commercial chicken eggs can be used. These eggs were incubated for 10 days
before inoculation with sample broth. During this period, the eggs were periodically candled to cull the
dead or infertile ones. On the 10th
day, the eggs, four for each sample, were inoculated with the swab
samples (see Appendix IV). Again, make sure to thaw the samples quickly and only thaw as many as
will be inoculated into eggs immediately. If there is more than 0.6 mL of the sample fluid, it should be
divided equally among the four eggs. When injecting the sample fluid into the eggs, care should be
taken not to puncture the embryo or the yolk. Inoculated eggs were candled every day during the
incubation period. If the embryos are dead, it should be marked on the egg and then on the HA results
sheet which day they died. Deaths during the first twenty-four hours are most likely, but not necessarily,
due to trauma during inoculation or bacterial infection. Deaths during the second day are likely to be
due to the pathogenicity of the virus. The allantoic fluids of eggs that died on the second day often
tested positive for hemagglutination.

227. 227
Figure 2: Pre-puncturing eggs during the inoculation process
III. Hemagglutination (HA) Detection
After the inoculated eggs have been incubated for 48-72 hours, the allantoic fluids were
harvested and tested for hemagglutination (see Appendix VI). Positive results (agglutinated red blood
cells) indicate the presence of a hemagglutinating agent, such as avian influenza or Newcastle Disease
Virus (NDV). After the initial HA testing, allantoic fluids of the eggs that test positive were harvested
completely and then the HA titer was determined to calculate the concentration of the virus or other
hemagglutinating agent (see Appendix VII). When harvesting the allantoic fluid, care should be taken
not to allow it to become contaminated with blood or yolk, as this can interfere with the
hemagglutination tests. If necessary, a sterile swab can be used to press down the chorioallantoic
membrane while sipping the allantoic fluid off the top. Pipettes and swabs can be shared between eggs
from the same sample but not between eggs from different samples. When mixing and transferring fluid
from well to well during the titration, take care to pipette slowly and smoothly, minimizing bubbles, to
maximize accuracy. Correct pipetting is important to make sure the concentrations are accurate during
the titration test.

228. 228
Figure 3: HA Test plate, showing positive, negative, and incomplete hemagglutination
Figure 4: HA Titer test

229. 229
IV. AC-ELISA
An ELISA (Enzyme-Linked Immunosorbent Assay) test is a rapid tool for detecting Avian
influenza. ELISA tests use monoclonal antibodies in order to detect Influenza A. In this study, Flu-
DETECT’s Avian Influenza Virus Type A Antigen Test kit was used with modified procedures (see
Appendix IX). This kit is intended for use for AI detection from cloacal swabs of symptomatic
commercial birds, and it calls for five swabs for each bird pooled into the same sample. However,
probably because our cloacal swabs were from healthy wild birds and only consisted of one swab per
bird, our attempts to detect AI directly from swab fluid samples were not successful. However, the kit
was able to detect AIV from allantoic fluid (AF) samples.
Figure 5: FluDetect Flu A Test (ELISA)

230. 230
RNA extraction
To prepare for RRT-PCR, RNA must be extracted, either from the allantoic fluid harvested from
HA positive eggs or directly from the corresponding swab sample fluid. Two methods were used in this
study.
The Qiagen RNeasy Mini kit was used for the extraction of RNA from allantoic fluids (see
Appendix VII). Because this kit uses filtered centrifuge columns, it is not ideal for swab samples or
tissue samples that might contain debris, as the sediment would clog the filter. The β-ME buffer lyses
the cells and denatures proteins. During centrifugation, the filtered Qiagen columns bind RNA while
allowing other cellular contents to wash through. It might take two centrifugations for each sample, as
the Qiagen columns only hold 850 uL at one time. When adding RNase free water to the extracted RNA
at the end of the procedure, only add 40-30 uL, and add it as close to the center of the filter as possible
without touching it with the pipette.
Trizol LS Reagent (see Appendix VIII) was used for RNA extraction directly from swabs. This
method is more effective for tissue samples or for swab samples that are contaminated with a large
amount of solid debris. When using this method on fluids from swab samples, skip the initial
preparation of a tissue homogenate and the first 30 minutes centrifugation. In this method, the Trizol
reagent lyses the cells. Chloroform precipitates the Trizol reagent, causing DNA and proteins to form a
middle layer with the RNA in the uppermost aqueous layer. After decanting the ethanol, the RNA pellet
can be dried more quickly by using nitrogen gas.

231. 231
Figure 6: RNA Extraction with Trizol Reagent
With either method, the resulting RNA concentration can be measured using the Nanodrop
machine. (see Appendix XIII).
VI. Reverse-Transcriptase Real-Time Polymerase Chain Reaction
Real-time Reverse-Transcriptase Polymerase Chain Reaction (RRT-PCR) is a rapid method
fordetecting viral nucleic acids such as AIV. There are various chemistries that can be used for RRT-
PCR such as: FRET, molecular beacons, etc. The “hydrolysis” probe technique was used in this study
(Figure 18). The probe carries two fluorescent dyes in close proximity, with the quencher dye
suppressing the reporter fluorescence signal. The 3’ end of the hydrolysis probe is phosphorylated, so it
cannot be extended during PCR. In the annealing phase of PCR, primers and probes specifically anneal
to the target sequence. As the DNA polymerase extends the primer, it encounters the probe. The
polymerase then cleaves the probe with its inherent 5´ nuclease activity, displaces the probe fragments
from the target, and continues to polymerize the new amplicon. The DNA polymerase will separate the
reporter and quencher only if the probe has hybridized to the target. In the cleaved probe, the reporter
dye is no longer quenched and therefore can emit fluorescent light that can be measured by one channel

232. 232
of the LightCycler® optical unit. Thus, the increase in fluorescence from the reporter dye directly
correlates to the accumulation of PCR products.
Figure 7: Hydrolysis/Taqman probe RRT-PCR technique
First, a reverse-transcriptase step creates double-stranded DNA complementary to the RNA
stand. Then, that DNA is amplified using Taq polymerase (DNA Polymerase from Thermus aquaticus),
nucleotides, and forward and backward primers. As it is amplified, a sequence specific fluorescent
probe binds to the target DNA. When the probe binds, it is hydrolyzed by Taq polymerase and
fluoresces. In real-time PCR, the fluorescence allows the researcher to see the levels of DNA produced
as it happens. To determine whether avian influenza RNA is present, a suitable limit for the number of
amplification cycles must be determined; in this study, the limit was set at 30. If the fluorescence
reaches the crossing point before the limit, the sample is considered positive. If a sample shows no
significant increase in fluorescence or a significant increase in fluorescence after the limit, the presence
of AI cannot be confirmed. RT-PCR is especially useful because of its quantitative nature - the–amount
of fluorescence is proportional to the amount of viral RNA in the sample.

233. 233
VII. Hemagglutination Inhibition Test for Newcastle Disease Virus
Avian influenza is not the only pathogen with hemagglutinating ability. Newcastle Disease
Virus can also cause a positive HA result. HA positive samples that do not show definite avian
influenza by RT-PCR are likely positive for NDV. Also, samples with atypical hemagglutination results
and high CPs might have mixed infections of avian influenza and NDV. The hemagglutination
inhibition test is performed similarly to the hemagglutination test, except with the addition of NDV
antiserum. If NDV is the hemagglutinating agent, the NDV antiserum will bind with the virus and
inhibit hemagglutination. Thus, the test results are read opposite of the HA test results – non-
hemagglutination confirms the presence of NDV. Also, unlike in the HA test, the concentration of
sample is maintained while the antiserum is diluted serially, allowing the HI titer to be determined.
RESULTS and DISCUSSION
I. Ses
5. We used the following samples for the purposes of this study:
1. FL13D (2010)
2. FL14D (2010)
3. FL15D (2010)
4. FL16D (2010)
5. AL299 (2007) – positive control
These samples had been tested and passed through eggs. In this study, we used both original
swab samples and allantoic fluids from the first passages of these samples.

234. 234
II. Inoculation and Culture
2/14/11: First passage allantoic fluids for the five samples were inoculated into 10-day old eggs
for a second passage. These eggs were then incubated and allantoic fluids were harvested on 2/17/11.
Figure 8: Inoculation, 2/14/11
III. Hemagglutination (HA) Detection
2/17/11: Allantoic fluids were harvested from the inoculated eggs and tested for HA activity.
We then determined the titer of any positive samples. If the eggs died before harvest, the day they died
is indicated by the X’s. Often, eggs that died on the second day proved HA positive. The odd
appearance of the HA and HA titer results for FL16 eggs is indicated in Table 1 (FL15D and FL16C).
As seen in Figure 10, the agglutinated red blood cells are clumped in the middle of the well, in contrast
to the non-agglutinated (negative) well that shows as a pellet and runs into a teardrop when tilted. This
abnormal result led us to expect that the FL16 sample contained NDV, or perhaps a mixed infection of
AI and NDV. The HA titers of the samples were: FL13A=64; FL14B=32; FL15A=64; and FL16D=8.
(Table 2)

235. 235
Figure 9: Table 1 - HA –esults (2/17/11)
Figure 10: Table 2 - HA –itration of HA Positive Samples

236. 236
Figure 11: Figure 10: Abnormal agglutination of red blood cells.
IV. AC-ELISA (FluDetect) Detection
3/1/11: The FluDetect ELISA kit was used to test the original swab samples. The 07AL299
sample’s allantoic fluid served as a positive control. Sample 10FL12 was used as a negative control.
None of the swab samples tested positive for AI by this test (Figures 12 and 13). Since this test is
designed for more concentrated samples from symptomatic poultry, it is probably not sensitive enough
to detect AI directly from cloacal swabs of non-symptomatic wild birds. By comparison, RT-PCR from
these swab samples detected one positive (10FL14) that FluDetect did not.
Swab Sample: Result:
10FL12 -
10FL13 -
10FL13 -
10FL14 -
10FL15 -
10FL16 -
07AL299 (AF) +
Figure 12: Table 3 - Flu–etect Results on Swab Samples (3/1/11)

237. 237
Figure 13: FluDetect for Influenza A Results for (from left to right) 10FL12, 10FL13, 10FL14,
10FL15, 10FL16, 07AL299.
3/2/11: When second-passage allantoic fluids were tested by FluDetect, more samples tested
positive and samples that tested positive for AIV by RRT-PCR, also tested positive by FluDetect (Table
4; Figure 15). Therefore, this test could be useful in labs that do not have PCR equipment, because it is
much cheaper and does not require trained personnel. However, this test would not be useful for in the
field monitoring of AIV in wild birds, as a passage through eggs was still necessary for detection.
P2 AF Sample: Result:
10FL58-B (NC) -
10FL13-A +
10FL14-B +
10FL15-A +
10FL16-B -
10FL16-C -
07AL299-C (PC) +
Figure 14: Table 4 - Flu–etect Results on Allantoic Fluids harvested on 2/17/11

238. 238
Figure 15: FluDetect ELISA test on Allantoic Fluids (harvested 2/17/11).
V. RNA Extraction
2/24/11: RNA was extracted from 2/17 allantoic fluids using the Qiagen kit. Concentration and
purity was measured with the Nanodrop machine. RNA concentrations range from 0.50 to 4.67 ng/ul.
(Figure 16)
Figure 16: Concentration of RNA extracted from 2/17 AFs by the Qiagen method
3/9/11: RNA from original swab samples was extracted using the Trizol reagent method. The
RNA concentration and purity was determined on 3/10 using the Nanodrop machine. The
concentrations were questionably high (Figure 17). It is possible that RNA from the debris in the swab

239. 239
samples (which would include fecal matter and sloughed intestinal epithelial cells) could result in these
high concentrations. Since only four out of the seven of these RNA samples in Figure 14 were positive
after subsequent testing by RRT-PCR (Figure 20); and 10FL14 had a relatively high CP , we can assume
that these concentrations do not accurately reflect the concentration of AIV RNA in the samples.
Figure 17: Concentration of RNA extracted from original swab samples using the Trizol reagent
method.
VI. Reverse Transcriptase Real-Time PCR
3/8/11: RNA samples extracted 2/24 with the Qiagen method from 2/17 allantoic fluids (AFs)
were tested by RT-PCR. The results were good, with smooth curves (Figure 18). 07AL299 did show a
higher CP than expected; however, the allantoic fluid from which the RNA was extracted had been
soiled with yolk.

240. 240
Figure 18: PCR Results for Qiagen-extracted RNA from 2/17 AFs
3/10/11: RNA samples extracted 3/9 from original swab samples by the Trizol reagent method
were tested by RT-PCR. Although the machine reported the RRT-PCR run as a success, these results
were not as good, with very jagged lines (Figure 19). It must be recalled that the RNA concentrations of
these samples were questionably high (Figure 17), which may account for the imperfect results. It could
also be possible that these poor results were due to my inexperience, which could especially affect the
accuracy of my pipetting technique. For this reason, we decided to rerun the test.

241. 241
Figure 19: PCR Results for 3/9 Trizol-extracted RNA from swab samples
3/22/11: RNA samples extracted 3/9 from original swab samples by the Trizol reagent method
were re-tested by RT-PCR due to jaggedness of original results. These results were much better, with
much smoother curves and more positive results (Figure 20). Thus, even though the previous results
were reported as a success by the computer, another test was beneficial. It is also worth noting that
when RNA was extracted from the 07AL299 AF (which was contaminated with yolk) using the Trizol
reagent, RT-PCR reported a lower CP. Thus, the Trizol method aided in the extraction of RNA when
the AF was contaminated with yolk.

242. 242
Figure 20: Second PCR Results for 3/9 Trizol-extracted RNA from original swab samples
VII. Hemagglutination Inhibition Test for Newcastle Disease Virus
3/31/11: HI tests were performed on 10FL15 and 10FL16, as well as other samples. As expected
because of the positive HA result but negative PCR result, 10FL16 was positive for NDV. 10FL15D
was negative. All control types confirmed that our results were good, with our back HA titration
resulting in 16, as intended (Figure 21). See attached sheets for the result tables.

243. 243
Figure 21: HI plate showing NDV titers and back titration results
CONCLUSIONS
During this study, I learned about the pathogenicity and spread of avian influenza and gained
understanding and experience in virus culture and molecular techniques for detecting avian influenza.
Hemagglutination tests are quick and inexpensive ways to eliminate the vast majority of negative
samples. In HA positive samples, ELISA tests and RT-PCR can be used to confirm that the
hemagglutinating agent is avian influenza. The FluDetect Influenza Type A ELISA kit proved less
accurate than RT-PCR for detecting AI in swab samples; however, in this instance it was as accurate as
RT-PCR in detecting AI in allantoic fluids. Therefore, it could be useful in laboratories that lack PCR
capability, as it is less-expensive and simpler than RT-PCR. However, it has the disadvantage of not
being quantitative, as is RT-PCR.

244. 244
APPENDIX
Appendix I: Preparation of BHIB with Penicillin/Streptomycin in Sampling Tubes
1. Add 900 ml ddH2O to a 1L flask.
2. Dissolve 37g BHI powder in the water over low heat.
3. Pour half of solution into another 1 L flask, cover both flasks with foil.
4. Autoclave both for 15 minutes on a liquid exhaust cycle and let cool.
5. Working under the hood and wearing gloves and a mask, add 6.02g Penicillin-G and 10g of
streptomycin sulfate to a 150 mL beaker.
6. Dissolve P/S in 50 mL ddH2O, under the hood.
7. Transfer the P/S solution to a 100 mL beaker and add 100 ddH2O to 100 mL.
8. Filter the P/S solution through a 0.22 um filtration device into a sterile 125 mL bottle.
9. Label and cool into the refrigerator.
10. Add 50 mL of P/S solution to each flask of BHIB and stir.
11. Pour into sterile 125 mL bottles.
12. Label, seal with tape around bottle neck/cap and store in freezer.
For each swab:
1. For each sample, using aseptic technique and working under the hood, pipette 1.8 mL BHIB with
P/S into a 5mL disposable capped tube.
2. Store vials in freezer until needed until needed for sampling.
Appendix II: Sample Collection
1. Obtain cloacal swabs, store in tubes, breaking off ends of swabs. Tubes can be transported over
dry ice or cool packs, for up to 48 hours.

245. 245
Appendix III: Sample processing
1. Thaw tubes of swabs at 37°C. Centrifuge tubes at low speed (500-1500g) for 10 minutes.
2. Let the tubes incubate at room temperature (22-25°C) for 15-60 min to allow antibiotics to
suppress microbial contamination. Filtration with a pre-wet 0.22-0.45um filter can also reduce
bacterial contamination, although it risks removing low levels of virus from samples.
3. Remove each swab with forceps, pressing the swab against the sides of the tube to expel as much
liquid as possible.
4. Pipette the supernatant into two vials, 650uL in an A vial and the rest in a B vial.
5. Store samples at -70°C.
Appendix IV: Inoculation
1. Candle 10 day old fertile eggs. Mark the edge of the air sac on viable eggs and discard
dead/infertile eggs.
2. Arrange eggs on a plastic flat in six rows of four eggs.
3. Label eggs with sample/bird number and egg letter (A through D for each sample)
4. Retrieve samples (swabs in vials of BHIB) from the ultra cold freezer, thaw quickly in a 37°C
water bath, and then keep cold for the rest of the procedure, either in the refrigerator or in an ice
bath.
5. Vortex samples for 1 min, then centrifuge for 15-20 minutes at 1200 rpm.
6. Sanitize eggs by lightly wiping with sterile swab dipped sparingly in 5% iodine in alcohol
solution.
7. Sanitize egg punch with 70% alcohol. Use the egg punch to puncture a small hole in the shell
just above the air sac line. Do not damage the membrane that lies just below the shell.
8. Inoculate eggs using a 23 gauge needle on a 1cc syringe. Pull up 0.6 mL of sample and inoculate
0.15 mL into each egg through the punched holes, inserting the needle vertically, slightly pointed
toward the front of the egg.

246. 246
9. Cover the holes with a small drop of Duco cement.
10. Incubate eggs for 48-72 hours in a 37°C humidified incubator.
11. Clean out and sanitize hoods with 70% alcohol.
Appendix V: Preparation of 0.5% Chicken Red Blood Cell Solution
1. As aseptically as possible, withdraw 6 cc Alsever’s solution from the tube into the syringe.
2. Collect 4-6 cc blood from the main wing vein of a rooster. Be sure to first swab the area with
alcohol and to hold pressure to the puncture site for about 1 minute after withdrawing the needle.
3. Gently invert the syringe several times to mix the blood and Alsever’s.
4. Remove the needle and transfer the contents into the 50 mL tube of Alsever’s.
5. Back in the lab, gently invert the tube several times to resuspend the blood cells in Alsever’s.
6. Centrifuge for 5 minutes at 1500 rpm.
7. Pour off and discard the supernatant. Add 25-30 mL PBS, gently resuspend the cells, and
centrifuge for 5 minutes at 1500 rpm.
8. Repeat step 7 twice more.
9. Pour off and discard the supernatant. Add 25-30 mL PBS, gently resuspend the cells, and
centrifuge for 10 minutes at 1500 rpm.
10. Remove the supernatant using a sterile disposable pipette. Do not disturb the packed CRBCs.
11. Using sterile technique, add 99.5 mL PBS to a glass bottle. Use the 1000 uL
micro246rthoreovirusdd .5 mL (500 uL) packed CRBCs to the bottle. Gently mix to suspend the
cells.
12. Label the bottle with “.5% CRBC,” your initials, and the date.

247. 247
13. Mark the number of the rooster bled on the record sheet.
Appendix VI: Harvesting Allantoic Fluid and Initial HA Testing
1. Prepare a 96-well plate by labeling one half-row per sample number and two sets of A-D
columns.
2. Add 0.025 mL PBS to each sample well and .05uL to each control well.
3. Transfer eggs into cardboard trays and sterilize the shells with a quick spurt of isopropanol.
4. Use an egg cracker and forceps sterilized by flaming to crack and peel away the top of the shell.
5. Using a sterile disposable pipette, place a drop of chorioallantoic fluid from each egg into the
appropriate well. Use a new pipette for each row/sample.
6. Cover tray of open eggs with foil and return to refrigerator.
7. After harvesting all the eggs, add 0.05mL of 0.5% CRBC (see Appendix V) to each well of plate.
8. Cell control: add 0.05mL PBS and 0.05 mL CRBC to the bottom row of the plate. Each well
should pellet and run in a tear-drop shape upon tilting. This is a negative control that tests
CRBC integrity and insures there is no agglutinating virus present in the blood suspension.
9. Cover and let sit at room temperature for 45 minutes.
10. Read and record results: pelleted CRBCs that run in a tear-drop shape upon tilting the plate 45
degrees indicate a negative well; hemagglutinated CRBCs (formed in a lattice-work, giving a
solid pink appearance to the entire well) indicate a positive well.
11. Harvest all the chorioallantoic fluid from each positive egg separately into a labeled tube.
12. Perform an HA titer on the fluid harvested from each egg (see Appendix VII).
13. Pool harvests from eggs of the same sample with similar titers.
14. Aliquot into labeled cryovials and freeze in the ultra-cold freezer (-70°C).

248. 248
Appendix VII: Hemagglutination (HA) Titration
1. Add 0.05 uL PBS to each well of a 96-well plate labeled with the sample number for every two
rows and “2, 4, 8, 16, 128, 256,” etc, (virus dilutions) across the top.
2. Add 0.05 mL virus isolate to the first well of appropriate rows.
3. Mix and transfer 0.05 mL across each row, discarding the final 0.05 mL.
4. Add 0.05 mL 0.5% CRBC to each well.
5. Cover and let sit at room temperature for 45 minutes.
6. Read and record results: pelleted CRBCs that run in a tear-drop shape upon tilting the plate 45
degrees indicate a negative well; hemagglutinated CRBCs (formed in a lattice-work, giving a
solid pink appearance to the entire well) indicate a positive well. Results are read as the inverse
of the furthest dilution producing complete agglutination, i.e. the last positive well.
7. For a cell control: Add 0.05 mL PBS and 0.05 mL CRBC to the bottom row of the plate. Each
well should pellet and run in a tear-drop upon tilting. This is a negative control that tests CRBC
integrity and insures there is no agglutinating virus present in the blood suspension.
Appendix VIII: Extraction of RNA (Quiagen RNeasy method)
1. Vortex swab specimen fluid and transfer 500µl of sample into a micro centrifuge.
2. Add 10 µl ß-ME (Sigma, cat. #M6250, St. Louis, MO) per 1 ml RLT lysis buffer (this buffer will
be stable for 1 month after addition of ME – be sure to date this buffer).
3. Place 500 µl of RLT lysis buffer with β-ME into the microcentrifuge tube containing sample.
Vortex for 15 sec. (The LRT buffer can be mixed with the specimen by pipetting up and down
vigorously 4-6 times)
4. Pulse spin (12,000 rpm on our machine). Add 500 µl 70% ETOH and vortex well. Centrifuge

249. 249
lysed swab specimen for 5 min. at 5000 X g at RT.
5. Transfer the supernatant to a RNeasy Qiagen column. Centrifuge for 15 sec. at 8000 X g at RT.
Check to assure the entire specimen has flowed through the column. Repeat until all of specimen
has been applied to the column.
(Alternatively, a QiaVac manifold can be used to pull the specimen and wash solutions through
the collection columns. This will increase the efficiency and eliminate the need to centrifuge the
columns at the steps 5 to 9.)
6. Add 700 µl of RW1 buffer to the column and centrifuge for 15 sec. at 8000g and place the column
in a clean collection tube.
7. Add 500µl RPE buffer to the column and centrifuge for 15 sec. at 8000g. Discard flow in the
collection tube.
8. Repeat step 8. Place column in a new 2 ml collection tube.
9. Centrifuge the empty column for 2 min. at full speed and discard the collection tube.
10. Place the column in a 1.5ml microfuge tube and add 50 µl RNase free H2O to the column. Do
not touch the silica-gel membrane with the pipette or tip. Incubate at room temperature for 1 min.
Elute RNA by centrifuging for 1 min. at 10,000rpm. Discard column. Store at 4 or at -20 C if the
sample cannot be tested on RRT-PCR within 24 hours.
Appendix VIII: RNA Extraction (Trizol LS Method for Tissue Samples)
1. Appropriate tissue (lung, spleen, intestine) should be processed by preparing a 10-20% tissue
homogenate. Alternatively, 5mm piece tissues are added to 2.0 ml of brain-heart infusion broth,
frozen solid, thawed and centrifuged. The supernatant from this tissue pool (250 µl) is extracted
using the trizol procedure. Note: Don’t pool tissues from more than one bird.

250. 250
2. Centrifuge tissue specimens at 1,500 x g for 30 min. Collect 250ul of the tissue supernatant and
transfer to 1.5ml tube. 750ul of Trizol LS is added to the tube and sample is vortexed for 15 sec.
Incubate at room temperature for 7 min.
3. Pulse spin.
4. Add 200 ul 100% chloroform to the sample/Trizol homogenate. Vortex for 15 sec. Incubate at RT
for 7 min.
5. Centrifuge at 12,000 x g for 15 min at RT.
6. Transfer 450ul of the upper aqueous layer to a separate tube. Add 500ul of 100% isopropanol.
Invert tube several times to mix. Hold at RT for 10 min.
7. Centrifuge at 10,000 x g for 10 min at 4 C.
8. Decant liquid. Add 1.0 ml of 80% ethanol. Mix gently.
9. Centrifuge at 10,000 x g for 5 min at 4 C.
10. Decant ethanol. Invert tube on a clean tissue wipe and allow to air dry for 10 min. It is important
not to let the RNA pellet over-dry, as this will decrease its solubility.
11. Hydrate pellet in 50ul of RNase free water and incubate at 4 C for 1 hr or overnight. Briefly
vortex to resuspend pellet before pipetting.
Appendix IX: FluDetect Flu A Test (ELISA) (modified from kit procedure)
1. Thaw allantoic fluid or swab sample fluid in 37°C water bath.
2. Vortex sample.
3. Add 200 uL of each sample to each tube. Use a separate tube for each sample.
4. Add three drops of extraction buffer to each tube.

251. 251
5. Flick tube with finger to mix.
6. Add a test strip to each tube, incubate at room temperature for 15 minutes.
7. Read results according to chart:
- Upper and lower red lines indicate a positive result.
- No lower red line with an upper red line indicate a negative result.
- Absence of both upper and lower lines, or presence of a lower line without an upper line
indicate an invalid test.
Appendix X: Real-time Reverse Transcriptase PCR
The real-time reverse transcriptase-PCR (RRT-PCR) is conducted using the LighCycler (Roche)
instrument utilizing a one step protocol with specific primers designed to amplify a portion of the
genome that contains a target PCR sequence. Hydrolysis Probe assays, conventionally called TaqMan
assays, can technically be described as homogenous 5’-nuclease assays, since a single 3’-non-extendable
Hydrolysis probe, which is cleaved during PCR amplification, is used to detect the accumulation of a
specific target DNA sequence. The fluorogenic probes are labeled at the 5’ end with a reporter dye
(FAM) and a quencher dye (Tamra) at the 3’ end. When the probe is intact, the reporter dye is close
enough to the reporter fluorescent signal. When the probe is hybridized to the target, the 5’ nuclease
activity of Taq-polymerase will cause hydrolysis of the probe and separation of these two dyes from
each other. This separation results in an increase in fluorescence emission of the reporter dye, which is
detected spectrophotometrically. In the cleaved probe, the reporter is no longer quenced and emits a
fluorescent signal when excited. The amount of fluorescence recorded is proportional to the amount of
target template in the samples.
A: Hydrolysis Probes and Primer
Suggested sources:
1- Integrated DNA technologies(corav251rthoreov,http://www.idtdna.com/)

252. 252
2- Operon(http://ologos.qiagen.com)
3- Biochem (saltlake city,UT)
AIV real time RT-PCR probe and primer sequence
Matrix M+25
5′ primer
5′- AGA TGA GTC TTC
TAA CCG AGG TCG-3′
M+64
PROBE
5′-FAM- TCA GGC CCC
CTC AAA GCC GA-
TAMR-3′
M-124
3′PRIMER
5′- TGC AAA AAC ATC
TTC AAG TCT CTG-3′
H7 H7+1244
5′-PRIMER
5′- ATT GGA CAC GAG
ACG CAA TG-3′
H7+1281
PROBE
5′- FAM- TAA TGC TGA
GCT GTT GGT GGC –
TAMRA-3′
H7-1342
3′ PRIMER
5′- TTC TGA GTC CGC
AAG ATC TAT TG-3′
H5 H5+1456 5′- ACG TAT GAC TAT

253. 253
5′-PRIMER CCA CAA TAC TCA-3′
H5+1637
PROBE
5′- FAM- TCA ACA GTG
GCG AGT TCC CTA
GCA-TAMRA-3′
H5-1685
3′PRIMER
5′- AGA CCA GCT AAC
ATG ATT GC-3′
Primer
Dilute primers to 200 pmol/ul (200uM) in 1X TE pH 8.3 (Promega #V6231 or V3511, Madison, WI) for
the stock dilution and 20 pmol/ul in RNase-free water for the working dilution. Dilute stock soln. 1:10 in
RNase-free water to make the working soln.
From each primer (forward and reverse) use 10 pmol per 20 µl reaction.
Probe: Protect it from exposure to direct light. Dilute probes to 120 pmol/ul (120uM) in 1X TE for the
stock solution and to 6 pmol/ul in RNase-free water for the working dilution. Dilute stock soln. 1:20 in
RNase-free water to make working solution.
A total of 3 pmol of the matrix, H5 and H7 probe are used, respectively per 25 ul reaction..
Note: Diluted probe should not be frozen/thawed more than 4 times
Sample Calculation:
Centrifuge probe and primer before the opening.
Divide pmol of oligo or probe by the pmol/ul needed or:
17786 pmol / 200 pmol/ul = 88.9ul of 1X TE (use to rehydrate)

254. 254
Mix gently by tapping the tube and allow the oligo to rehydrate for 10 minutes before use.
B: Qiagen OneStep RT-PCR Kit cat.# 210210 or 210212
Alternative kits are: 1) Superscript One-Step RT-PCR System with Platinum Taq DNA Polymerase
(Cat. #10928-034 or 10928-042, Invitrogen, Carlsbad, CA) and 2) RNA amplification Kit (Roche
Molecular Biochemicals, Alameda, CA)
C: Other reagents
RNase inhibitor, 40 units/ul (Promega, cat. #N2511 or N2515, Madison,WI)
MgCl2, 25 mM (Promega cat. #A3511 or A3513, Madison, WI)
D: One-step real-time RT-PCR procedure
- Two work areas are required for this procedure: a “clean” area (Rm 324-A) with a
dedicated BSC, freezer and supplies, and a thermal cycling area (Rm 324-B).
- Never introduce RNA/DNA material into the “clean” area and always change gloves
before entering the “clean” area.
- Set up the reactions with the reaction tubes (nuclease-free) in the cooling block and use
aerosol resistant pipette tips. Use fresh gloves.
- Frequently treat the work areas and instruments (pipettes!) with DNAzap, RNAsezap,
and/or overnight UV-irradiation.
- For all batches of PCRs, calculate the number of samples and prepare a master mix of the
DNA polymerase accordingly. In addition to duplicates of the specimens, add a set of
appropriate control reactions as indicated in the specifics for each PCR.
SET-UP OF PCR MASTERMIX
1) In the “clean” hood, prepare a master mix of the following reagents sufficient for the number of
samples being tested including standards. Prepare the reaction mix (with 10% excess) containing

255. 255
everything but the template by pipetting into a nuclease-free microcentrifuge tube using the
volumes per reaction for each reagent given in the table (add the reagents in the order they are
written:
Volume per reaction Final concentration
RNase-free water(Qiagen kit)
5X buffer (Qiagen Kit)
25 mM MgCl2
dNTPs (10 mM each)
Forward primer (20 pmol/ul)
Backward primer (20pmol/ul)
RNase inhibitor (13.3 U)
Enzyme mix
Probe (6 pmol/ul)
Total
4.6 oif 0.8 of dNTPs are
used
4µl
5.9
1.µl
0.65 µl(each) or 0.8 (400uM)
0.5
0.5
0.5
0.8
0.5
15µl
1X
3.75 mM*
325 uM ea. dNTP
10 pmol/20 ul
10 pmol/20 ul
6.5 U
0.15uM (3 pmol/20ul)
*Qiagen buffer already contains 2.5 mM MgCl2 at 1X concentration

256. 256
2) Mix reagents and centrifuge briefly. (Once the probe has been added to the reaction mix,
minimize exposure to light.
SET-UP OF PCR
1) To each Lightcycler Capillary add 15 uL PCR Mastermix and 5 uL specimen DNA in
elution buffer
2) After closing the LightCycler Capillaries with the plastic stopper, spin the capillaries at 3000
rpm for 5 sec in the small Shelton microcentrifuge.
3) Insert reaction tube into LightCycler and run the designated stored program (channel one)
RT step cycling for one step RT-PCR kit
RT step 1cycle 30 min
15 min
50 ۫◌ ۫◌
95 ۫◌
Cycling conditions for gene specific probe and primer sets
Probe/Primer set Step Time Temp
Matrix
H7
45 cycles
40 cycle
Denaturation
Annealing
denaturation
0 sec
20 sec
0 sec
94۫ C
60۫ C
94۫ C

257. 257
H5 40 cycles
annealing
denaturation
annealing
Extension
20 sec
0 sec
20 sec
5 sec.
58۫ C
94۫ C
57۫ C
72۫ C
NOTICE:
The transcribed RNA (positive control) should be diluted by the user to a working
dilution that will have a cycle threshold of approximately 25.
Appendix XI: Laboratory Biosafety and Waste Disposal for Avian Influenza Work
1. Biosafety level 2 practices should be followed when handling specimens.
2. Biological Safety cabinets should be used for all manipulations of agents.
3. Use barrier protection at all times (disposable laboratory coats, gloves, mask, or other
appropriate barriers)
4. When processing samples, collect used tubes, swabs, pipette tips, gloves, hair caps, coats and
masks into biohazard container lined with blue autoclave bags. Autoclave bag at 1210
C for 30
minutes.

258. 258
5. When inoculating eggs (Mondays), dispose used syringes, needles, and tubes in waste beaker in
the hood. Cover with foil. Dispose infertile/cracked eggs, gloves, used Kimwipes etc. into autoclave
bags. Autoclave everything immediately at 1210
C for 30 minutes. Wipe down hood with 70%
ethanol and leave under UV light overnight.
6. When harvesting allantoic fluids (Thursdays), dispose pipette tips and forceps in separate waste
beakers. Place HA disposable plates/boats, coats, gloves, etc. into autoclave bags. Collect all
embryonated eggs in blue bag and tie. Autoclave everything immediately at 1210
C for 1 hour. Wipe
down hood with 70% ethanol and leave under UV light overnight. Soak used egg flats, ice trays and
racks in disinfectant (Decon- ortho-phenyl phenol).
7. Dispose syringes and needles in Sharps-container and tips in “tips-only”-waste container.
8. Place autoclaved bag of embryonated eggs in walk-in freezer until ready for incineration.
9. After each work-day, wipe countertops and biological safety cabinets with disinfectant (Decon).
10. Change gloves and wash hands often especially before leaving the laboratory. Protective clothing
should be removed before leaving the laboratory.
Appendix XII: Hemagglutination Inhibition Test for NDV
1. First perform an HA titer test (see HA titer test protocol) on each virus isolate and appropriately
dilute the isolate and re perform HA titer test until the HA titer is 1:16. If HA titer is too low, repass
the isolate (see repass protocol).
2. Add 0.025 mL PBS to each well of a 96-well plate labeled with the sample number for every two
rows and “10, 20, 40, 80, 160, 320, 640, 1280” (antiserum dilutions) across the top.
3. Dilute antiserum 1:5 with PBS (eg. .4 mL PBS + .1 mL antiserum in a sterile cryovial).

259. 259
4. Add 0.025 mL diluted antiserum in the first well of each row. Mix and transfer .025 mL across
each row, discarding the final .025 mL.
5. Add 0.025 mL appropriately diluted virus isolate to each well of appropriate rows.
6. Cover with a plastic plate lid and let sit at room temperature for 30 minutes.
7. Add 0.05 mL .5% CRBC to each well.
8. Recover and let sit at room temperature for 45 minutes.
9. Read and record results: pelleted CRBCs that run in a tear-drop shape upon tilting the plate 45
degrees indicate a POSITIVE well; hemagglutinated CRBCs (formed in a latticework, giving a solid
pink appearance to the entire well) indicate a NEGATIVE well. Results are read as the inverse of the
furthest dilution producing complete inhibition of agglutination, ie, the last positive (pelleted and
tear-drop running) well.
***Note: Results are read in the opposite manner as HA titer tests.
Cell control – Add 0.05 mL PBS and 0.05 mL CRBC to the bottom row of each plate. Each well should
pellet and run in a tear-drop upon tilting. (This is a negative control that tests CRBC integrity and
insures there is no agglutinating virus present in the blood suspension.)
Serum control – Perform HI test steps as above but add 0.025 mL PBS instead of virus (step 5) to a
single row of wells. Each well should pellet and run in a tear-drop upon tilting. (This is a negative
control that insures there is no agglutinating factor present in the antiserum.)
Virus control – Perform HI test steps as above using appropriately diluted NDV antigen (purchased from
NVSL) instead of a virus isolate (steps 1 and 5) in a single row of wells. (This is a positive control that
insures all reagents are of good quality and the set-up was done properly. It should give a reproducible
positive result.)

260. 260
Back Titration – At the same time that the HI test is performed, conduct a final HA titer test using the
exact virus dilution samples used in the HI test. All HA titers should be 16. (This confirms that the HA
titer of each virus dilution used in the HI test is of an appropriate titer for valid HI test results.)
Appendix XIII: Measuring RNA concentration with the Nanodrop Machine
1. Clean sample pedestals.
2. Load 1 uL of water sample to initialize the machine.
3. Set the sample type to RNA-40 and input sample ID.
4. Blank the machine.
5. Wipe pedestals clean.
6. Load 1 uL of sample, click measure.
7. Wipe pedestals between samples.
UTable of Contents

261. 261
Detection and Isolation of Infectious Laryngotracheitis Virus on a Broiler Farm after a Disease
Outbreak
Teresa V. Dormitorio, Joseph J. Giambrone* and Kenneth S. Macklin
SUMMARY. A broiler farm in North Alabama suffered a mild infectious laryngotracheitis (ILT)
outbreak as determined by clinical disease and the polymerase chain reaction. The poultry integrator
sought help to control further outbreaks in subsequent flocks. Samples were collected from various areas
of the poultry houses on the farm over an 8-week period. The first sampling was conducted 9 days after
the infected farm was depopulated; the second was 2 days prior to subsequent flock placement; and the
third was when the new flock was 5 weeks of age. Samples were examined for ILTV DNA by real-time
PCR (rtPCR) and virus isolation in embryos. The infected houses were cleaned, disinfected, heated,
litter composted, and curtains replaced after the first sampling and prior to placement of the next flock.
Samples from all periods were positive for ILTV DNA. However, the number of positive samples and
crossing point (Cp) values indicated a decrease in the amount of viral DNA, while virus isolation in
embryos was successful only on the first sampling. The subsequent flock was vaccinated against ILTV
by in ovo route using a commercial recombinant vaccine. Cleaning and sanitation after the disease
outbreak reduced the amount of ILTV on the farm and together with in ovo vaccination of the new flock
may have prevented a recurrence of another ILT outbreak.
Key words: infectious laryngotracheitis, detection, disinfection, vaccination, prevention
Abbreviations: BHI = brain heart infusion; CAM = chorioallantoic membrane; CEO = chicken
embryo origin; Cp = crossing point; ICP4 = infected cell protein 4; ILTV = Infectious
laryngotracheitis virus; rtPCR = real-time polymerase chain reaction

262. 262
Infectious Laryngotracheitis (ILT) is a highly contagious, respiratory disease in chickens caused
by a herpesvirus. ILT has become one of the most important diseases in broilers worldwide because it
leads to serious economic losses due to decreased growth rates, increased condemnation, reduced egg
production, and increased mortality. Losses caused by the disease had a great economic impact on
poultry production and the US economy. The value of broilers produced during 2011 was $23.2 billion
and established a new record of US export value of $4.9 billion (15). Most outbreaks of ILT on farms
are traced to transmission by contaminated people or equipment. Under laboratory controlled conditions,
the causative agent, ILT virus (ILTV) is susceptible to disinfectants (8, 12), was readily killed when
exposed to an aerosol of formaldehyde (9), and was found to be inactivated or reduced below detection
level (354 viral copies) if heated to 380
C for 24 hours (5). However, it can survive for weeks to months
if protected by organic material, such as manure, deep litter, biofilms, or respiratory secretions (2, 5, 8,
9, 12). Thus in the field, ILTV is not easily eliminated from an infected chicken house unless thorough
cleaning, disinfecting, heating of the house, and litter composting is done. In the US, the frequency of
ILT in broiler flocks has been increasing despite the development of new recombinant vaccines.
Majority of cases occur in areas with a large amount of unvaccinated broiler flocks in close proximity to
vaccinated commercial egg-layers (1). Most reported outbreaks of ILT in broilers have shown milder
signs and have been associated with vaccine-origin viruses (13).
This present study was conducted to detect, isolate, and characterize ILTV from environmental
samples collected by swabbing different areas of the house, equipment, and live birds of an infected
farm; in order to identify possible sources of infection and implement ways to control future ILT
outbreaks. Other areas not commonly sample included: beetles, cow manure, water from puddles, and
mud. Cleaning, heating, disinfection, windrow composting of the litter, and replacing of house curtains
resulted in a significant reduction of ILTV DNA to levels where virus isolation was not possible. The
combination of improved sanitation, hygiene, and in ovo vaccination of the subsequent flock may have

263. 263
reduced the amount of live virus and prevented the return of clinical ILT on this farm.
MATERIALS AND METHODS
Disease Outbreak. One of four houses on a poultry farm suffered increased daily mortality (20-
200 birds), showed clinical respiratory disease, and was reported by the Alabama Veterinary State
Diagnostic Laboratory in Auburn, Alabama as positive for ILT based on clinical signs, gross lesions,
and the PCR test. All broilers were sent to the processing plant the day after highest (>200 birds)
mortality occurred and when ILT was confirmed. ILTV vaccination has never been done on this farm
and this is the first mild disease outbreak. A commercial egg-laying facility is about a mile away.
Sampling. Only two houses (H2 and H3) and the area in between were sampled. H2 had no ILT
outbreak, whereas H3 experienced mild (20-200) mortality and ILTV was identified from tissue
specimens submitted to the State Diagnostic Laboratory. First sampling was conducted 8 days after all
houses were emptied of chickens. Houses have been heated to 380
C for 24 hours, caked litter removed,
and litter windrow (in-house) composted for 3 days. Loose uncaught chickens from the previous
diseased flock were found in and around the houses. The farm owner killed 3 sick-looking birds, and
conjunctival and tracheal swabs were taken from these birds. Other samples included swabs from: top of
water line, fan louvers, brooder, curtains, and water from a puddle; and beetles. As many as possible
beetles and their larvae were caught from different areas of the sampled houses (H2 and H3), then
placed in 5-ml tubes. Two or 3 swabs were taken from each sample area and each swab was placed in a
tube containing 2-ml Brain Heart Infusion (BHI) broth plus 1% (wt/vol) streptomycin and 0,6% (wt/vol)
penicillin-G. Total of 41 samples were taken on the first sampling. Swab and beetle samples were
transported to the laboratory on ice. Beetles/larvae were cleaned of soil debris, homogenized in a
blender, centrifuged at 2000 x g for 10 min, and supernatants transferred to 2-ml tubes then stored at -
800
C. Tubes with swabs were centrifuged at 2000 x g for 10 min, debris/swab removed, and supernatant

264. 264
stored at -800
C until needed for DNA extraction or virus isolation.
The second sampling was done 2 weeks after the 1st
, and 2 days before the new chicks were
placed. The house equipment had been sanitized by washing and spraying with AGRI-CRES CR
cleanser® (RXV Products, 7 Village Circle, Suite 200, Westlake, TX 76262); curtains replaced, and
grass around the houses cut. A smell of strong disinfectant was evident and blue chemical was seen
scattered on the ground. Less beetles were found, mostly larvae. Feeders, waterers, and brooders were
lowered closer to the ground. There was an effort to collect samples from the same areas swabbed on the
1st
sampling, especially those that were positive for ILTV. In addition, swab samples from hoppers,
nipple drinkers, water faucet, cow manure, old/used curtains in the dumpster were taken. The
replacement chicks received a commercial recombinant ILTV vaccine by in ovo (18 days incubated
eggs) route.
Chickens were 5-weeks-old during the 3rd
sampling. Most samples were taken from birds,
beetles, and areas that were ILTV positive on 1st
and 2nd
samplings. Water nipples were sampled by
swirling a 6-in (wood shaft) cotton-tipped (1-in) swab around the opening of the nipple drinkers. Sick,
dead, or live birds were chosen at random from the front, mid, and back sections of the house. Eye or
tracheal swabs were taken as prior indicated.
Real-time PCR (rtPCR). Total DNA from swab/beetle supernatants was extracted using
DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA) following manufacturer’s recommendations.
Primers (ICP4-F 5’CCCCACCCAGTAGAGGAC 3’; ICP4-R 5’ CGAGATACACGGAAGCT GATTT
3’) and probe (FAM-5’ACAGTCTTTGGTCGATGACCCGC 3’) were designed to amplify and bind the
conserved region of the ICP4 gene of ILTV (11). Quantitect Probe PCR Kit (Qiagen, Valencia, CA) was
used to prepare the PCR reaction mixture. The rtPCR was carried out using the Lightcycler (Roche
Applied Science, Indianapolis, IN.). The reaction procedures were as follows: 10µL of 2x Master Mix
QuantiTect Probe PCR Kit, 1µL of 10µM each primer, 0.5µL of 4µM probe, 2.5µL of water, and 5µL of
DNA template. The rtPCR reaction was subjected to initial activation at 950
C for 15 min, 40 cycles of

265. 265
denaturation at 950
C for 0 s, and combined annealing and extension at 600
C for 60 s. Samples were
reported with a crossing point (Cp) value, the cycle number at which the specimen tested positive.
Lower Cp value means higher amount of viral DNA present in the sample. A threshold Cp value above
35 was determined to be negative (11).
Virus isolation. Frozen samples were thawed at 370
C for 1 min and kept on ice. Eleven-day old
embryonated eggs were prepared for inoculation on the artificially dropped chorio-allantoic membrane
(CAM). Eggs were inoculated with 0.2 mL/egg of thawed sample using a syringe fitted with a needle
into the false air cell directly over the CAM. Inoculated eggs were positioned horizontally, incubated at
370
C for 5-7 days, and candled daily. During incubation, eggs with dead embryos were removed and
stored at 40
C. Embryo deaths within 24 hr were considered non-specific and were discarded. CAMs
from other eggs with dead embryos were harvested by grasping it with sterile forceps, and stripping
away excess fluids with a second set of forceps. CAMs were prepared as a 10% suspension in antibiotic
diluent and centrifuged at 1500 x g for 20 min. CAM suspensions were placed in sterile tubes and stored
at -800
C until needed for ILTV DNA detection. After 7 days of incubation, eggs with live embryos were
killed by chilling at 40
C overnight. The CAMs were examined for plaques and thickening and then
harvested and processed as done before.
PCR, restriction enzyme digestion and gel electrophoresis. The ICP4 genes (4.9 kb) of ILTV
isolates (H3/S21 and commercial CEO vaccine) were amplified by PCR according to procedures
previously described (3, 11), with some modifications. PCR product (16 ul) was digested by adding 2 ul
(20 U) of MspI (Promega, Madison, WI), and incubated in 370
C for 1 h. Digested DNA bands were
analyzed by 2% agarose gel electrophoresis containing ethidium bromide (0.5 ug/ml).
RESULTS
Table 1 shows rtPCR results on samples collected from two houses during the first sampling.
The H3 house experienced the mild ILT outbreak; whereas the H2 house had normal mortality and no

266. 266
apparent respiratory disease. Fifty five percent of processed swabs or beetle samples were rtPCR
positive (PCR1). All positive samples were from the infected house (H3). PCR2 of Table 1 showed
rtPCR results for ILTV DNA detection conducted on CAMs harvested from embryonating eggs
inoculated with samples from both infected and uninfected houses. Similar to PCR1, where positive
samples came from the infected house (H3), PCR2 showed that 30% of these contained live ILTVs as
indicated by propagation and positive rtPCR on the CAM.
Table 2 lists ILTV detection of samples collected 23 days after the outbreak (2nd
sampling).
ILTV DNA was present in 27% of samples from swabs or beetles (PCR1) and most Cp values were
higher than those on the 1st
sampling. However, one positive sample (H2/S13) came from the outside
curtain of H2, which did not have an ILT outbreak. When these same samples were inoculated into
embryonating eggs, then harvested CAMs tested for ILTV DNA (PCR2); all Cp values were >35. These
values were considered negative.
ILTV detection results on samples from the 3rd
sampling are presented in Table 3. Ten percent
tested positive by rtPCR with Cp-values greater than 30 (PCR1). Majority of samples collected were
from chickens (5 weeks old) and beetles, and none were positive for live virus (PCR2 data not included
in table because they were all negative). The three ILTV DNA positive samples were swabs from water
nipple drinkers (S297, S302) and right side wall of the house with the prior ILT outbreak (H3/S307).
According to the farmer, the middle area of the house had greater mortality and streaks of blood were
seen on the right side walls.
Viral DNA was separately extracted from a field isolate (H3/S21) propagated in CAM, and a
commercial vaccine (CEO). The ICP4 gene fragment (4.9 bp) of ILTV was amplified from each DNA
preparation by PCR, using primers designed by P.C. Chang, et al (3); then digested by restriction
enzymes. Figure 1 shows the MspI digests of the 4.9 bp fragment of ICP4 gene from two ILTV (field
and vaccine) isolates. The uncut (no enzyme) fragments for H3/S21 and CEO isolates are in lane 2 and
lane 4, respectively. Lanes 3 and 4 showed the same enzyme cut pattern, which indicated that the isolate

267. 267
from the outbreak may be of vaccine origin.
Discussion
The study was conducted on a commercial broiler farm comprised of four houses, one of which
suffered a mild ILT outbreak. No ILTV vaccine had ever been used on the farm and this was the first
outbreak of the disease. A commercial egg laying facility was located about a mile from the farm. It is
conjectured that this farm could have been the source of the vaccine virus, which caused the disease
outbreak, since egg layers are routinely vaccinated against ILT. Epidemiologic investigations of
outbreaks in mild ILT point to common sources of infection such as recovered or vaccinated birds (10).
The severe form comes from the introduction of the virus in the poultry house via movement of
contaminated humans/equipment or infected poultry processing (6).
During the 1st
sampling, there were some loose uncollected birds inside and outside of the houses
showing clinical ILT. Swabs from foamy eyes had the highest amount of viral DNA followed by
darkling beetles (Table 1). The poultry grower was alerted of these findings and must have eliminated
them all as none of these birds were seen during the 2nd
sampling, which was 2 days before placement of
new flock. If these sick birds were kept in the farm premises, they could have been the primary source of
ILT for the next flock. Live ILTV was also present in the nipple drinkers, fan louvers, walls, curtains,
etc. (PCR2). All of these ILTV positive samples came from the house (H3) with clinical ILT. It can be
noted that some samples upon inoculation in embryonating eggs had rtPCR with a decrease in Cp values
indicating growth or increase of detectable viral particles. On the other hand, some PCR1 positive
samples became negative on PCR2, which meant that the detectable DNA was not from live virus. A
swab of the water from a puddle at the back side of the infected house (S33), which was negative for
ILTV DNA when tested directly from swab, became positive (Cp=24.71) after embryo inoculation. The
initial amount of virus in the swab sample may not have been enough for detection by rtPCR however,
inoculation into embryos allowed viral propagation and detectable live ILTV.
The poultry integrator was notified immediately of laboratory results from 1st
sampling in which

268. 268
more than half of samples tested were positive for ILTV DNA and 30% of these were shown to contain
live virus. The farm grower performed thorough cleaning and disinfection of all houses, equipment, and
premises. Grasses were cut and surroundings were sprayed with pesticides. Houses were heated again at
380
C for 24 hours and curtains were replaced. The 2nd
sampling was conducted 2-days before placement
of new chicks. Table 2 shows that 27% of samples were still positive for ILTV DNA although the Cp
values were mostly greater than 30, indicating a decrease in viral load compared to the 1st
sampling.
Moreover, these samples were negative for live virus as shown by negative rtPCR test from the CAMs
(PCR2).
The subsequent flock that was placed after the 2nd
sampling was vaccinated with a commercial
recombinant vaccine via in ovo route, and was 5-weeks old at the time of 3rd
sampling. House log charts
showed normal daily mortality and no clinical ILT. On this sampling (Table 3), the majority of samples
were taken from chickens and were all negative for ILTV DNA. However, swabs from nipple drinkers
and walls of the infected house (H3) were still positive for ILTV DNA, although Cp values were greater
than 30. It is possible that ILTV was protected by biofilm on the nipple drinkers as demonstrated by
previous work of Ou, S. et al (12). It was reported by Jordan, F.T.W, et al (9) that ILTV infectivity in
tracheal mucus can survive at room temperatures (200
C-230
C) for up to three months on wooden
surfaces if protected by light. Therefore, the samples from the walls (area where mucus and blood were
found plus greater mortality) that was consistently positive for ILTV may prove previous findings.
Nevertheless, no live virus was present in these samples after one passage in embryonated eggs as
determined by a negative rtPCR test of the CAMs (data not reported on table).
Most of the ILT outbreaks have shown milder signs and have been associated with the vaccine
like virus (13). In the US, Spatz, S.J. et al (14), have reported that 63% of field isolates were related to
CEO vaccine viruses, while in Europe, 94% of field viruses collected over 35 years were likewise
related to vaccines. RFLP studies showed that there are no antigenic differences between TCO, CEO
and field viruses (4). On the other hand, Guy, J.S. et al, (7) showed that field isolates possessed greater

269. 269
virulence than Modified-live (ML) vaccine viruses, based on severity and duration of clinical illness,
mortality and tracheal lesions. Preliminary results to characterize ILTV isolated from the Alabama
infected farm showed similar enzyme digestion patterns as that of CEO-type commercial vaccine. A live
ILTV vaccine virus may have been introduced into a non-vaccinated farm through inadequate
biosecurity. Cleaning, disinfection, other management practices, and in ovo vaccination of the new flock
may have reduced live ILTV and helped prevent another ILT outbreak. Management techniques
implemented herein and in ovo vaccination could be used as a template for farmers to help reduce the
incidence and severity of ILT on their farms.
REFERENCES
1. http://agr.wa.gov/FoodAnimal/AvianHealth/Docs/iltfactsheet.pdf- accessed 3/1/2013.
2. Bagust, T.J., R.C. Jones, and J.S. Guy. Avian infectious laryngotracheitis. Rev. Sci. Tech. Off.
Int. Epiz., 19(2) 483-492. 2000
3. Chang, P.C., Y.L. Lee, J.H. Shien, and H.K. Shieh. Rapid differentiation of vaccine strains and
field isolates of infectious laryngotracheitis virus by restriction fragment length polymorphism of
PCR products. J. Virol. Methods 66:179-186. 1997.
4. Garcia, M. Current LT vaccine performance and new prospects for alternatives. U.S. Poultry and
Egg Association 2012 Production and Health Seminar. Birmingham, AL. September 25-26,
2012.
5. Giambrone, J.J., O. Fagbohun, and K.S. Macklin. Management practices to reduce infectious
laryngotracheitis virus in poultry litter. J. Appl. Poult. Res. 17:64-68. 2008.
6. Guy, J.S. and T.J. Bagust. Laryngotracheitis. In:Y.M. Saif, J.J. Barnes, J.R. Glisson, A.M. Fadly,
L.R. McDougald, and D.E. Swayne (eds.). Diseases of Poultry, 11th
ed. Iowa State Press. Ames,
IA, 121-134. 2008.

270. 270
7. Guy, J.S., H.J. Barnes, and L.M. Morgan. Virulence of infectious laryngotracheitis viruses:
comparison of modified-live vaccine viruses and North Carolina field isolates. Avian Dis. 34:1
106-113. 1990.
8. Jordan, F.T.W. A review of the literature on infectious laryngotracheitis (ILT). Avian Dis. 10:1-
26. 1966.
9. Jordan, F.T.W., H.M. Evanson, and J.M. Bennett. The survival of the virus of Infectious
Laryngotracheitis. Zentralblattfur Veterinarmedizin Reihe B, 14:135-50. 1967.
10. Oldoni, I., and M. Garcia. Characterization of infectious laryngotracheitis virus isolates from the
United States by polymerase chain reaction and restriction fragment length polymorphism of
multiple genome regions. Avian Pathol. 36:1 67-76. 2007.
11. Ou, Shan-Chia, J.J. Giambrone, and K.S. Macklin. Detection of infectious laryngotracheitis virus
from darkling beetles and their immature stage (lesser mealworms) by quantitative polymerase
chain reaction and virus isolation. J. Appl. Poult. Res. 21:33-38. 2012.
12. Ou, Shan-Chia, J.J. Giambrone, and K.S. Macklin. Infectious laryngotracheitis vaccine virus
detection in water lines and effectiveness of sanitizers for inactivating the virus. J. Appl. Poult.
Res. 20:223-230. 2011.
13. Sellers, H.S., M. Garcia, J. Glisson, T.P. Brown, J.S. Sander, and J.S. Guy. Mild infectious
laryngotracheitis in broilers in the southeast. Avian Dis 48:430-436, 2004.
14. Spatz, S.J., J.D. Volkening, C.L. Keeler, G.F. Kutish, S.M. Riblet, C.M. Boettger, K.F. Clark, L.
Zsak, C.L. Alfonso, E.S. Mundt, D.L. Rock, and M. Garcia. Comparative full genome analysis of
four infectious laryngotracheitis virus (Gallid herpesvirus-1) virulent isolates from the United
States. Virus Genes. 44 273-285. 2012.
15. USDA, National Agricultural Statistics Service -
http://usda.mannlib.cornell.edu/usda/current/PoulProdVa/PoulProdVa-04-26-2012.pdf

271. 271
Table 1. ILTV DNA detection results using real-time PCR on swab, beetle, and CAM samples from
poultry houses after a disease outbreak (1st
sampling).
House#/
Sample IDA
Sample description PCR1B
(CpC
) PCR2D
(Cp)
H2/S26 Fan louvers >35 uncertain
H2/S29 House wall >35 >35
H2/B32 Beetles1 negative negative
H3/S10 Top of water line 27 negative
H3/B11 Beetles2 22 31.78
H3/S13 Middle brooder 28 negative
H3/S17 Fan louvers 29 >35
H3/B19 Beetles3 34 negative
H3/S21 uncollected bird trachea 20 32.01
H3/S22 uncollected bird trachea 27 negative
H3/S23 uncollected bird eye 24 31
H3/B24 Beetles4 32 negative
H3/S33 Water outside puddle-back negative 24.71
H3/S35 Outside house curtain-back >35 32.73
H3/S36 Outside house curtain-middle >35 uncertain
H3/S38 Puddle outside house Invalid PCR + but no Cp
H3/S40 Outside mud >35 negative
A
House#/Sample ID = House number: H2 = no ILT outbreak; H3 = mild ILT outbreak and sample
identification.
B
PCR1 = ILTV DNA detection from swab or beetle samples by rtPCR
C
Cp = crossing point
D
PCR2 = ILTV DNA detection by rtPCR from chorioallantoic membrane (CAM) of swab or beetle
samples after inoculation in embryonating eggs.

272. 272
Table 2. ILTV DNA detection results using real-time PCR on swab, beetle, and CAM samples from
poultry houses after a disease outbreak (2nd
sampling).
House#/
Sample IDA
Sample description PCR1B
(CpC
) PCR2D
(Cp)
H2/S4 Hopper, front right >35 negative
H2/B7 Beetles-mostly larvae negative negative
H2/S11 Water nipple, middle right >35 negative
H2/S13 Window curtain, mid right 31.85 negative
H2/B17 Beetles, mid-left negative negative
H3/S19 Hopper, front left >35 >35
H3/S23 Water nipple, front right >35 negative
H3/B24 Beetles, front right >35 negative
H3/B29 Beetles, mid-right >35 uncertain
H3/S31 Fan louvers, mid-right 27.80 negative
H3/S32 Water nipple, mid-right 30.80 >35
H3/B33 Beetles, mid right >35 >35
H3/S34 Wall, mid right 29.69 negative
H3/B36 Beetles, mid right >35 negative
H3/S38 Curtain, back door 27.36 negative
H3/B39 Beetles, back doorway >35 negative
H3/S42 Faucet opening, front >35 >35
H3/S43 Mud, front door >35 >35
H3/S44 Vents, outside – front left 29.37 negative
H3S45 Vents, outside – middle left >35 negative
H3/S46 Cow manure, outside left negative Not tested
S47 Dumpster >35 negative
A
House#/Sample ID = House number: H2 = no ILT outbreak, H3 = mild ILT outbreak; and sample
identification.
B
PCR1 = ILTV DNA detection from swab or beetle samples by rtPCR.
C
Cp = crossing point.
D
PCR2 = ILTV DNA detection by rtPCR from chorioallantoic membrane (CAM) of swab or beetle
samples after inoculation in embryonating eggs.
Table 3. ILTV DNA detection results using real-time PCR on swab and beetle samples from poultry
houses after a disease outbreak (3rd
sampling).
House#/ Sample description PCR1B
(CpC
)

273. 273
Sample IDA
H2/S276 Bird eye/trachea Negative
H2/B277 Beetle/mealworms negative
H2/S278 Bird trachea, mid right negative
H2/B283 Beetles, mid right negative
H2/S284 Bird eye, back right negative
H2/S285 Trachea, bird 284 negative
H2/S288 Beetles/worms negative
H2/B292 Beetles negative
H2/S293 Bird eye (shut) negative
H2/S294 Trachea, bird 293 Negative
H3/S297 Water nipple, front left 33.60
H3/S298 Dead bird, eye/trachea negative
H3/S299 Dead bird, eye/trachea negative
H3/S300 Bird trachea Negative
H3/S301 Bird trachea, sick/dying negative
H3/S302 Water nipple, Front-right 30.99
H3/S303 Sick bird trachea, mid right >35
H3/S304 Small bird trachea negative
H3/S305 Sick bird trachea, mid right Negative
H3/S306 Water nipple, mid right >35
H3/S307 Wall, mid right 31.9
H3/B308 Beetles negative
H3/S309 Small bird trachea negative
H3/B312 Beetles negative
H3/S315 Bird trachea negative
H3/S316 Trachea, sick bird negative
H3/B319 Beetles negative
H3/S322 Bird trachea, mid left negative
H3/S325 House vent, mid left >35
A
House#/Sample ID = House number: H2 = no ILT outbreak; H3 = mild ILT outbreak and sample
identification.
B
PCR1 = ILTV DNA detection from swab or beetle samples by rtPCR
C
Cp = crossing point

274. 274
Figure 1. Msp1 digests of the 4.9 kb fragment amplified from the ILTV ICP4 gene. Lane M, size marker
(1Kb plus DNA ladder, Invitrogen, Inc., Grand Island, NY); lane 1, H3/S21 uncut; lane 2, H3/S21; lane
3, CEO vaccine; lane 4, CEO vaccine uncut; lane M2, size marker (50 bp ladder, Promega, Inc.,
Madison, WI).
M1 M21 2 3 4
1000
650
500
100
200
300
400
5000
bp

275. 275
DEVELOPMENT of a LOOP-MEDIATED ISOTHERMAL AMPLIFICATION ASSAY AND
COMPARISION with a TAQMAN®
REAL-TIME PCR for DETECTION of INFECTIOUS
LARYNGOTRACHEITIS VIRUS
Infectious laryngotracheitis virus (ILV) causes an acute respiratory disease of chickens. It occurs
world-wide and causes significant economic losses to the poultry industry. Standard procedures for
ILTV diagnosis include clinical signs, gross and microscopic lesions, immunofluorescence assay (IFA)
and real time polymerase chain reaction (RT-PCR). The histopathologic lesions associated with ILTV
infection include intranuclear inclusion bodies in tracheal epithelial cells (Guy et al., 2008). The
immunoperoxidase (IP) and FA tests with labeled monoclonal antibodies are used to detect ILTV in
tracheal smears (Guy et al., 1992). The AC-ELISA and ELISA can be used for ILTV antigen and
antibody detection (York et al., 1988; Chang et al., 2002). ILTV can be isolated in embryonic eggs
inoculated via the CAM route. Primary chicken cells, such as chicken embryo liver (CEL), chicken
embryo kidney (CEK), and chicken kidney (CK) are also used for ILTV isolation (Srinivasan et al.,
1977; Hughes et al., 1988).
PCR provides a quick, accurate, and highly sensitive method for ILTV DNA detection. Nested PCR
has been used to detect ILTV DNA in formalin-fixed and paraffin-embedded respiratory tissues of
clinically infected birds. Nested PCR can also be used to detect ILTV DNA in flocks showing
subclinical or clinical infection (Humberd et al., 2002).
Multiplex PCR, which uses several pairs of specific primers in one reaction tube, can simultaneously
detect ILTV from avian influenza virus (AIV), NDV, infectious bronchitis virus (IBV), and Mycoplasma
spp. Infected samples (Pang et al., 2002; Rashid et al., 2009). Quantitative PCR (qPCR) provides a
quantitative and qualitative method to detect ILTV DNA. ILTV detection by qPCR is more sensitive

276. 276
than traditional methods, such as histological, fluorescent antibody, and electron microscopy tests
(Crespo et al., 2007). The SYBR Green I based qPCR has been reported to detect 140 molecules/ µl of
ILTV DNA (Creelan et al., 2006). Callison et al. in 2007 reported a real-time PCR using the ILTV gC
gene detection. The sensitivity was 100 copies/ reaction.
LAMP assay provides a rapid and low-cost method for pathogen detection. It is has been used for
viral and bacterial nucleic acid detection of AIV (Imai et al., 2007), foot-and-mouth disease virus
(Dukes et al., 2006), pseudorabies virus (En et al., 2008), Salmonella (Ueda et al., 2009), and
Campylobacter (Yamazaki et al., 2009). LAMP assay uses Bst DNA polymerase, which has strand
displacement activity, and a set of two inner, two outer, and two loop primers to recognize eight regions
of target sequences. The LAMP method amplifies DNA at temperatures between 60 and 65°C in 60
minutes (Notomi et al., 2000; Nagamine et al., 2002; Tomita et al., 2008). To our knowledge the LAMP
assay has not been use for the diagnosis of ILTV. There are presently a number of lamp assay kits,
which can give a rapid detection for many pathogens, without the need for expensive regent or a thermal
cycler.
In this study, we report on the development of a LAMP assay for ILTV DNA detection and
compared its sensitivity and specificity with a TaqMan®
probe based real-time PCR to detect and
quantity ILTV DNA.
3.2 Materials and methods
Viral strains
Five commonly used commercial ILT vaccines were used: four CEO vaccines—AviPro®
LT
(Lohmann Animal Health Inc., Winslow, ME ), LT Blen®
(Merial Select Inc., Gainesville, GA),
Laryngo-Vac®
(Fort Dodge Animal Health, Overland Park, KS), Trachivax®
(Schering-Plough Animal

277. 277
Health Corp., Kenilworth, NJ), and a TCO vaccine—LT-IVAX®
(Schering-Plough Animal Health
Corp., Kenilworth, NJ). In addition, for the purpose of evaluating specificity the following non-ILTV
vaccines were used as controls: Mycoplasma gallisepticum (MG) vaccine—MycoVac-L®
(Intervet Inc.,
Millsboro, DE), fowl pox vaccine—Chicken –N-PoxTM
TC (Fort Dodge Animal Health, Overland Park,
KS), and MD serotype 3 vaccine—MD-Vac®
CFL (Fort Dodge Animal Health, Overland Park, KS).
Only MD serotype 3 vaccine was used for the brevity of the study.
Viral DNA extraction
Total DNA from ILTV vaccines and non-ILTV avian pathogens was extracted using Qiagen
DNeasy®
Blood & Tissue Kit (Qiagen, Valencia, CA, USA). Briefly, 200µl of each sample were mixed
with 20µl proteinase K and 200µl of Buffer AL. The mixture was mixed and incubated at 56°C for 10
min. After mixing, 200µl of 100% ethanol was added and vortexed. The mixture was transferred into the
DNeasy Mini spin column and centrifuged at 6000 x g for 1 min and the flow-through discarded. The
column was placed in a 2 ml tube and 500µl of Buffer AW1 added. The tube was centrifuged at 6000 x
g for 1 min, and again the flow-through was discarded. The column was transferred into a 2 ml tube and
500µl of Buffer AW2 was added. The tube was centrifuged at 20,000 x g for 3 min to remove excess
reagents from the column membrane. Finally, the DNA was eluted in 100µl of Buffer AE by
centrifuging at 6000 x g for 1 min and stored at -20°C.
Construction of standard DNA
To construct a plasmid containing the ILTV ICP4 gene, a 942 bp segment of LT Blen®
ILTV partial
ICP4 gene was amplified by PCR using the following primers: ICP4-F: 5’-
CGCAGAGGACCAGCAAAGACCG-3’; ICP4-R: 5’-GAAGCAGACGCCGCCGTAGGAT-3’. For
PCR, 50 µl of reaction was set up as follows: 5 µl of 10x PCR buffer, 5 µl of 25 mM MgCl2, 1µl of 10
mM dNTP each, 1 µl of 100 µM ICP4-F, 1 µl of 100 µM ICP4-R, 0.25µl of Taq DNA polymerase (5
U/µl; AmpliTaq®
DNA polymerase, Applied BioSystems, Foster City, CA), 28.75µl of water, and 5 µl

278. 278
of sample DNA. PCR steps were subjected to a 94°C initial denaturation for 2 min and 35 cycles of
94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, and 72°C extension for 1 min,
followed by 72°C final extension for 5 min. PCR was conducted in GeneAmp®
PCR System 9700
(Applied BioSystems, Foster City, CA). The PCR products were detected with 2% agarose gel
electrophoresis.
The PCR products were purified with the Wizard®
PCR preps DNA purification system (Promega,
Madison, WI). The cDNA was cloned into the pT7Blue-3 vector. A blunt-end cloning kit (Novagen,
Darmstadt, Germany), was used according to the manufacturer’s instructions. The plasmids were
transformed into NovaBlue®
SinglesTM
competent cells (Novagen, Darmstadt, Germany). Several clones
were selected and the plasmid DNA extracted using Wizard®
Plus SV kit (Promega, Madison, WI),
according to the manufacturer’s directions. Clones containing the proper insert were verified by DNA
sequencing. The concentrations of cloned plasmids were measured by the NanoDrop®
ND-100UV-Vis
Spectrophotometer (Wilmington, DE).
Copy number of ILT ICP4 cloned DNA was calculated with the following formula (Ke et al., 2006):
ICP4 DNA (copies/ µl) =
23
6.022 10
molecules g
concentration
mole l
g
Weight
mole
µ
  
× ×   
   
 
 
 
Weight in Daltons (g/mole) = (bp size of plasmid + insert) × (330 Da × 2 nucleotide/ bp)
Real-time, conventional PCR, and LAMP assays
Real-time PCR amplification of a partial ILTV ICP4 gene was performed in a LightCycler®
(Roche,
Applied Science, Indianapolis, IN) with 20 µl in volume. For real-time PCR assay, each reaction
contained 10µl of 2X master mix (QuantiTect®
Probe PCR kit, Qiagen, Valencia, CA), 1 µl of 10 µM
each primer (0.5 µM), 0.5 µl of 4 µM probe (0.1 µM), 2.5 µl of water, and 5µl of DNA template. The

279. 279
real-time PCR program was 95°C initial activation for 15 min and 40 cycles for 95°C denaturation at 0
second and a 60°C combined annealing and extension step for 60 seconds.
The PCR was performed in the GeneAmp®
PCR System 9700 (Applied BioSystems, Foster City,
CA) using the same primers as for real-time PCR described above. Fifty µl of PCR reagents in a tube
containing 5 µl of 10X PCR buffer, 5 µl of 25 mM MgCl2, 1µl of 10 mM dNTP each, 1 µl of each
primer in 100µM, 0.25µl of Taq DNA polymerase (5 U/µl; AmpliTaq®
DNA polymerase, Applied
BioSystems, Foster City, CA), 28.75µl of water, and 5 µl of sample DNA. The PCR steps were
subjected to a 94°C initial denaturation for 2 min and 35 cycles of 94°C denaturation for 30 sec, 50°C
annealing for 30 sec, and 72°C extension for 30 sec, followed by 72°C final extension for 5 min. The
PCR products were detected using 2% agarose gel electrophoresis.
The LAMP assay was performed in 25 µl, which contained 1X ThermolPol buffer (New England
Biolabs Inc., Beverly, MA). Each dNTP was used at a concentration of 1.2 mM, inner primers to a final
concentration of 1.6 µM, outer primers to a concentration of 0.2 µM, loop primers to a concentration of
0.4 µM, 1.0 M of betaine (Sigma, Saint Louis, MO), 1 µl of 8U Bst DNA polymerase (Large Fragment;
New England Biolabs Inc., Beverly, MA), 4 mM of MgSO4, and 5 µl of DNA template. To optimize the
reaction, 60°C, 63°C, and 65°C temperatures were tested. Reaction times of 15, 25, 35, 45, 50, and 60
min were also examined to optimize the LAMP. The reaction was stopped at 95°C for 3 min to
terminate the enzyme activity. After LAMP reaction, DNA products were verified by 2% agarose gel
electrophoresis, stained with ethidium bromide, and visualized on a UV transilluminator (Fotodyne®
Inc., Hartland, WI). During DNA amplification (PCR or LAMP), the betaine increased the yield and
specificity. Betaine also reduced secondary structure in GC-rich regions and eliminated base pair
composition dependence of DNA melting (Rees et al., 1993; Henke et al., 1997).
Designing primers and probe
Primers and probe for real-time PCR and primers for LAMP were designed in the ICP4F/R

280. 280
amplicon. The partial ICP4 gene sequences of the following ILTV strains: CEO vaccine (Genbank
accession number EU104900), TCO vaccine (accession number EU104908), ILTV assembled total
genome sequence (accession number NC_006623), and 2 ILTV vaccines, AviPro®
LT and LT Blen®
,
were sequenced at Auburn University Genomics & Sequencing Laboratory. They were aligned with
AlignX®
from vector NTI sequence analysis and data management software v10.3 (Invitrogen Co.,
Carlsbad, CA). Real-time PCR primers and probe, which generated a 125 bp product, were selected
from the conserved regions of the ICP4 gene (Fig 3.1 and Table 3.1). The target DNA sequence was
searched using the BLAST service in the Genbank database. Results indicated that the real-time PCR
product was located in the ILTV ICP4 gene. Primers and probes were produced by Integrated DNA
Technologies®
, Inc. (Coralville, CA).
The LAMP primers were designed using the conserved region of ILTV ICP4 gene in the ICP4F/R
amplicon as determined by the Primer Explorer V4 software (Eiken Chemical Co., Ltd, Japan). To
produce the end stability, the primer selection followed the rule that the free energy (ΔG) of 3’end of
F2/B2, F3/B3, LF/LB, and the 5’end of F1c/B1c should be -4kcal/mol or less. One set of primers was
chosen. This primer set comprising two outer, two inner, and two loop primers recognized eight distinct
regions in the target sequence. The forward inner primer (FIP) and the backward inner primer (BIP)
each had two distinct sequences corresponding to the sense and anti-sense sequence. The DNA strands
synthesized from the outer primers (F3 and B3), displaced the primary strands. The forward loop primer
(LF) recognized the complementary strand corresponding to the region between F1 and F2, and the
reverse loop primer (LB) annealed to the complementary strand corresponding to the region between B1
and B2 (Fig 3.2 and Table 3.2).
Specificity, detection limit, and reproducibility of real-time PCR and LAMP assays
To determine the sensitivity and detection limit for real-time PCR and LAMP, serial 10-fold
dilutions of plasmid DNA from 100
-109
copies/ µl were analyzed. The real-time PCR assay was repeated

281. 281
four times. Standard curves indicating the linear relationships between the threshold crossing points (Cp)
and the logarithms of initial ILTV ICP4 gene count were constructed. Serial dilutions were repeated in
the same run to evaluate intra-experiment reproducibility.
To determine specificity, five ILTV strains, non-template negative controls, MG, fowl pox, and MD
vaccines were tested. The detection limit and reproducibility of the real-time PCR assays were
determined by four independent runs using 10-fold serial dilutions (100
-109
) of the ICP4 gene plasmids
as template. A standard curve and equation were generated. Copy number of the ILTV template per
amplification reaction was estimated using the standard curve equation. Serial dilutions of the ICP4
plasmids from 6, 15, 30, 60, 6×102
, 6×103
, and 6×104
copies/ µl determined the sensitivity of the LAMP
assay.
Viral titration and ILTV genome copy number conversion
To determine the conversion between viral titer and ILTV DNA copy number, ILTV vaccine stock
was titrated in SPF chicken embryonated eggs and the copy number was checked with real-time PCR.
For viral titration, 50% embryonic infective dosage (EID50) of the LT Blen®
vaccine was initiated using
9 serial 10-fold dilutions of viral stock made in PBS. Four 9-day-old SPF embryonic eggs were used per
viral concentration and each egg was inoculated with 200 µl of viral dilution via the CAM route. After 7
days the CAMs were checked for ILTV associated pock formation. The viral titer was calculated using
the Reed-Muench formula (Reed and Muench, 1938). The EID50 titrations were repeated three times and
the ILTV genome copy number was detected with the real-time PCR.
Viral concentration was detected in one dose of LT Blen®
vaccine. The vaccine virus was diluted
using the manufacture’s protocol to 4 doses and the ILTV genome copy number checked with real-time
PCR. The tests were repeated three times.

282. 282
3.3 Results
Specificity of real-time PCR and LAMP assays
Both assays were positive for only ILTV DNAs. No fluorescent signal or positive gel patterns were
detected with the non-template control and non-ILTV vaccines (Figs 3.9 and 3.10). When the LAMP
products were analyzed with agarose gel electrophoresis, they typically showed many bands with
different sizes and a smeared DNA between these bands at each loading well.
Sensitivity, reproducibility, and detection limit
Four repeats of qPCR tests generated standard curves, which had an average intercept of 38.28 ± 0.63
and an average slope of -3.14 ± 0.06 (Figs 3 and 4, Table 4). The standard curves had a significant
correlation between Cp value and copy number with the square of the sample correlation coefficient (R2
)
above 0.99 and the average efficiency was 2.063 ± 0.048. The standard deviation of Cp value was low,
which indicated excellent reproducibility (Table 3.4). The real-time PCR maintained linearity at 10
copies/ µl and the standard deviation (SD) and standard error (SE) were stable and low (Table 3.3). One
of four repeated real-time PCR tests at 1 copy/ µl was negative, and the Cp values of the other three
repeats were above 35. The LightCycler®
could not estimate the Cp value when the Cp value was
between 35 and 40 for a 40-cycle real-time PCR. Quantification limits were determined at 10 copies/ µl.
Samples with the Cp value ≤ 35 were considered positive for ILTV DNA (Table 3.3). The sensitivity of
conventional PCR, using the same primer set as real-time PCR, was 103
copies/ µl (Fig 3.6). Therefore,
real-time PCR was about 100 times more sensitive than conventional PCR. The LAMP assay detected
ILTV DNA templates at 60 copies/ µl (Fig 3.7). The sensitivity of real-time PCR was 6-fold higher than
the LAMP.
Correlation between virus genome count and virus titer

283. 283
One EID50 was equal to (2.1 ± 1.3) × 102
ILTV genomic copies, and one dose of ILTV vaccine was
equal to (6.9 ± 0.85) × 105
copies (Tables 5A and 5B).
Optimizing the LAMP assay conditions
The LAMP reaction created many DNA bands of different sizes in the target sequence region. The
amplification with LAMP assay showed a ladder-like pattern upon agarose electrophoresis. The
optimal temperature for Bst DNA polymerase was between 60-65°C. DNA products using the LAMP
assay at 65°C were brighter and clearer than at other temperatures (Fig 3.7). Thus, 65°C was selected as
the optimal temperature for this ILTV LAMP assay. Reaction time also affected the LAMP efficiency.
The LAMP products were observed with bright bands after the LAMP reaction was performed above 45
min (Fig 3.8).
3.4 Discussion
A TaqMan®
probe based real-time PCR and LAMP assay for the detcion of IALTV were developed
and their snbetivity compared. Alought the real time PCR assay was more sentivt thatn the LAMP, the
RT-PCT assay requires a thermal cycler and reagents are more expensive. The LAMP assay is more
economical and faster than real-timer PCR.
The sensitivity of this real-time PCR was 10 copies/ µl of ILTV DNA. It was highly repeatable.
According to ANOVA statistics analysis, Ct values at the same genomic copy number of multiple
repeats were almost identical (p = 0.9948 > 0.05). The variations of slopes (-3.14 ± 0.06) and intercepts
(38.28 ± 0.63) of regression equations were minimal, implying that the real-time PCR assay was highly
repeatable. The reaction was performed at 65°C for less than one hour and did not require a thermal
cycler. In addition, the reaction time was faster than qPCR. Reagents and equipment for LAMP assay
were less expensive than qPCR and could be easily adopted for most laboratories. The sensitivity of

284. 284
LAMP assay was less affected by contaminating components, feces, feed, and blood, which can be
contained in clinical samples, than for PCR. Therefore, the DNA purification steps can be omitted
(Kaneko et al., 2007).
The current real-time PCR using a fragment of the ICP4 gene was the most sensitive detection
method reported reported so for ILTV. Also the binding of SYBR-Green I dye to dsDNA molecules is
non-specific, the SYBR-Green I based PCR can be affected by the formation of primer-dimmers and
sample concentration. In addition, multiple SYBR-Green I dye molecules can bind to the same dsDNA
fragment. These disadvantages have limited the application of SYBR-Green I based real-time PCR for
use in DNA quantitative detection. In contrast the ILTV LAMP detection method used six primers,
which recognized eight distinct regions of the ILT ICP4 gene, the specificity of LAMP was high.
However, in this study, the selection region of the LAMP primer designation was limited to the same
region as the real-time PCR.
In summary, the real-time PCR and LAMP assays were specific, sensitive, and reproducible for
ILTV detection. Although the sensitivity of LAMP was lower than that of real-time PCR, it is faster, has
a lower cost, and does not require a temperature cycler or expensive real-time PCR equipment. This was
the first report comparing these two methods for ILTV DNA detection.
References
Abbas, F., Andreasen, J. R., Baker, R. J., Mattson, D. E., and Guy, J. S., 1996. Characterization of
monoclonal antibodies against infectious laryngotracheitis virus. Avian Dis. 40, 49-55.
Alexander, H. S., Key, D. W., and Nagy, E., 1998. Analysis of infectious laryngotracheitis virus isolates
from Ontario and New Brunswick by polymerase chain reaction. Can. J. Vet. Res. 62, 68-71.
Callison, S. A., Riblet, S. M., Oldoni, I., Sun, S., Zavala, G., Williams, S., Ressurreccion, R., Spackman,
E., and Garcia, M., 2007. Development and validation of a real-time TaqMan PCR assay for the

285. 285
detection and quantification of infectious laryngotracheitis virus in poultry. J. Virol. Meth. 139, 31-38.
Chang, P. C., Chen, K. T., Shien, J. H., and Shieh, H. K., 2002. Expression of infectious
laryngotracheitis virus glycoproteins in Escherichia coli and their application in enzyme-linked
immunosorbent assay. Avian Dis. 46, 570-580.
Chacón, J. L., and Ferreira, A. J., 2008. Development and validation of nested-PCR for the diagnosis of
clinical and subclinical infectious laryngotracheitis. J Virol. Meth. 151(2), 188-93.
Clavijo, A., and Nagy, E., 1997. Differentiation of infectious laryngotracheitis virus strains by
polymerase chain reaction. Avian Dis. 41, 241-246.
Creelan, J. L., Calvert, V. M., Graham, D. A., and McCullough, S. J., 2006. Rapid detection and
characterization from field cases of infectious laryngotracheitis virus by real-time polymerase chain
reaction and restriction fragment length polymorphism. Avian Pathol. 35, 173-179.
Cresop, R., Woolcock, P. R., Chin, R. P., Shivapreasad, H. L., and Garcia, M., 2007. Comparison of
diagnostics techniques in an outbreak of infectious laryngotracheitis from meat chickens. Avian Dis. 51,
858-862.
Dukes, J. P., King, D. P., and Alexandersen, S., 2006. Novel reverse transcription loop-mediated
isothermal amplification for rapid detection of food-and-mouth disease virus. Arch. Virol. 151, 1093-
1106.
En, F. X., Wei, X., Jain, L., and Qin, C., 2008. Loop-mediated isothermal amplification establishment
for detection of pseudorabies virus. J. Virol. Meth. 151(1), 35-39.
Guy, J. S., and Garcia, M. Chapter 5: Laryngotracheitis., 2008. In: Saif, Y. M., Fadly, A. M., Glisson, J.
R., McDaugald, L.R., Nolan, L.K., and Swayne, D. E. (Eds.), Disease of Poultry, 11th
ed. Iowa State
University Press, Ames, Iowa, pp. 137-152.
Guy, J. S., Barnes, H. J., and Smith, L. G., 1992. Rapid diagnosis of infectious laryngotracheitis using a
monoclonal antibody-based immunoperoxidase procedure. Avian Pathol. 21, 77-86.
Henke, W., Herdel, K., Jung, K., Schnorr, D., and Loening, S. A., 1997. Betaine improves the PCR
amplification of GC-rich DNA sequences. Nucleic. Acid Res. 25 (19), 3957-3958.

286. 286
Hughes. C. S., and Jones, R. C., 1988. Comparison of cultural methods for primary isolation of
infectious laryngotracheitis virus from field materials. Avian Pathol. 17, 295-303.
Humberd, J., Garcia, M., Riblet, S. M., Resurreccion, R. S., and Brown, T. P., 2002. Detection of
infectious laryngotracheitis virus in formalin-fixed, paraffin-embedded tissues by nested polymerase
chain reation. Avian Dis. 46, 64-74.
Imai, M., Ninomiya, A., Minekawa, H., Notomi, T., Tu, P. V., Tien, N. T. K., Tashiro, M., and Odagiri,
T., 2007. Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5
hemagglutinin gene-specific loop-mediated isothermal amplification method. J. Virol. Meth. 146, 125-
128.
Kaneko, H., Kawana, T., Fukushima, E., and Suzutani, T., 2007. Tolerance of loop-mediated isothermal
amplification to a culture medium and biological substance. J. Bioch. Bio. 70, 499-501.
McGeoch, D. J., Dolan, A., and Ralpf, A. C., 2000. Toward a compresensive phylogeny for mammalian
and avian herpesviruses. J. Virol. 74, 10401-10406.
Mori Y, Nagamine K, Tomita N, and Notomi T. Detection of loop-mediated isothermal amplification
reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res.
Commun. 2001, 289:150-54.
Mori Y, Hirano T, and Notomi T, 2006. Sequence specific visual detection of LAMP reactions by
addition of cationic polymers. BMC Biotechnol. p 3-6.
Nagamine, K., Hase, T., and Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal
amplification using loop primers. Mol. Cell. Prob. 16, 223-229.
Nair, V., Jones, R. C., and Gough, R. E., 2008. Herpesviridae. In: Pattison, M., McMullin, P. F.,
Bradbury, J. M., and Alexander, D. J. (Eds.), Poultry Disease. 6th
ed. Sunders Elsevier. pp. 267-271.
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., and Hase, T., 2000.
Loop-mediated isothermal amplification of DNA. Nucl. Acids Res. 28, e63.

287. 287
Pang, Y., Wang, H., Girshick, T., Xie, Z., and Khan, M. I., 2002. Development and application of a
multiplex polymerase chain reaction for avian respiratory agents. Avian Dis. 46, 691-699.
Rashid, S., Naeem, K., Ahmed, Z., Saddique, N., Abbas, M. A., and Malik, S. A., 2009. Multiplex
polymase chain reaction for detection and differentiation of avian influenza viruses and other poultry
respiratory pathogens. Poult. Sci. 88, 2526-2531.
Reed, L. J., and Muench, H., 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg.
27, 493-497.
Rees, W.A., Yager, T. D., Korte, J. and von Hippel, P. H., 1993. Betaine can eliminate the base pair
composition dependence of DNA melting. Biochemistry 32, 137–144.
Srinivasan, V. A., and Mallick, B. B., 1977. Studies on multiple inoculations of infectious
laryngotracheitis virus in chickens. Ind. Vet. J.54, 1-5.
Thureen, D. R., and Keeler, C. L. Jr., 2006. Psittacid herpesvirus 1 and infectious laryngotracheitis virus
: comparative genome sequence analysis of two avian alphaherpesvirus. J. Virol. 80, 7863-7872.
Tomita, N., Mori, Y., Kanda, H., and Notomi, T., 2008. Loop-mediated isothermal amplification
(LAMP) of gene sequences and simple visual detection of products. Natur. Protocol. 3, 877-882.
Uedas, S., and Kuwabara, Y., 2009. The rapid detection of Salmonella from food samples by loop-
mediated isothermal amplification (LAMP). Biocontrol. Sci. 14(2), 73-6.
Vogtlin, A., Bruckner, L., and Ottiger, H.-P., 1999. Use of polymerase chain reaction (PCR) for the
detection of vaccine contamination by infectious laryngotracheitis virus. Vaccin. 17, 2501-2506.
WilliamsR. A., Bennett, M., Bradbury, J. M., Gaskell, R. M., Jones, R. C., and Jordan, F. T. W., 1992.
Demonstration of sites of latency of infectious laryngotracheitis virus using the polymerase chain
reaction. J. Gen. Virol. 73, 2415-2420.
Williams, R. A., Savage, C. E., and Jones, R. C., 1994. A comparison of direct electron microscopy,
virus isolation, and a DNA amplification method for the detection of avian infectious laryngotracheitis
virus in field material. Avian Pathol. 23, 709-720.

288. 288
Yamazaki, W., Taguchi, M., Ishibashi, M., Nukina, M., Misawa, N., and Inoue, K., 2009. Development
of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Campylobacter
fetus. Vet Microbiol. 136(3-4), 393-6.
York, J. J., and Fahey, K. J., 1988. Diagnosis of infectious laryngotracheitis using a monoclonal
antibody ELISA. Avian Pathol. 17(1), 173-182.
Table 3.1.
Real-time PCR primers and TaqMan probe sequences
Primers and probe (5’-3’) Length Position c
ICP4 qPCR-F： CCCCACCCAGTAGAGGAC
ICP4 qPCR-R： CGAGATACACGGAAGCTGATTT
ICP4 Probe： FAM A
-CAGTCTTTGGTCGATGACCCGC-
TAMRA B
18
22
23
143906-143923
144010-144031
143949-143971
A. FAM, 6-carboxyfluorescein;
B. TAMRA, 6-carboxytetramethylrhodamine.
C. The position numbers of the primers and probe were obtained from GenBank accession
#NC_006623.

289. 289
Table 3.3. Intra-experimental reproducibility of real-time PCR assay
ICP4-BIP
(B1c+B2)
ATGTACTCTCACGAGCGTTGGCCTGGAACAAAAACGCGAGC Reverse
inner
41
ICP4-LF: CGTTTCGACCCACTCCCT Forward
loop
18
ICP4-LB GTCGACCTCCATAGTTCCGA Reverse
loop
20
Copy number
Mean Cp (cycles) A
SDB
SEC

290. 290
A. Average Cp value from
four independent runs.
B. Standard deviations of Cp values.
C. Standard error of the mean Cp values.
D. One of four repeats was negative and the Cp values of other 3 repeats were higher than 35.
Table 3.5A.
Correlation between ILTV viral genomic copy number and EID50
Titration1 Titration 2 Titration 3 Mean SDA
EID50/ml 8.9 × 105
8.0 ×105
5.0×105
Real-time PCR
(copies/ml)
3.2×108
9.8×107
7.6×107
Conversion factor
(copies/EID50)
3.6×102
1.2×102
1.5×102
2.1×102
±1.3×102
1 EID50 ≈ (2.1±1.3) ×102
copies
A: SD= Standard deviation
109
108
107
106
105
104
103
102
101
100
10.26
13.26
16.24
18.97
22.66
25.67
28.99
32.40
34.90
>35
±0.45
±0.56
±1.02
±0.88
±0.85
±0.82
±0.76
±0.50
±0.12
-D
±0.22
±0.27
±0.51
±0.44
±0.42
±0.41
±0.38
±0.25
±0.06
-D

291. 291
Table 3.5B.
Correlation between vaccine dosage and ILTV viral genomic copy number
4 doses of ILTV vaccine
Real-time PCR (copies/4
doses)
2.4 × 106
3.1 × 106
2.8 ×106
Mean SDA
Conversion factor
(copies/dose)
6.0×105
7.7×105
7.0× 105
6.9 ×105
±0.85×105
1 dose ≈ (6.9 ± 0.85) × 105
copies
A: SD= Standard deviation
Fig 3.5. Sensitivity of LAMP for ILTV detection. Electrophoresis photo of serial 10-fold dilutions of
ILTV ICP4 gene subjected to LAMP assay. The ILTV positive products in wells showed many
bands with different sizes and a smeared DNA between these bands. The bands smaller than 50 bp
were primer dimmers. M: DNA marker. 1: 6×104
; 2: 6×103
; 3: 6×102
; 4: 60; 5: 30; 6: 15; 7: 6
copies/ µl; 8: negative control.
ICP4 qPCR-R
F2
B3c
F1c
B1C
B2LB
LF
Cycles
Fluorescence(530nm)
bp
1000
750
500
300
150
50

292. 292
Fig 3.9. Specificity test of real-time PCR using four CEO vaccines: AviPro®
LT, LT Blen®
, Laryngo-
Vac®
, and Trachvax®
and one TCO vaccine: LT-IVAX®
, and non-ILTV DNA from MG vaccine
(MycoVac-L®
), fowl pox (Chicken-N-PoxTM
), and MD vaccine (MD-Vac®
). The concentrations of ILT
vaccine DNAs were different. There were no fluorescent signals from MG, flowpox virus, MDV
vaccine DNAs and negative control.
-5
0
5
10
15
20
1 6 11 16 21 26 31 36
Avipro LT
LT Blen
Laryngo-Vac
Trachivax
LT-IVAX
MycoVac-L
Chicken-N-Pox
MD-Vac
Negative control
M 1 2 3 4 5 6
Cycles
Fluorescence(530nm)

293. 293
Fig 3.10. Specificity of LAMP assay. M: DNA marker; 1: AviPro®
LT; 2: LT Blen®
; 3: Laryngo-Vac®
;
4: Trachivax®
; 5: LT-IVAX®
; 6: MycoVac-L®
; 7: Negative control; 8: LT Blen®
; 9: Chicken –N-PoxTM
TC; 10: MD-Vac®
CFL; 11: Negative control.
Table of Contents

294. 294
Development of TaqMan real-time RT-PCR for rapid detection of avian reoviruses
Abstract
Avian reoviruses (ARVs) are an important cause of economic losses in commercial poultry. We
developed a TaqMan real-time RT-PCR assay for detecting ARVs. The primer-probe set was designed
from the conserved region of ARV S4 genome segment. The real-time RT-PCR detected 6 ARV strains:
S1133, 2408, CO8, 1733, JR1, ss412 and 2 vaccine strains (ChickVacTM
and V.A. Vac®
) with no cross-
reaction with other avian viruses. It detected CO8, and ss412, which belonged to a different serological
subgroup. The detection limit of this assay was 25 ARV genome copies and was 150 times more
sensitive compared to traditional RT-PCR. Statistical analyses indicated excellent reproducibility.
Correlation between the ARV genome copies and virus titer indicated that for ARV strain 2408, 1EID50
and 1 TCID50 was equivalent to 3.9 ± 0.8 ARV, and 2.9 ± 0.3 ARV genome copies, respectively. This
present test is a rapid, specific and sensitive assay to detect ARVs and will be useful in
veterinary diagnostic laboratories.
Keywords: avian reoviruses, TaqMan, real-time RT-PCR, detection.

295. 295
1. Introduction
Avian reoviruses (ARVs) cause tenosynovitis and are associated with viral enteritis, chronic respiratory
disease, malabsorption syndrome, inclusion body hepatitis, myocarditis, hydropericardium, etc. in
chickens (Bains and MacKenzie, 1974; Fahey and Crawley, 1954; Kerr and Olson, 1969; Kibenge and
Wilcox, 1983; McFerran et al., 1976; Page et al., 1982). These diseases can lead to economic losses due
to mortality and morbidity, reduced growth, poor feed conversion and increased processing plant
condemnation.
ARVs belong to the genus Orthoreovirus and the family Reoviridae (Mertens, 2004; Nibert, 1998).
They have a non-enveloped, double-layer concentric capsid of 70-80 nm in diameter, enclosing the
segmented double-stranded RNA (dsRNA) genome (Spandidos and Graham, 1976). The 10 dsRNA
segments are categorized into 3 groups, designated L (large), M (medium), and S (small), based on their
size and electrophoretic mobility. These segments code for at least 8 structural proteins (λA, λB, λC,
μA, μB/μBC, σC, σA and σB) and 4 non-structural proteins (μNS, P10, P17, and σNS) (Benavente and
Martinez-Costas, 2007; Varela and Benavente, 1994). All genome segments (except the L2 segment) of
vaccine strains S1133 and 1733 have been sequenced.
Virus isolation (VI), serological methods, e.g., virus neutralization (VN), and histopathological assays
are used for detecting ARV infection (Robertson and Wilcox, 1986). VI and VN require propagation of
the samples in chicken embryos or cell culture for 3-5 days. Serological methods, such as agar-gel
precipitin assay (Adair et al., 1987), fluorescent antibody assay (Menendez et al., 1975), and enzyme-
linked immunosorbent assay (Slaght et al., 1978), although fast, lack sensitivity. Reverse transcriptase
(RT)-PCR (Bruhn et al., 2005), nested PCR (Liu et al., 1997), multiplex PCR (Caterina et al., 2004), and
PCR followed by restriction fragment length polymorphism (RFLP) (Lee et al., 1998), have been used to
detect ARVs.
Real-time PCR allows real-time detection and quantification of target DNA molecules as they proceed
through amplification cycles. By incorporating fluorescent reporters, real-time PCR can measure and
monitor target DNA amplification during the exponential phase, resulting in more accurate readings
compared to conventional PCR.
The current study developed the first TaqMan probe based real-time RT-PCR assay for detecting ARVs
from clinical samples. It is a rapid, specific, reproducible, and sensitive test that can be used by
veterinary diagnostic laboratories for efficient control of ARV infections.
2. Materials and methods
2.1 Virus propagation and preparation
All strains were propagated in chicken embryo kidney (CEK) cell cultures. Flasks were stored at -70°C
after 48 to 72 hrs of incubation when 75%-85% cytopathic effect (CPE) was observed. Cell cultures
were frozen and thawed three times to rupture the cell membrane and release virus particles. Cell culture
materials were transferred into 30 ml centrifugation tubes, which contained 3 ml of 40% sucrose.

296. 296
Centrifugation was at 100,000 x g using Type 30 rotor with Beckman®
(Fullerton, CA) ultracentrifuge
L8-70 for 1.5 hr. The bottom phase, which contained concentrated virus and cell debris, was collected
in cryopreservation vials and stored in -70˚C.
2.2 Viral RNA extraction
Viral RNAs were extracted using Qiagen RNeasy®
Mini Kit (Valencia, CA) with modifications.
Briefly, 250 µl of concentrated virus-cell suspension were mixed with 3.5 volumes (875 µl) of lysis
buffer RLT and 20 U Proteinase K (Sigma-Aldrich, St. Louis, MO) and incubated at 37˚C for 10 min.
Two and half volumes (625 µl) of cold 100% ethanol were added and mixed well. Seven hundred
microliters of the mixture was transferred to an RNeasy column and centrifuged at 9,000xg for 15 sec,
then the flow-through was discarded. Remaining mixture was filtered through the same column and
subsequently, the column was washed once with 700 µl of buffer RW1 and twice with 500 µl buffer
RPE. The column was transferred to a 2 ml tube and centrifuged at 14,000xg for 2 min to remove excess
reagents from the filter. Total RNA was eluted in 30 µl of nuclease-free water.
2.3 Primer and probe design
The S4 gene sequences of 9 ARV strains were searched using BLAST and copied from GenBank nucleic
acid database: 2408 (AF213468), 1733(AF294772), 176 (AF059724), 601SI (AF294773), OS161
(AY573913), 750505 (AF213470), 919 (AY573912), T6 (AF213469) and S1133 (U95952). These
sequences were aligned using AlignX®
from Vector NTI™ Sequence analysis and data management
software v10.3 (Invitrogen Corporation, Carlsbad, CA). One set of gene-specific primers and hydrolysis
probe combination, which generates a 139-nucleotide PCR product, was designed from the conserved
region of S4 for use in real-time RTPCR. Another set of primers that encompassed the full length of S4
gene was selected for use in conventional RT-PCR. All probes and primers (Table 2.) were
manufactured by Integrated DNA Technologies®
, Inc. (Coralville, IA).
2.4 Real-time RT-PCR and conventional RT-PCR
Real-time RT-PCR was performed on a LightCycler®
(Roche Applied Science, Indianapolis, IN) with a
20 µl volume, containing 5 µl viral RNA sample and 15 µl of reaction mixture. The Qiagen One-Step
RT-PCR Kit (Valencia, CA) was used for making reaction mixtures, which contain 4 µl of 5x buffer,
3.75 mM of MgCl2, 325 µM of dNTPs (each), 0.5 µM of each primer (R-S4F and R-S4R), 20 U of
RNase inhibitor, 0.8 µl of Enzyme Mix, and 0.25 µM of probe S4-P. Reverse transcription was carried
out at 45˚C for 30 min, and the reaction was heated at 95˚C for 15 min to deactivate the reverse
transcriptase. The PCR stage was subjected to 40 cycles at 95˚C denaturation for 0 sec, 59˚C annealing
for 20 sec, and 72˚C extension for 10 sec.
Conventional two-step RT-PCR was conducted in GeneAmp®
PCR System 9700 (Applied BioSystems,
Foster City, CA) with GeneAmp®
RNA PCR Core Kit (Applied BioSystems, Foster City, CA) following
recommended reagent concentrations and RT-PCR protocol from the manufacturer with modifications.
In the reverse transcription (RT) step, 1 μl of primer S4-FF (100 μM) was mixed with 2 μl of each RNA
sample in a MicroAmp®
tube (Applied BioSystems, Foster City, CA), and the mixture was subjected to
99˚C for 5 min for denaturation. Reaction tubes were rapidly cooled on ice for 5 min to prevent re-

297. 297
annealing of denatured strands. For each reaction, 8 μl of reverse transcription (RT) reaction mixture
with final concentrations of 4.55 mM MgCl2, 1 μl 10x PCR buffer II, 0.9 mM each dNTP, 10 U RNase
inhibitor, and 25 U MuLV reverse transcriptase were added. The RT reaction was performed at 42˚C for
60 min and 72˚C for 15 min. In the PCR step, 40 μl of reaction mixture containing final concentrations
of 2 mM MgCl2, 4 μl 10x PCR buffer II, 2 μM primer S4-FR, and 2.5 U AmpliTaq®
DNA polymerase
were dispensed into each tube. Thermal cycling conditions were 5 min at 95˚C, and 35 cycles of 1 min
at 95˚C, 1 min at 55˚C, and 1 min at 72˚C, and then followed by 7 min at 72˚C final extension. PCR
products were detected following 1.5% agarose gel electrophoresis.
2.5 Construction of ARV σNS RNA standard
Full length (1104 bp) ChickVac™ S4 cDNA was obtained by conventional RT-PCR with primers S4-
FF/S4-FR and cloned into NovaBlue Singles™ competent (Escherichia coli) cells via T7Blue-3 vectors,
which was supplied by a blunt-end cloning kit (Novagen, Darmstadt, Germany). All procedures followed
manufacturers’ instructions.
To verify successful insertion, plasmids were extracted using Wizard®
Plus SV kit (Promega, Madison,
WI). Plasmids were digested with restriction enzymes SnabI and HindIII (Promega, Madison, WI) to
select plasmids with inserts of correct size, and with restriction enzymes HindIII and MfeI (Roche,
Penzberg, Germany) to determine correct orientation.
Plasmids with correct inserts were sequenced using T7 primer to confirm the full length sequence.
Plasmids were linearized with HindIII and transcribed with RiboMAX™ Large Scale RNA Production
System-T7 (Promega, Madison, WI) to produce high quantity viral RNA in accordance with the kit
instructions. Transcribed RNA products were purified with Qiagen RNeasy Mini Kit (Valencia, CA),
and concentrations were measured by the NanoDrop®
ND-1000 UV-Vis Spectrophotometer.
Copy number of the S4 RNA was calculated by the following formula (Ke et al., 2006):
𝑆4 𝑅𝑁𝐴(𝑐𝑜𝑝𝑖𝑒𝑠 𝜇𝑙⁄ ) =
6.022 × 1023
�
𝑚𝑜𝑙𝑒𝑐𝑢𝑙𝑒𝑠
𝑚𝑜𝑙𝑒
� × 𝑐𝑜𝑛𝑐𝑒𝑛𝑡𝑟𝑎𝑡𝑖𝑜𝑛 �
𝑔
𝜇𝑙
�
𝑀𝑜𝑙𝑒𝑐𝑢𝑙𝑎𝑟 𝑤𝑒𝑖𝑔ℎ𝑡 �
𝑔
𝑚𝑜𝑙𝑒
�
2.6 The specificity of real-time RT-PCR protocol
The specificity of real-time RT-PCR was examined using 8 ARV strains: S1133, 2408, CO8, 1733, JR1,
ss412, ChickVac™ and V.A. Vac®
(Fort Dodge Animal Health, Fort Dodge, IA). Both ChickVac™ and
V.A. Vac®
were developed to control tenosynovitis in broiler chickens. Strain JR1, which is trypsin-
resistant, was provided by Fort Dodge Animal Health, Inc. (Overland Park, KS). The CO8 and ss412
strains belong to a different serologic subtype than other strains. Non-template negative controls, and
other avian viral pathogens (avian influenza virus transcribed RNA matrix, H5 and H7 genes and 2
infectious bursal disease virus strains) were included.
2.7 The detection limit
A limiting dilution assay was used to determine the detection limit of the real-time RT-PCR assay (Ke et
al., 2006; Taswell, 1981). Cloned full length ARV S4 RNA was diluted into 50, 30, 20, 5, and 1 copies

298. 298
per tube. Ten replicates for each dilution were examined. The percentage of negative reactions was
plotted against number of copies within the reaction tube. As for standard Poisson distribution, number
of copies that can be detected with this assay corresponded to 37% negative reactions (Slaoui et al.,
1984).
2.8 Viral titers
The 50% embryonic infective dosage (EID50) and 50% tissue culture infective dosage (TCID50) of the
ARV strain 2408 was determined as follows. Nine 10-fold serial dilutions of virus stock were made in
PBS. This was done to determine the sensitivity of the test to detect live virus.
EID50: Four 7-day chicken embryos were used per dilution and each embryo was inoculated with 200 μl
of virus dilution via yolk sac route. Embryos were checked for pathological changes after incubation for
72 hrs. The viral titer (EID50) was calculated using Reed-Muench method (Reed and Muench, 1938).
TCID50: 10-2
to 10-9
virus dilutions were inoculated to chicken embryo kidney (CEK) cell culture on 96-
well cell culture plates. Five wells on each row for each dilution and two replicates on each plate were
used. After incubation for 48 hrs, plates were examined for CPE and TCID50 was calculated using Reed-
Muench method (Reed and Muench, 1938).
3. Results
3.1 Specificity of the real-time RT-PCR assay
All eight ARVs were detected by the real-time RT-PCR assay (Fig. 1). In contrast, it did not detect the
non-template control and non-ARVs (IBDV strains and AIV H7, H5 matrix genes).
3.2 Detection limit
Detection limit of real-time RT-PCR was determined by extrapolating the point of 37% negative samples
intersecting with the x-axis (number of copies) on the linear regression graph of limiting dilution assay
(Fig. 2). The detection limit of the real-time RT-PCR was 25 ARV genome copies.
3.3 Sensitivity comparison of real-time RT-PCR and conventional RT-PCR
Conventional RT-PCR detected as few as 3.8x103
genomic copies (Fig. 3.), whereas the real-time RT-
PCR was capable of detecting 25 copies of ARV RNA (Fig. 2). Therefore, real-time RT-PCR was about
150 (3.8x103
/25) times more sensitive than conventional RT-PCR.
3.4 Reproducibility
Cloned ARV S4 RNA was diluted from 5 x1010
to 50 copies/μl and detected by real-time RT-PCR (Fig.
4). The assay was repeated 3 times. Standard curves indicating the linear relationships between
threshold crossing points (Cp) and the logarithms of initial ARV S4 RNA count were constructed. Three
replicates of standard curves had an average intercept of 40.86 ± 0.88 and an average slope of -3.237 ±
0.17. Standard curves showed a significant correlation between Cp values and copy number with R2
≈1
and average efficiency of 2.040 ± 0.07 (Fig. 5, Table 2). Serial dilutions were amplified in triplicates in

299. 299
the same run to evaluate the intra-experimental reproducibility. Standard deviations of the Cp values
were mostly less than 0.39. The data indicated excellent reproducibility.
3.5 Correlation between virus genome count and virus titer
Viral titers of ARV strain 2408 were measured using 7-day old chicken embryos and CEK cells. Both
EID50 and TCID50 titrations were repeated 3 times and compared with number of ARV genomic copies
determined by the real-time RT-PCR assay. Results indicated that 1 EID50 was equivalent to 3.91 ± 0.80
ARV genome copies, and 1 TCID50 was equivalent to 2.9 ± 0.3 ARV genome copies (Table 3).
4. Discussions
ARVs cause diseases, leading to economic losses in commercial chickens. Rapid and accurate detection
and identification of this pathogen is critical for controlling and prevention of ARV infections. A
sensitive and specific TaqMan probe based real-time PCR assay based on a conserved region of the ARV
S4 genome segment was developed for the qualitative and quantitative detection of ARVs.
Previous studies developed conventional RT-PCR detection methods targeting regions of ARV genome
segments (Bruhn et al., 2005; Lee et al., 1998; Liu et al., 1999; Wen et al., 2004). Results showed low
sensitivity for ARVs. Ke and coworkers (2006) reported quantitative real-time RT-PCR based on
SYBR-Green I chemistry. The assay targeted ARV σA-encoding gene (genome segment S2), which
resulted in high sensitivity (Ke et al., 2006). However, sample RNA preparations required laborious
purification process and density gradient precipitation to remove cellular DNAs. In addition, the SYBR-
Green based PCR can be affected by primer-dimers and sample concentration. Furthermore, multiple
SYBR-Green dye molecules can simultaneously bind to the same dsDNA fragment, thus the
fluorescence intensity generated is proportional to size of DNA molecule. These drawbacks have limited
the application of SYBR-Green I based real-time PCR in quantitative detections.
We reported the first TaqMan probe based real-time RT-PCR targeting the conserved region of ARV S4
genome segment. The assay achieved additional specificity, because of inclusion of a dual-labeled
sequence-specific probe. TaqMan probes only emit fluorescence signals upon complementary binding to
the target region and subsequent cleavage by exonuclease activity of Taq polymerase. Sample
preparation process is simplified especially with the use of a commercial total RNA extraction kit which
needs simpler procedures. TaqMan real-time RT-PCR showed high specificity for all 8 ARV strains
with no cross-reaction with other avian viruses. It also detected strains (CO8 and ss412), which
belonged to different serological subgroups from the other viruses (BIOMUNE Inc., Lenexa, KS, 2007;
Hieronymus et al., 1983).
Our assay could detect and quantify ARV RNA templates as few as 25 copies. Since a 5 μl of sample
was used in each PCR reaction, the lowest detectable concentration was about 5 copies/μl. TaqMan real-
time RT-PCR was also highly reproducible. Multiple repeats resulted in nearly identical standard curves,
and the statistics indicated only small variations in the intercept (40.86 ± 0.88) and slope (-3.237 ± 0.17)
of the regression equation (Fig. 4 and Table 2). Intra-experimental comparisons resulted in small
variations. Comparing conventional RT-PCR using the same primer set, real-time RT-PCR was about

300. 300
150 times more sensitive for detecting cloned ARV S4 RNA.
Determination of virus or vaccine titer is critical for successful experiments or vaccination studies.
Traditionally, virus titration is performed using standard VI method involving inoculation and incubation
of virus in chicken embryos or cell culture, which takes up to a week. In the current study, titers of ARV
reference strain 2408 were determined in 7-day-old chicken embryos (EID50) and CEK cell culture
(TCID50), and number of ARV genome copies were simultaneously determined with real-time RT-PCR.
Results (Table 3) indicated that, 1 EID50 was equivalent to 3.9 ± 0.8 ARV genome copies, and 1 TCID50
was equivalent to 2.9 ± 0.3 ARV genome copies. ARV strain 2408 has been propagated in chicken
embryos and cell cultures for vaccine development for nearly two decades (Rosenberger et al., 1989).
These results indicated that this strain was well adapted to propagate in both chicken embryos and cell
culture. The conversion factors derived from real-time RT-PCR assay measuring genome copy numbers
can be converted to viral titers (EID50 or TCID50); and therefore can provide a simple, and rapid
mathematical estimation of the viral titer for this particular ARV strain.
The current TaqMan based real-time RT-PCR will find use for the rapid and sensitive detection of ARVs
in veterinary diagnostic laboratories.

301. 301
References
Adair, B. M., Burns, K., and McKillop, E. R., 1987. Serological studies with reoviruses in chickens,
turkeys and ducks. J. Comp. Pathol. 97, 495-501.
Bains, B. S. and MacKenzie, M., 1974. Reovirus-associated mortality in broiler chickens. Avian Dis. 18,
472-476.
Benavente, J. and Martinez-Costas, J., 2007. Avian reovirus: Structure and biology. Virus Res. 123, 105-
119.
BIOMUNE Inc., 2007. REOMUNE ss412 (Avian Reovirus Vaccine). BIOMUNE Inc., Lenexa, KS.
USA.
Bruhn, S., Bruckner, L., and Ottiger, H. P., 2005. Application of RT-PCR for the detection of avian
reovirus contamination in avian viral vaccines. J. Virol. Meth. 123, 179-186.
Caterina, K. M., Frasca, S., Girshick, T., and Khan, M. I., 2004. Development of a multiplex PCR for
detection of avian adenovirus, avian reovirus, infectious bursal disease virus, and chicken anemia
virus. Mol.Cell.Probe. 18, 293-298.
Fahey, J. E. and Crawley, J. F., 1954. Studies on chronic respiratory disease of chickens II. Isolation of a
virus. Can. J. Comp. Med. Vet. S. 18, 13-21.
Hieronymus, D. R. K., Villegas, P., and Kleven, S. H., 1983. Identification and serological differentiation
of several reovirus strains isolated from chickens with suspected malabsorption syndrome. Avian
Dis. 27, 246-254.
Joklik,W.K. 1983. The reovirus particle. 9-78pp in The Reoviridae. Plenum Press Inc.
Ke, G. M., Cheng, H. L., Ke, L. Y., Ji, W. T., Chulu, J. L. C., Liao, M. H., Chang, T. J., and Liu, H. J.,
2006. Development of a quantitative LightCycler real-time RT-PCR for detection of avian
reovirus. J. Virol. Meth. 133, 6-13.
Kerr, K. M. and Olson, N. O., 1969. Pathology of chickens experimentally inoculated or contact-infected
with an arthritis-producing virus. Avian Dis. 13, 729-745.
Kibenge, F. S. B. and Wilcox, G. E., 1983. Tenosynovitis in chickens. Vet. Bull. 53, 431-443.
Lee, L. H., Shien, J. H., and Shieh, H. K., 1998. Detection of avian reovirus RNA and comparison of a
portion of genome segment S3 by polymerase chain reaction and restriction enzyme fragment
length polymorphism. Res. Vet. Sci. 65, 11-15.

302. 302
Liu, H. J., Chen, J. H., Liao, M. H., Lin, M. Y., and Chang, G. N., 1999. Identification of the C-
encoded gene of avian reovirus by nested PCR and restriction endonuclease analysis. J. Virol.
Meth. 81, 83-90.
Liu, H. J., Giambrone, J. J., and Nielsen, B. L., 1997. Molecular characterization of avian reoviruses
using nested PCR and nucleotide sequence analysis. J. Virol. Meth. 65, 159-167.
McFerran, J. B., McCracken, R. M., Connor, T. J., and Evans, R. T., 1976. Isolation of viruses from
clinical outbreaks of inclusion body hepatitis. Avian Pathol. 5, 315-324.
Menendez, N. A., Calnek, B. W., and Cowen, B. S., 1975. Localization of avian reovirus (FDO isolant)
in tissues of mature chickens. Avian Dis. 19, 112-117.
Mertens, P., 2004. The dsRNA viruses. Virus Res. 101, 3-13.
Nibert, M. L., 1998. Structure of mammalian ortho302rthoreovirusicles, reoviruses I. structure, proteins
and genetics. Curr. Top. Microbiol. 233, 2-30.
Page, R. K., Fletcher, O. J., Rowland, G. N., Gaudry, D., and Villegas, P., 1982. Malabsorption
syndrome in broiler chickens. Avian Dis. 26, 618-624.
Reed,L.J. and Muench,H., 1938. A simple method of estimating fifty percent endpoints. Am.J.Hyg. 27,
493-497.
Robertson, M. D. and Wilcox, G. E., 1986. Avian reovirus. Vet. Bull. 56, 726-733.
Rosenberger, J. K., Sterner, F. J., Botts, S., Lee, K. P., and Margolin, A., 1989. In vitro and in vivo
characterization of avian reoviruses. I. Pathogenicity and antigenic relatedness of several avian
reovirus isolates. Avian Dis. 33, 535-544.
Schnitzer, T. J., 1985. Protein coding assignment of the S genes of the avian reovirus S1133. Virology.
141, 167-170.
Slaght, S. S., Yang, T. J., van der Heide, L., and Fredrickson, T. N., 1978. An enzyme-linked
immunosorbent assay (ELISA) for detecting chicken anti-reovirus antibody at high sensitivity.
Avian Dis. 22, 802-805.
Slaoui, M., Leo, O., Marvel, J., Moser, M., Hiernaux, J., and Urbain, J., 1984. Idiotypic analysis of
potential and available repertoires in the arsonate system. J. Exp. Med. 160, 1-11.
Spandidos, D. A. and Graham, A. F., 1976. Nonpermissive infection of L cells by an avian reovirus:
restricted transcription of the viral genome. J. Virol. 19, 977-984.

303. 303
Taswell, C., 1981. Limiting dilution assays for the determination of immunocompetent cell frequencies.
I. Data analysis. J. Immunol. 126, 1614-1619.
van der Heide, L. and Page, R. K., 1980. Field experiments with viral arthritis/tenosynovitis vaccination
of breeder chickens. Avian Dis. 24, 493-497.
Varela, R. and Benavente, J., 1994. Protein coding assignment of avian reovirus strain S1133. J. Virol.
68, 6775-6777.
Wen, L. S., Ying, J. L., Hung, Y. S., Hung, J. L., and Long, H. L., 2004. Rapid characterization of avian
reoviruses using phylogenetic analysis, reverse transcription-polymerase chain reaction and
restriction enzyme fragment length polymorphism. Avian Pathol. 33, 171-180.

304. 304
Table 1. Real-time and conventional RT-PCR primers and TaqMan probe sequences
RT-PCR Primers and Probes Length Positions
Real-time
R-S4F: ATTATGGCTGGCTTTGTACCT 21 433-453
S4-P: FAMa
-CGTGAAGGTGATGACTTTGCTCC-TAMRAb
23 454-476
R-S4R: ACAATCTGAGGACGACCATC 20 572-553
Conventional
Full-length
S4-FF: ATGGACAACACCGTGCGT 18 1-18
S4-FR: CTACGCCATCCTAGCTGGAGA 21 1104-1084
a
FAM, 6-carboxyfluorescein;
b
TAMRA, 6-carboxytetramethylrhodamine.
Table 2. Statistics for standard curve and regression equationsa
for cloned viral RNA detected by real-
time RT-PCR
Repeat 1 Repeat 2 Repeat 3 Mean SD
Intercept 40.49 40.23 41.86 40.86 ±0.88
Slope -3.115 -3.162 -3.433 -3.237 ±0.17
Eb
2.094 2.071 1.955 2.040 ±0.07
R2
0.9977 0.9958 0.9935
a
𝐶𝑝 = 𝑠𝑙𝑜𝑝𝑒 × log(𝑔𝑒𝑛𝑜𝑚𝑒 𝑐𝑜𝑢𝑛𝑡) + 𝑖𝑛𝑡𝑒𝑟𝑐𝑒𝑝𝑡
b
E: Efficiency = 10−1/𝑠𝑙𝑜𝑝𝑒

305. 305
Table 3. Correlation between viral genome copy number versus EID50 and TCID50
for ARV strain 2408.
Titration 1 Titration 2 Titration 3
EID50/ml 1.26x104
8.91x105
1.26X106
Mean SDReal-time RT-PCR
(genome copies/ml)a 3.76x104
3.83x106
5.58x106
Conversion factor
(copies/EID50)b 3.0 4.3 4.4 3.9 ±0.8
TCID50/ml 1.02X106
9.12X105
1.12X106
Mean SDReal-time RT-PCR
(genome copies/ml)c 2.89x106
Conversion factor
(copies/TCID50)d 2.8 3.2 2.6 2.9 ±0.3
a
Titrations were repeated with 3 different virus stock solutions.
b
1 EID50 ≈ 3.9 ± 0.8 ARV 2408 genome copies.
c
Titration was repeated with the same virus stock solution.
d
1 TCID50 ≈ 2.9 ± 0.3 ARV 2408 genome copies

306. 306
0
2
4
6
8
10
5 10 15 20 25 30 35
Negative
ChickVac
S1133
JR1
2408
CO8
1733
ss412
VaVac
IBDV_VarE
IBDV_APHIS
AIV_H7
AIV_H5
AIV_Matrix
Fluorescence(530nm)
Cycles
Figure 1. Specificity test of real-time RT-PCR. Eight ARV strains: ChickVac, S1133, JR1, 2408, CO8,
1733, ss412 and V.A.Vac were detected by the assay; while the five non-ARV viral RNAs: IBDV VarE,
IBDV APHIS, AIVs (H7, H5 and Matrix purchased, transcribed RNA) were not detected.

307. 307
0%
20%
40%
60%
80%
100%
0 10 20 30 40 50
Negative%
Number of copies per reaction
y= - 1.852x + 83.263 R=0.9564
25
37%
Figure 2. . Limiting dilution assay indicated that the detection limit of TaqMan real-time RT-PCR was
about 25 genome copies per reaction.

308. 308
Figure 3. Electrophoresis photo of conventional RT-PCR of serial dilution of cloned ARV S4 gene on
1.8% agarose gel indicated the target amplicon of 139 bp. (M: DNA marker; 1: 3.8x109
; 2: 3.8x108
; 3:
3.8x107
; 4: 3.8x106
; 5: 3.8x105
; 6: 3.8x104
; 7: 3.8x103
; 8: 3.8x102
; 9: 3.8x10; 10: 3.8 genome copies; N:
negative control).

309. 309
0
1
2
3
4
5
6
7
0 5 10 15 20 25 30 35 40
Negative
3.8x10e9
3.8x10e8
3.8x10e7
3.8x10e6
3.8x10e5
3.8x10e4
3.8x10e3
3.8x10e2
3.8x10e1
Fluorescence(530nm)
Cycles
Figure 4. Amplification curves of 10-fold serial dilutions of cloned ARV S4 RNA. Legend indicates the
number of copies of S4 RNA template.

310. 310
10
15
20
25
30
35
1 2 3 4 5 6 7 8 9
Repeat 1
Repeat 2
Repeat 3
y = 40.49 - 3.115x R
2
= 0.9977
y = 40.23 - 3.162x R
2
= 0.9958
y = 41.86 - 3.433x R
2
= 0.9935
CrossingPoints(cycles)
Log (genome count)
Figure 5. Standard curves (three repeats) of the TaqMan real-time RT-PCR assay and regression
equations.

311. 311
Detection and differentiation of avian reoviruses using SYBR-Green I
based two-step real-time RT-PCR with melting curve analysis
Kejun Guo*, Teresa V. Dormitorio, Joseph J. Giambrone
Department of Poultry Science, Auburn University, Auburn, AL 36830, USA
Abstract
Avian reoviruses (ARVs) are a cause of reduced profits to the chicken industry.
Improved viral detection and differentiation are needed for better ARVs control. A
SYBR-Green I based real-time PCR detected and differentiated ARVs (S1133, 2408,
CO8, 1733, JR1, 3005, ss412, and two vaccines: ChickVac™ and V.A. Vac®
). All
isolates from North America belong to the same serotype, however, at least 2
subtypes have been shown using cross viral neutralization (CVN) tests. The JR1, a
trypsin resistant strain, and the 3005 strain are from Europe. A multitude of sero and
subtypes have been isolated worldwide. Subtype differences can make production and
use of correct vaccines complicated. CVN tests are time consuming and require a
collection of viruses and antibodies. The Reverse transcriptase PCR followed by
restriction fragment polymorphism (RT-PCR-RFLP) can also show differences and
group ARVs. We developed a (SYBER-Green I based 2 step real time PCR) to speed
up subtype detection and differentiation. It was faster and more sensitive than other
methods. Three primers sets were taken from the σC-encoding gene located at in the
S1 genome, which codes for the attachment protein. The σC protein induces
neutralizing antibody, is the determinant for ARV serotypes, and has a higher
mutation rate than the other genes.

312. 312
5. Introduction
Avian reovirus belongs to Orthoreovirus genus and Reoviridae family (Mertens, 2004). ARVs are
associated with multiple of disease in poultry (Rosenberger et al., 1989). They were first identified as
the cause of tenosynovitis, and subsequently were associated with other diseases, such as enteritis,
respiratory disease, myocarditis, hepatitis, and malabsorption syndrome. However, most ARV infections
cause subclinical infections, which complicate ARV diagnosis (Bains and MacKenzie, 1974; McFerran
et al., 1976;
Page et al., 1982).
ARVs are associated with immunosuppression. Co-infection with other pathogens can result in
synergetic effects, which may lead to more severe disease and poor immunological response to
vaccination (Page et al., 1982; Robertson and Wilcox, 1986).
There are over 40 ARV strains worldwide. They are categorized into sero and subtypes in Japan
(Kawamura et al., 1965; Takase et al., 1987), Australia (Robertson et al., 1984), and other countries
(Wood et al., 1980). A phylogenetic study grouped them into 5 major clusters: the Netherlands,
Germany, Taiwan, Australia, and the US. Australia and US isolates are more uniform than other regions
(Kant et al., 2003). Heterogeneity in sequences and serological classifications may result from high
mutation rate in viral RNA and possible reassortment when strains co-infect the same host (Rekik et al.,
1991). Isolated geographical characteristics facilitated exchanges of segmented genomes within small
numbers of viral strains, which resulted in less genetic variations within the region. All North American
ARV strains belonged to the same serotype (van der Heide, 2000). Nevertheless, diversities in
serological and phylogenetic classifications do not correlate with specific conditions (Kant et al., 2003).
Closely related strains provide ease of detection and
prevention. In contrast, small differences in

313. 313
genotypes may affect vaccination efficacy. Studies indicate that the most commonly used ARV
(S1133) vaccine resulted in poor antibody (AB) titer and partial protection against strain 1733 as
compared to recombinant vaccine developed from 1733 (Vasserman et al., 2004). To achieve protection
against ARVs, it is important to identify specific antigenic subtypes.
The σC-encoding gene located at the third open reading frame of the S1codes for the attachment
protein, which allowed its binding with host cells. The σC protein located on the surface of the outer
layer capsid, induces neutralizing antibody and is the determinant for serotypes (Martinez-Costas et al.,
1997). The σC-encoding gene has a higher mutation rate than other ARV genes (Liu et al., 2003);
therefore, we selected it as the target to group ARVs.
An analysis was conducted using all published σC nucleotide sequences of North American ARV
strains, which resulted in 96.6% sequence similarity. Mutation sites were scattered across the whole
gene. Therefore, there were no short (100~200bp in length) strain-specific regions, which could be used
for designing probes based real-time PCR. However, utilizing melting peak analysis of DNA dye –
SYBR-Green based real-time RT-PCR was an option for differentiation of isolates.
Melting peak analysis monitors changes in fluorescent signal during temperature increase. Analysis
is based on the fact that each dsDNA has its own melting temperature (Tm),Ich is defined as the
temperature at which 50% of DNA becomes single-stranded. The Tm value of a dsDNA molecule is
determined by its size (number of nucleotides), G-C contents, Waston-Crick pairing and sequence order.
As temperature increases, the proportion of dissociated dsDNA increases; therefore, using dsDNA dye,
such as SYBR-Green I, when temperature reaches the Tm, the fluorescent signal will drop (Ririe et al.,
1997). A sequence-specific melting peak is calculated as the negative first derivative of fluorescence
change, meaning the temperature at which the highest reduction of fluorescence signal strength occurs.

314. 314
SYBR-Green chemistry can perform real-time PCR. SYBR-Green is an asymmetrical cyanine dye,
which binds the minor groove of double stranded DNA. SYBR Green dye can emit a strong fluorescent
signal upon binding to double stranded DNA, and the intensity of the fluorescent emissions increases
during PCR annealing and extension phases (Nygren et al., 1998). As more double stranded amplicons
are produced, SYBR Green dye signal will increase. SYBR-Green real-time PCR has several advantages
over probe based real-time PCR. It is easy to design, because it has no requirement for probes. It can
accommodate a long fragment, and most importantly it allows melting curve analysis.
A SYBR-Green based real-time PCR scheme was developed to amplify 3 regions of the σC genes of
different ARV strains using three primer pairs, which maximize the coverage of mutation sites. Melting
peak analyses were performed to determine specific melting peak temperature combination profiles for
each ARV strain. This method could differentiate ARVs.
1. Materials and methods
2.1 Avian reovirus strains and sample preparation
The ARVs were S1133, 2408, 1733, CO8, ss412, JR1, and 3005, and two vaccine strains (V.A.
Vac®, and ChickVac™). All North American ARVs belong to the same serotype, however, the CO8
and ss412 belong to a different subtype (Ceva, formerly, Biommune Inc., Lenexa, KS, 2007; Giambrone
and Solano, 1988). V.A. Vac® and ChickVac™ were originally derived from S1133, which is the
standard tenosynovitis challenge virus (Fort Dodge Animal Health, Inc. (Overland Park, KS, 66210).
Trypsin resistant strain JR1 and 3005, derived from Europe, were also provided by Fort Dodge Animal
Health, Inc. Table 1 listed ARV strains and their disease association.
All were propagated in chicken embryo kidney cell culture.
Cells were harvested at 80%~90% CPE,

315. 315
and subsequently concentrated by centrifugation over 40% sucrose density gradient solution for 1.5
hrs at 100,000 xg. Concentrated cell cultures were stored at -70˚C. A negative control contained no
virus.
2.2 Viral RNA extraction
Viral RNAs were extracted using Qiagen RNeasy®
Mini Kit (Valencia, CA) with modifications.
Briefly, 250 µl of concentrated virus-cell suspension was mixed with 3.5 volumes (875 µl) of lysis buffer
RLT and 20 U Proteinase K (Sigma-Aldrich, St. Louis, MO) and incubated at 37˚C for 10 min. 2.5
volumes (625 µl) of cold 100% ethanol was added and mixed well. 700 µl of the mixture was
transferred to a Rneasy column and centrifuged at 9,000 xg for 15 sec, then the flow-through was
discarded. The processes were repeated with the same column till all the mixture was filtered. The
column was washed once with 700 µl of RW1buffer and twice with 500 µl RPE buffer. The column was
transferred to a new 2 ml collection tube and centrifuge at 14,000 xg for 2 min to remove excess regents
in the column filter. Finally, total RNA was eluted in 30 µl of nuclease-free water.
Concentrations were measured using NanoDrop® ND-1000 UV-Vis Spectrophotometer
(Wilmington, DE, 19810). Viral RNAs were diluted to similar concentration (35~40 ng/µl) to minimize
concentration effects of the amplification during real-time RT-PCR.
2.3 Experiment and primer design
Alignment analysis of available nucleotide sequences of σC gene was conducted using Invitrogen
Vector Nti ® v10.3 (Carlsbad, CA, 92008). Three regions (Fig. 1), which cover most mutations, were
selected. Four primer sets were designed to amplify these regions, which resulted in amplicons of 451
bp, 370 bp and 357 bp, respectively, for 5’ region, center region, and the 3’ region (Fig. 1 and Table 2).
Primers were had similar Tm values, so all amplification processes could be conducted under the same
conditions.

316. 316
2.4 Two-step real-time RT-PCR
Reverse transcription (RT) reaction was performed using QuantiTect®
Reverse Transcription Kit
(Qiagen), according to the manufacturer’s instructions with minor adjustments. Extracted RNA was
mixed with 2 µl of 7x gDNA wipeout buffer and nuclease-free water (a total reaction of 14 µl) and
incubated at 42˚C for 2 min to remove contaminating cellular DNA. After incubation, the tube was
chilled on ice. Subsequently, 1 µl of Quantiscript Reverse Transcriptase, 4 µl of 5x Quantiscript RT
buffer and 1µl random hexamer primer were added into each tube, which produced a total reaction of 20
µl. The RT was performed at 42˚C for 15 min on a GeneAmp®
PCR System 9700 thermocycler
(Applied BioSystems, Foster City, CA 94404).
SYBR-Green real-time PCR was performed in Roche LightCycler® (Indianapolis, IN, 46038) v1.5
with LightCycler®
software version 4.05. The 20 µl consisted of 2 µl finished RT reaction and 18 µl of
real-time PCR master mix made from QuantiTect®
SYBR®
Green PCR Kit (Qiagen), including 10 µl of
2x QiantiTect SYBR Green PCR Master Mix, 1 µl of each primer (final concentration of 0.3~0.5 µM)
and 6 µl of nuclease-free water. Real-time PCR was carried out at 95˚C for 15 min to activate HotStart
Taq DNA polymerase, and 50 cycles at 94˚C denaturation for 15 sec, 55˚C annealing for 20 sec and 72˚C
extension for 22 sec. A single fluorescence signal acquisition was set at the end of each extension step.
Melting curve analyses contained 95˚C initial denaturation for 0 sec, 65˚C annealing for 15 sec and
temperature was increased at the ramp rate of 0.1˚C/sec till it reached 95˚C. Real-time PCR was set to
the continuous acquisition mode to record fluorescence signal density change during the temperature
increase.
2. Results
3.1 Real-time RT-PCR amplification

317. 317
Non-specific nature of SYBR-Green binding, non-template controls displayed levels of fluorescent
background. Amplification curves generated by qualitative detection, did not provide sufficient
information in terms of whether the templates were optimally amplified (Figs. 3 and 4). Therefore, all
real-time RT-PCR products were examined with conventional agarose gel electrophoresis in the
preliminary study to optimize PCR conditions.
SYBR-Green real-time PCR optimization
During PCR setup, final concentrations of primers had significant impact on results. Panel A in the
fig. 2 showed melting curves and their corresponding agarose gel. Lowering the primer concentration to
0.3 µM, allowed melting curves to display only one peak (panel B), and desired bands were clearer as
compared to panel A. Beside primers, the concentration of template can also affect melting curve. Low
initial template concentration resulted in low melting temperatures due to insufficient specific
amplification, which failed to generate sufficient signal strength to overcome background (data not
shown).
3.2 The melting peak temperature profiles
All strains at all regions showed mean Tm significantly higher than the negative control of the same
region, indicating valid amplifications (Table 3). All displayed distinct melting peak temperature
combinations from the 3 amplified regions, which presented a profile to differentiate them. Tms of the 3
regions of each strain were regrouped and regions to demonstrate variations among ARVs (Figs. 3 and
4). The CO8, 3005, and ss412 displayed different melting peak temperature profiles, which were 5~8˚C
lower than other strains in some regions. In contrast, differences in mean melting peak temperatures
among other strains were within 2~3˚C.
3.2 Statistical analyses and reproducibility

318. 318
After the optimal PCR conditions were determined, all assays were repeated at least 3 times to obtain
data for statistical analyses. Mean melting peak temperatures and the standard deviations of each region
of each ARV strain were calculated (Table 3). In the 5’ region, the center region and the 3’ region, the
standard deviation ranged from 0.05 to 0.70, 0.03 to 0.62, and 0.02 to 0.42, representing the CV% of
0.06% to 0.85%, 0.04% to 0.78%, and 0.03% to 0.51%, respectively. Data indicated that when the
SYBR-Green I based real-time PCR was optimized, variations between different PCR runs were small
and the refined method had excellent reproducibility.
3. Discussions
Traditionally, ARVs were grouped by CVN (Wood et al., 1980), whereas the genotypical
classification of ARVs were performed using conventional RT-PCR in combination of phylogenetic
analysis and/or other molecular techniques, such as restriction fragment length polymorphism (Lee et al.,
1998; Liu et al., 1999; Wen et al, 2004). However, serological classification of ARVs has not been
successful, because of cross-reactivity of neutralizing antibody. No correlative relationship was found
between genotypes, serotypes and pathotypes, given the detectable genetic differences of different ARV
strains (Kant et al., 2003). Discrepancies between genotypes, serotypes, and pathogenicity suggested the
involvement of multiple genes/proteins in serological and pathogenic determination.
Each ARV had a unique melting peak temperature combination of the three regions. Therefore, it
was possible to identify a particular ARV strain based on its melting peak temperature profile.
After extensive optimization, SYBR-Green real-time PCR resulted in small inter-experimental
variations. Standard deviations and CV% of mean Tms for all targeted regions were within 0.02~0.70
and 0.03%~0.85%, respectively, indicating excellent reproducibility.
Analyzing Tm profiles showed that 3 ARV strains CO8, 3005,
and ss412 were different from the rest

319. 319
than other strains, respectively. Differences indicated that the majority of mutations of CO8 and
3005 were located in the 5’region (between nucleotide 11 and 461) and ss412 in center region and
3’region (between nucleotide 124 and 811). Results were in agreement with CVN, which showed that
CO8 and ss412 belong to their own serological subtypes (BIOMUNE Inc., 2007; Giambrone and Solano,
1988).
A study revealed that European and Taiwanese ARV isolates demonstrated greater genetic variations
in their σC genes (Kant et al., 2003). The Tm profile for 3005 confirmed that it was different from North
American ARV strains.
JR1 appeared similar to other ARVs (except CO8 and ss412). Sequencing of the σC gene revealed
that it had 96.6% similarity on nucleotide sequence with other North American strains. Attempts to
sequence the 3005 σC gene have so far been unsuccessful.
4. Conclusion
SYBR-Green I real-time RT-PCR grouped ARVs based on melting peak temperature profiles of 3
different regions of ARVσ C gene. The assay utilized SYBR-Green chemistry and real-time PCR. It
differentiated closely related ARVs with excellent reproducibility. More isolates need to be tested by this
test and compared to CVN to determine whether it can subtype ARVs.
References
Bains, B. S. and MacKenzie, M., 1974. Reovirus-associated mortality in broiler chickens. Avian Dis. 18,
472-476.
BIOMUNE Inc., 2007. REOMUNE ss412 (Avian Reovirus Vaccine). BIOMUNE Inc., Lenexa, KS,
USA.
Giambrone, J. J. and Solano, W., 1988. Serologic comparison of avian reovirus isolates using virus
neutralization and an enzyme-linked immunosorbent assay. Avian Dis. 32, 678-680.

320. 320
Hieronymus, D. R. K., Villegas, P., and Kleven, S. H., 1983. Identification and serological differentiation
of several reovirus strains isolated from chickens with suspected malabsorption syndrome. Avian
Dis. 27, 246-254.
Kant, A., Balk, F., Born, L., van Roozelaar, D., Heijmans, J., Gielkens, A., and ter Huurne, A., 2003.
Classification of Dutch and German avian reoviruses by sequencing the σC protein. Vet. Rec. 34,
203-212.
Kawamura, H., Shimizu, F., Maeda, M., and Tsubahara, H., 1965. Avian reovirus: Its properties and
serological classification. Natl. Inst. Anim. Hlth. Q. 5, 124
Kerr, K. M. and Olson, N. O., 1969. Pathology of chickens experimentally inoculated or contact-infected
with an arthritis-producing virus. Avian Dis. 13, 729-745.
Lee, L. H., Shien, J. H., and Shieh, H. K., 1998. Detection of avian reovirus RNA and comparison of a
portion of genome segment S3 by polymerase chain reaction and restriction enzyme fragment length
polymorphism. Res. Vet. Sci. 65, 11-15.
Liu, H. J., Chen, J. H., Liao, M. H., Lin, M. Y., and Chang, G. N., 1999. Identification of the σC-
encoded gene of avian reovirus by nested PCR and restriction endonuclease analysis. J. Virol. Meth.
81, 83-90.
Liu, H. J., Lee, L. H., Hsu, H. W., Kuo, L. C., and Liao, M. H., 2003. Molecular evolution of avian
reovirus:: evidence for genetic diversity and reassortment of the S-class genome segments and
multiple cocirculating lineages. Virology. 314, 336-349.
Martinez-Costas, J., Grande, A., Varela, R., Garcia-Martinez, C., and Benavente, J., 1997. Protein
architecture of avian reovirus S1133 and identification of the cell attachment protein. J. Virol. 71,
59-64.
McFerran, J. B., McCracken, R. M., Connor, T. J., and Evans, R. T., 1976. Isolation of viruses from
clinical outbreaks of inclusion body hepatitis. Avian Pathol. 5, 315-324.
Mertens, P., 2004. The dsRNA viruses. Virus Res. 101, 3-13.
Nygren, J., Svanvik, N., and Kubista, M., 1998. The interactions between the fluorescent dye thiazole
orange and DNA. Biopolymers. 46, 39-51.
Page, R. K., Fletcher, O. J., Rowland, G. N., Gaudry, D., and Villegas, P., 1982. Malabsorption
syndrome in broiler chickens. Avian Dis. 26, 618-624.

321. 321
Rekik, M. R., Silim, A., and Bernier, G., 1991. Serological and pathogenic characterization of avian
reoviruses isolated in Quebec. Avian Pathol. 20, 607-617.
Ririe, K. M., Rasmussen, R. P., and Wittwer, C. T., 1997. Product differentiation by analysis of DNA
melting curves during the polymerase chain reaction. Anal. Biochem. 245, 154-160.
Robertson, M. D. and Wilcox, G. E., 1986. Avian reovirus. Vet. Bull. 56, 726-733.
Robertson, M. D., Wilcox, G. E., and Kibenge, F. S. B., 1984. Prevalence of reoviruses in commercial
chickens. Aust. Vet. J. 61, 319-322.
Rosenberger, J. K., Sterner, F. J., Botts, S., Lee, K. P., and Margolin, A., 1989. In vitro and in vivo
characterization of avian reoviruses. I. Pathogenicity and antigenic relatedness of several avian
reovirus isolates. Avian Dis. 33, 535-544.
Takase, K., Nonaka, F., Yamamoto, M., and Yamada, S., 1987. Serological and pathogenetic studies on
avian reoviruses isolated in Japan. Avian Dis. 31, 464-469.
Van der Heide, L., 2000. The history of avian reovirus. Avian Dis. 44, 638-641.
Van der Heide, L. and Page, R. K., 1980. Field experiments with viral arthritis/tenosynovitis vaccination
of breeder chickens. Avian Dis. 24, 493-497.
Vasserman, Y., Eliahoo, D., Hemsani, E., Kass, N., Ayali, G., Pokamunski, S., and Pitcovski, J., 2004.
The influence of reovirus sigma C protein diversity on vaccination efficiency. Avian Dis. 48, 271-
278.
Wen,L. S., Ying, J. L., Hung, Y. S., Hung, J. L., and Long, H. L., 2004. Rapid characterization of avian
reoviruses using phylogenetic analysis, reverse transcription-polymerase chain reaction and
restriction enzyme fragment length polymorphism. Avian Pathol. 33, 171-180.
Wood, G. W., Nicholas, R. A. J., Hebert, C. N., and Thornton, D. H., 1980. Serological comparisons of
avian reoviruses. J. Comp. Pathol. 90, 29-38.

322. 322
Table 1. Disease association of different ARV strains
ARV Strains
Disease association
or characteristics
Literature or origin
S1133 Tenosynovitis (van der Heide and Page, 1980)
2408 Malabsorption/Tenosynovitis (Rosenberger et al., 1989)
1733 Malabsorption/Tenosynovitis (Rosenberger et al., 1989)
CO8 Malabsorption Syndrome (Hieronymus et al., 1983)
JR1 Tenosynovitis, trypsin-resistant European origin
3005 Malabsorption/FHN/BBD European origin
ss412 Malabsorption/proventriculitis (BIOMUNE Inc., 2007)
V.A.Vac®
Tenosynovitis Vaccine (3~8 wks old) Fort Dodge Animal Health, Inc.
ChickVac™ Tenosynovitis Vaccine (1~10 day old) Fort Dodge Animal Health, Inc.
*FHN: Femur head necrosis; BBD: Brittle bone disease
Table 2. SYBR-Green based real-time PCR primer sequences
Primers Sequence Length Positions
5’ region
2408L-F 5’-TCA ATC CAT CGC AGC GAA GAG-3’ 21 11-31
2408L-R 5’-GAC TCC AAT GAT TTA ACA CGA TCC TG -3’ 26 461-436
Center region
2408C-F 5’-GCG TCT ACG GAG TTA TTA CAT CGC T-3’ 25 124-148
2408C-R 5’-AGG CGA AAA AGA TAG ACC ATG AC-3’ 23 493-471
3’ region
2408R-F 5’-TGG AGT CTA CCG CGA GTC A-3’ 19 455-473
2408R-R 5’-TTG GAA TCC CGC ACT GG-3’ 17 811-795

323. 323
Table 3. Statistical analyses of mean melting peak temperatures of the 3 designated regions of
different ARV strains
Strains
5’ region Center region 3’ region
Mean SD CV% Mean SD CV% Mean SD CV%
Negative 70.64 0.30 0.42% 70.34 0.40 0.57% 71.63 0.30 0.42%
S1133 81.81 0.05 0.06% 80.43 0.16 0.20% 82.75 0.25 0.30%
2408 81.43 0.06 0.07% 82.37 0.21 0.25% 82.37 0.15 0.18%
1733 82.18 0.26 0.32% 80.92 0.25 0.31% 79.92 0.14 0.18%
CO8 74.68 0.41 0.55% 81.32 0.42 0.52% 82.85 0.13 0.16%
JR1 81.11 0.35 0.43% 79.85 0.11 0.14% 81.01 0.23 0.28%
3005 75.07 0.42 0.56% 81.89 0.13 0.16% 82.30 0.42 0.51%
ss412 79.98 0.16 0.20% 76.61 0.34 0.44% 74.71 0.02 0.03%
V.A. Vac® 80.45 0.06 0.07% 79.86 0.03 0.04% 82.14 0.09 0.11%
ChickVac™ 82.42 0.70 0.85% 79.94 0.62 0.78% 80.64 0.19 0.24%
Figure 1. Schematic diagram of the experimental design. Three pairs of primers amplified three
regions of ARV 2408 sigma C gene, which covered regions, that contained the most genetic variations.
The 5’ region, center region and the 3’ region resulted in PCR production of 451bp, 370bp and 257bp in
length, respectively.

324. 324
Figure 2. Primer concentrations and their effect on melting curves. A). Primer concentration at 0.5µM; B).
Primer concentration at 0.3µM.
70
72
74
76
78
80
82
84
MeanMeltingPeakTemperature(˚C)
5' region Center 3' region

325. 325
70
72
74
76
78
80
82
84
5' region Center 3' region
MeanMeltingPeakTemperature(˚C)
Negative
S1133
2408
1733
CO8
JR1
3005
ss412
VAVac
ChickVac
Figure 3. Melting peak temperature combination profiles of 3 regions of different ARVs.
Figure 4. Mean melting peak temperatures of ARVs grouped by regions.

326. 326
DNA SEQUENCING
Sequencing of nucleic acids is sometimes necessary to distinguish between organisms which
are so closely related and can not be differentiated using serologic techniques or with PCR-RFLP, or to
provide the necessary genetic information needed to develop recombinant probes and specific primers
for PCR. DNA sequencing is now performed almost exclusively by primed DNA synthesis in the
1 1
presence of 2P
P
,3P
P
-dideoxy-ribonucelosidetriphosphates. This method requires that a primer be
annealed to a template DNA that is single-stranded. This single-stranded template can be inherently
single-stranded DNA, such as that produced by bacteriophage M13, or denatured from a double-
stranded DNA. Therefore, problems can arise when creating a suitable single-stranded template for
sequencing, especially for linear duplex DNA’s, such as with PCR products, where denaturation is
readily reversible. Annealing of the primer is in competition with re-annealing of the template during
the time required to complete the sequencing reactions. Recently a commercial kit was made available
from USB Corp., which makes use of the exonuclease from bacteriophage T7 (gene 6 exonuclease), to
convert the double-stranded DNA to single-stranded DNA.
Another recent development for making single-stranded templates is by asymmetric PCR. This
modified type of PCR utilizes an unequal, or asymmetric, concentration of the two amplification
primers and has thus been termed asymmetric PCR. During the initial 15 to 25 cycles, most of the
product generated is doubled-stranded and accumulates exponentially. As the low-concentration
primer becomes depleted, further cycles generate an excess of one of the two strands, depending on
which of the amplification primers was limited. This single-stranded DNA accumulates linearly and is
complementary to the limiting primer. Typical primer ratios for asymmetric PCR are 50:1 to 100:1.
The single-stranded template can be sequenced with the limiting primer.
A typical procedure for asymmetric PCR is as follows:
1. Assemble the following mixes:
a) Master mix
Sterile HB
2B0 73.5 ul
10x PCR Buffer 10 ul 1x
dATP 0.5 ul 50 uM
dCTP 0.5 ul 50 uM
dGTP 0.5 ul 50 uM
dTTP 0.5 ul 50 uM
MgClB
2B 8.0 ul 2.0 mM
AmpliTaq 0.5 ul 2.5 units
b) Primer 1 1.0 ul 50 pmol
Primer 2 1.0 ul 1 pmol
Template (DNA from PCR)
2.0 ul 1 ng
2. Overlay master mix with 75 ul mineral oil.

327. 327
3. Put primer/template mixture in boiling water for 5 min, transfer immediately on ice and allow
cooling to 37C before adding to master mix.
4. Amplification: 2 min at 95C, [30 sec at 95C, 30 sec at 60C and 1 min at 72C, 30 cycles], 4C.
Note: 1) Final volume of each tube = 100 ul
2) 2nd Asymmetric PCR may be done using the above protocol, but using 50:1 pmol
primer ratio in order to produce single-stranded DNA.
5. The asymmetric PCR product is now ready for sequencing.
Overview of DNA Sequencing Methods
DNA sequencing techniques are based on electrophoretic procedures using high-resolution
denaturing polyacrylamide (sequencing) gels, which are capable of resolving single-stranded
oligonucleotides up to 500 bases in length that differ by a single deoxynucleotide (Figures 5.6 and 5.7).
The practical limit on the amount of information that can be obtained from a set of sequencing
reactions is the resolution of the sequencing gel. Current technology allows 500 nucleotides of
sequence information to be reliably obtained in one set of reactions.
Figure 5.6. DNA sequencing

328. 328
Figure 5.7. DNA sequencing
The two methods that are widely used to determine DNA sequences—the enzymatic dideoxy
method and the chemical method—differ primarily in the technique used to generate the ladder of
oligonucleotides. In the enzymatic dideoxy sequencing method, a DNA polymerase is utilized to
synthesize a labeled, complementary copy of a DNA template. In the chemical sequencing method, a
labeled DNA strand is subjected to a set of base-specific chemical reagents. We will only describe the
enzymatic method.
Dideoxy (Sanger) Sequencing
The dideoxy or enzymatic method (Sanger et al., 1977) utilizes a DNA polymerase to
synthesize a complementary copy of a single-stranded DNA template. DNA polymerases elongate
chains at the 3' end of a primer DNA that is annealed to "template" DNA (Figure 5.7). The synthesis
of the normal nucleotides (deoxynucleoside triphosphates) is replaced by their dideoxy analogues. The
latter are the same as the normal nucleotides, except they lack 3' hydroxyl groups. As a result, when
they become incorporated into a growing DNA chain they act as termination because the end of the
chain no longer has a free 3' hydroxy group and so no other nucleotide can be added.
There are several protocols for dideoxy sequencing. The original dideoxy method, referred to as
the Sanger method, was developed for use with the E. coli DNA polymerase I large fragment, or the
Klenow fragment. In the "labeling/termination" method, developed for use with modified T7 DNA
polymerase (Sequenase), labeling of the primer and termination by incorporation of a
dideoxynucleotide occur in two separate reactions. In the Sanger procedure, the average length of the
sequencing products is controlled by the ddNTP:dNTP ratio, where a higher ratio leads to shorter
products. In the labeling/termination protocol, the average length can be modulated either by the
concentration of dNTPs in the labeling reaction (a higher concentration
leads to longer products) or by the ddNTP:dNTP ratio in the
termination reaction.

329. 329
The labeling/termination method is capable of yielding longer sequencing products, on average,
than those obtained using the original Sanger protocol. Therefore, the labeling/termination method is
advantageous for obtaining the maximum amount of sequence information per template. For applications
where large amounts of sequence information are not needed (such as verifying constructions or
sequencing small regions of DNA), the Sanger procedure is usually adequate. The anger procedure may
be more reliable for obtaining the first few nucleotides of sequence information after the primer.
Dideoxy sequencing requires a single-stranded template to which the primer can anneal. Single-
stranded templates can be easily generated using specialized vectors derived from M13. Dideoxy
sequencing can also be readily carried out using double-stranded DNA if it is first denatured with alkali
or heat. The product of the polymerase chain reaction (PCR) can also be sequenced by the dideoxy
method which we will describe herein.
Radiolabeling of Dideoxy Sequencing Reactions
The dideoxy sequencing protocols involve radiolabeling the nascent DNA chains with 35SdATP
rather than with [32P]dATP since the low-energy emissions of a 35S result in sharper autoradiographic
bands compared to those generated by 32P, allowing more sequence to be read from the upper portion of
the gel. The lower-energy emissions of 35S also cause fewer breaks in the sugar-phosphate backbone of
the DNA, allowing 35S-reaction products to be stored at -20C for several weeks without significant
degradation; 32P0reaction products should be electrophoresed within a day. In addition, users receive a
lower dose with 35S than with 32P.
However, 32 P offers the advantage of short exposure times and is particularly useful in
situations, such as verifying plasmid constructions, where maximizing resolution in the higher region of
the sequencing gel is not a priority. Recently, the use of a new labeled nucleotide analog [33P]dATP in
sequencing reactions has been described. 32P has a maximum 0-emmision energy that is 50% stronger
than 35S, but fivefold weaker than 32P. Sequences generates using 33PdATP have short exposure times
like 32P, but have band resolution comparable to 35S.
5’end labeling: An alternative to labeling the nascent oligonucleotide with 35SdATP is to use a
5’-end-labeled primer generated by T4 polynucleotide kinase and 33PATP of 35SATP

330. 330
Cycle Sequencing
Sequencing has only become practical for diagnostic purposes with the introduction of the PCR
for amplifying the gene, automated techniques for performing the sequencing reaction (e.g. cycle
sequencing), and computer programs to increase the accuracy and speed of the sequences analysis.
Commercial kits eliminate the need to assemble numerous mixes and can save a significant amount of
startup time, although they are somewhat less flexible and can limit the ability to troubleshoot reactions.
Two procedures from commercial kits made by Promega, Co (Madison, WI) and Epicentre
Technologies (Madison, WI) are being outlined here. They both utilize the newly emerging thermal
cycle sequencing technology. This procedure does not require single-stranded DNA templates, so
DNAs such as cosmids, PCR products and double stranded plasmids can be directly sequenced without
sub-cloning into M13 or phagemid vectors.
Unlike conventional sequencing protocols, cycle sequencing utilizes a thermostable DNApolymerase and
multiple rounds of high-temperature DNA synthesis. A small number of template DNA molecules are
repetitively utilized to generate a sequencing ladder from each template/primer combination. Each
reaction contains a base-specific, chain-terminating dideoxynucleotide (i.e., ddATP, ddCTP, ddGTP, or
ddTTP) as well as a primer that is end-labeled with P or P can be incorporated in to the growing chains,
the dideoxy sequencing reaction mixture is subjected to repeated rounds of denaturation annealing and
synthesis steps in a thermal cycling machine, similar to PCR. The resulting radiolabeled DNA prodcuts
are then loaded in adjacent lanes of a polyacrylamide/urea gel. After electrophoresis, the gel is exposed
to x-ray film, creating an image of four “ladders” of DNA molecules ending in G, A, T or C from which
the DNA sequence can be determined.
Sequencing Reaction using fmol DNA Sequencing Kit from Promega, Co.
I. Primer Radiolabeling Reaction
1. Combine the following in a tube:
Primer 1 ul 10 pmol
[PP]ATP 5 ul 10 pmol
P. kinase buffer 1 ul
P. kinase 1 ul 5 units
Sterile HB
2BO 2 ul
2. Incubate at 37C for 30 min and then inactivate the kinase at 90C for 2 min.
3. Briefly spin in a microcentrifuge to collect any condensation. The end-labeled primers may
be stored at -20C for as long as a month.
II. Extension/Termination Reactions
1. Label four 0.5ml tubes (G, A, T, C). Add 2ul of the appropriate d/ddNTP Mix to each tube.
Cap the tubes and store on ice or at 4C until needed.
2. Mix the following in a tube:

331. 331
P
P
32
32
Template DNA 2 ul * 4 - 40 fmol
Seq. 5x buffer 5 ul
Labeled primer 1.5 ul 1.5 pmol
Sterile HB
2BO 7.5 ul
3. Add 1.0 ul of Taq Polymerase (5 u/ ul) to the primer/template mix. Mix briefly by pipetting
up and down.
4. Add 4 ul of the enzyme/primer/template mix from step II.3 to the inside wall of each tube
containing d/ddNTP Mix.
5. Add one drop of mineral oil to each tube and spin briefly.
6. Place the reaction tubes in a thermal cycler programmed as follows: 2 min at 95C, [30 sec
at 95C, 30 sec at 60C and 1 min at 72C, 30 cycles], 4C.
7. After the thermocycling program has been completed, add 3ul of Stop solution to the inside
wall of each tube. Spin briefly.
8. Heat the reactions at 70C for 2 min immediately before loading on a sequencing gel.
Sequencing using Sequitherm Cycle Sequencing Kit
from Epicentre Technologies
A new kit from Epicentre Technologies (1202 Ann Street, Madison, WI 53713) has been developed for
direct sequencing of double stranded PCR amplified DNA. The starting material is double stranded RNA
of infectious Bursal Disease Virus isolated from chickens. cDNA is made and amplified using the Gene
Amp RNA PCR®Kit from Perkin Elmer Cetus as previously described. The amplified cDNA is purified
using three different purification procedures such as Magic PCR Prep® procedure from Promega, Inc.,
Ultra free- MC 30,000 NMWL filter units (Millipore Corp., Bedford, MA) and Gelase Agaraose Gel-
Digesting Preparation (Epicenter Technologies, Madison, WI) as described previously. The purified
cDNA is then used as a template for the sequencing reactions as described below.
I. Primer radiolabelling reaction
1. Thaw the following reagents on ice and combine the stated amounts in a 0.5-ml
microcentrifuge tube.
Gama P
P— 0.5 ul (y-PPP) ATP (80 Ci; 12 pmol).
— 12 pmol primer (e.g., 1 l of the M 13 24-mer Forward Primer supplied with the
kit at 12.6 pmol/ l.)
— 1 l (1 unit) of T4 polynucleotide kinase (PNK).
— deionized HB
2BO to a final volume of 25 l.
Gama P
P
-- 3 ul (yPPP) ATP (3O ul; 30 pmole)-- 30 pmole primer
-- 1.5 ul 10XPNK buffer

332. 332
-- 1 ul T4 polymerase kinase
-- dd HB
2BO to a final vol. of 15 ul
2. Incubate 30 minutes at 37C.
3. Inactivate the PNK by incubating 5 minutes at 70C.
End-labeled primers can now be used in the cycle sequencing protocol (Figure 5.8). It is not
necessary to separate unincorporated nucleotides from the labeled primer prior to use in SequiTherm
Reactions. Primers should be stored at -20C or at 4C if they contain a special buffer as the Ready
R 32
ViewP
P
from Amersham, Inc. They may be used for up to two weeks after labeling with P32PPPPPPP32P or one
month with 34P
Figure 5.8. IBDV Partial Sequence of Vp2 gene

333. 333
32
32
I. Extension/Termination Reactions
1. Thaw the reagents listed in step 2 on ice.
2. Combine the following components in a 0.5-ml microcentrifuge tube labeled "Premix."— 1.5
pmol (PPP)-labeled primer 12 pmol (PPP) labeled primer.
— 2.5 l 10X sequencing buffer.
32 33
— 5-50 pmol of IBDV-cDNA template when using P
— deionized HB
2BO to 16 l.
PP or 200-400 pmole when usingP
P
P.
— l (5 units) SequiTherm Thermostable DNA Polymerase.
3. For each template, label four 0.5—ml microcentrifuge tubes with G, A, T or C and place on
ice. Then add:
— 2 l of G Termination Mix (contains ddGTP) to the G tube.
— 2 l of A Termination Mix (contains ddATP) to the A tube.
— 2 l of T Termination Mix (contains ddTTP) to the T tube.
— 2 l of C Termination Mix (contains ddCTP) to the C tube.
4. On ice, add 4 l of the premix to each of the four tubes.
5. Overlay each reaction with 10 l mineral oil.
6. Pre-heat thermocycler to 95C.
7. Heat the reactions for 5 minutes at 95C.
8. *Cycle the reactions 30X for:
— 30 sec. at 95C;
— 1 min. at 70C.
9. Add 3 l Stop solution to each reaction.
11. Spin tubes briefly in a microcentrifuge to separate the mineral oil from the reaction.
12. Heat tubes 5 min. at 70C.
13. Load 1 — 2 l/well on sequencing gel.
At 6% to 8% polyacrylamide/8 M urea gel is suitable for most purposes. By using multiple
loadings, lower percentage gels, modified acrylamide mixes (e.g., LongRanger™
Concentrate from AT Biochem), and/or longer gel plates, researchers should be able to get
500 bases or more of unambiguous data from a single primer with SequiTherm.
* A 30-second annealing step should be included between the 95C denaturation and 70C
synthesis steps for primers shorter than 20 bases or with less than 50% GC-content.
EPICENTRE recommends a TB
annealingB of 50C for initial experiments. For more information,
see "Sequencing Primers" and "Calculating TB
mB".

334. 334
Sequencing Gel Hydrolink
(AT Biochem, Inc.)
I. Gel Preparation and Pouring
1. Clean glass plates with ethanol then wipe dry.
2. Siliconize (occasionally) one plate then clean again with ethanol.
3. Assemble glass plates with the side and bottom spacers. Clamp and tape sides and bottom
of cassette.
4. Assemble the following in a 250ml beaker:
Urea 42 g
20x TBE 6 ml
Long Ranger (conc.) 10 ml
DD HB
2BO fill to 90 ml
5. Mix until urea is in solution. Filter through Whatman No. 1 filter paper.
6. Fill gel solution to 100 ml with deionized water.
7. Add 50ul TEMED and 500ul 10% APS.
8. Swirl the solution gently and slowly add gel solution along one side of the plates with a
50ml syringe.
9. After filling, lay the plates on a flat surface and insert the flat edge of the comb to a depth
of 2 to 3mm below the short plate. Clamp the comb in place to prevent gel from forming
between the comb and plate. Polymerization should take place within 30 - 40 min.
10. Wash and clean the gel cassette with distilled water. Remove comb, tapes and clamps.
Mount the gel cassette on the sequencing apparatus.
II. Electrophoresis
1. Prepare 1L of 0.5x TBE. Fill upper and lower tanks with running buffer.
2. Rinse the top of the gel with running buffer by squirting with the aid of syringe and needle.
Insert back the comb with the teeth down toward the gel. Insert the comb until it just makes
contact with the surface of the gel, but do not allow the teeth to pierce the gel surface.

335. 335
3. Prerun the gel for 10 - 30 min at constant current of 40 - 50 watts or 1,500 - 1,900 volts.
4. Prepare the DNA samples by heating at 70C for 2 min. Wash each well with buffer before
loading 1- 3ul of the sample.
5. Connect power supply and electrophorese at the pre-running settings for 1½ - 2 hours.
Multiple sample loading may be done as desired.
6. Once the electrophoresis has been completed, disconnect the power supply and remove the
glass plates.
7. Cool for 5 - 10 min prior to separating the plates. Fix the gel in 20% methanol and 10%
acetic acid for 10 - 20 min.
8. Remove the gel on plate from the fixing solution. Pour off as much solution as possible.
9. Transfer the gel onto Whatman 3MM paper by firmly pressing onto the gel surface, flip the
glass plate over and slowly lift it from the paper.
10. Place the paper on a flat surface with gel side up and cover with ATP gel drier sheets.
11. Dry the gel under vacuum at 80C for 30 - 60 min.
III. Autoradiography
1. Remove the gel drier sheet and place the dried gel in the autoradiogram cassette.
2. In the dark, put a Kodak XAR - film on top of the gel. Expose for 10 - 20 hours.
IV. Reading and Analysis of Sequencing Data.
The nucleotide sequence of a portion of the VP2 gene of IBDV is derived by reading the
autoradiograph of the sequencing gel (Figure 5.8) either manually (Figure 5.10) or by using a computer
software package such as the DNA Proscan Pro-Seq (PO Box 121585, Nashville, TN 37212). This
program magnifies the image of the bands and enhances their contrast. It also provides a predictor bar
to aid in the identification of the next band to be entered and stores the gel image for side by side
comparisons to the sequence. After the sequences are coupled, they are entered into another software
package such as the PC/GENE Software Package (Intelligenetics, Inc., Mountain View, CA 94040) for
further analysis. This program, among other things, can perform a restriction enzyme analysis, translate,
predict secondary structures and antigenic sites, sequence comparisons, and alignments.
Once you have the sequence of several different strains of the same organisms, you can use a
computer and special software programs to translate the nucleic acid sequences into amino acid
sequences and then compare the % related of the organisms. Figure 5.9 compares the relatedness of
IBDV.

336. 336
Figure 5.9. Dendrogram of alignment of IBDV Vp2 gene
Once the % relatedness of viruses has been determined the computer can be utilized to produce a
dendrogram. A dendrogram is a diagram which groups organisms according to their sequences and
provides information as to the possible evolution of the organisms (Figure 5.90).
Figure 5.10. Manual reading of DNA sequences

337. 337
References
Ausubel, F.M., R. Brent, R.E. Kingston, D.D. More, J.G. Seidman, J.A. Smith and K. Struhl, 1992.
"DNA Sequencing." In Short Protocols in Molecular Biology. Green Publishing Associates
and John Wiley and Sons, N.Y., N.Y. pp. 7-1 to 7-11.
Innes, M.A., D.H. Gelfand, J.J. Sninsky and T.J. White, 1990. "Optimization of PCR," "Amplification
of RNA" and "Production of Single-Stranded DNA by Asymmetric PCR." In PCR Protocols:
A Guide to Methods and Applications. Academic Press, Inc., N.Y., N.Y. pp. 3-12, 21-27, 76-
84.
Jackwood, M.W., 1992. "Introduction to the Polymerase Chain Reaction." In Improved Diagnosis of
th
Avian Diseases Using Molecular Biology. 129P
Aug. 1992. pp 23-25.
P
Am. Vet. Med. Assoc. Meeting. Boston, MA.
Liu, Hung-Jen, J.J. Giambrone, and T. Dormitorio, 1993. Detection of genetic variations in Serotype I
isolates of infectious bursal disease virus using polymerase chain reaction. J. Virol. Methods
48:281-291.
Sambrook, J., E.F. Fritsch and T. Maniatis, 1989. "DNA Sequencing" and "In Vitro Amplification of
DNA by the Polymerase Chain Reaction." In Molecular Cloning: A Laboratory method. Cold
Spring Harbor Laboratory Press. N.Y., N.Y. pp. 13.3-13.10, 14.6-14.34.
Sanger, F., J.E. Donelson, A.R. Coulson, H. Kossel, and D. Fisher, 1973. Use of DNA polymerase I
primed by Synthetic oligonucleotide to determine a nucleotide sequence in phage f1 DNA.
Proc. Nat1. Acad. Sci. 70:1209.
Table of Contents

338. 338
Microarray Analysis
Is used for the identification of specific viruses or specific viral sequences.
The development of microarrays has been fueled by the application of robotic technology to routine
molecular biology, rather than by any fundamental breakthrough. Southern and Northern blotting
techniques for the detection of specific DNA and mRNA species provided the technological basis for
microarray hybridization.
The construction of microarrays involves the spotting of specific DNA sequences on a glass slide or
silica chip via robotics. The glass slide may contain up to 50,000 genes. The slides are then exposed to
fluorescently labeled source DNA. A computer monitors fluorescence on the slide, indicating where the
labeled DNA has bound to a DNA sequence on the slide.
As many DNA sequences can be present on a slide, it is possible for microarray analysis to test for
multiple pathogens simultaneously. This is particularly important for bio-weapons detection and
disease diagnosis. Several microarrays are commercially available, such as the CapitalBio_
SARSarrayTM-1.8 Detection System for identifying early stage infection by the SARS virus. In
addition to nucleic acid microarrays, protein microarray analysis is also being performed. In this case,
one is looking for the presence of a particular protein.
Table of contents

339. 339
B. Proteins
Introduction
Fractionization of proteins from organisms in polyacrylamide gels is a common means for
differentiation, because of its speed and ease of use. The most widely use technique for separating
proteins is by sodium dodecyl sulfate polyacrylamide denaturing gel electrophoresis (SDS-PAGE).
http://www.genome.gov/page.cfm?pageID=10000552

340. 340
http://www.garlandscience.com/ECB/about.html
Published by Garland Publishing, a member of the Taylor & Francis Group.

341. 341
Protein Structure
SDS-PAGE separates proteins in a complex mixture on the basis of molecular weight. First, the
protein is denatured in the presence of SDS and a reducing agent, usually -mercaptoethanol. The SDS
coats the protein(s) giving it a negative charge. The protein(s) separate by charge when run on the gel.
Sharp banding of the protein(s) is achieved by using a discontinuous gel system which has stacking
and separating gel layers can differ in salt concentration, pH, and/or acrylamide concentration.
SDS PAGE can also be used for fractionation of protein mixtures prior to immunoblotting
(Western blots), which will be described later herein. Two formats of gels can be used, minigels and
large gels. Table 1.0 provides characteristics of each type.
Table 1.0 Characteristics of Minigels and Large Format Gels.
Gel Format Sample capacity Run times Load
volumes
General Uses
Minigels 4 g/band, but 1 hour 10 l analytical and
(7 x 10cm) resolution suffers (100 V until dye some preparative
front reaches fractionation
separating gel, techniques
then 200V)
Large gels 20 g/band 4 hours 25 l analytical
(16 x 16cm) (75V until dye
front reaches
separating and
isolation of
separating gel, large amounts
then 150V) of denatured
proteins
Remember always wear gloves, since acrylamide is a neurotoxin. Stacking gel length should be
1 cm from the well bottom to top of separating gel. Gels may be placed in a moistened paper towel and
plastic wrap and stored at 4C for a week prior to use. Use fresh ammonium persulfate and high quality
acrylamide. Prepare clean plates prior to mixing acrylamide and work fast.
The following contains a common procedure for SDS-PAGE using the Bio Rad Mini Protean II
gel system from Bio Rad, Inc., Richmond, California.

342. 342
SDS-PAGE Electrophoresis
BIORAD Mini-Protean II
I. Assembling the plates
1) Clean glass plates with alcohol
2) Lay longer plate down, place two spacers, then apply a shorter plate.
3) Loosen four screws on clamp assembly screws facing away from you.
4) Firmly grasp plate sandwich with longer plate facing away—gently slide into clamp
assembly, tighten top screws.
5) Recheck that plates and spacers are set flush against casting stand base.
6) Transfer the clamp assembly to the casting stand.
II. Casting gels
1) Prepare fresh ammonium persulfate every time.
2) Prepare separating gel 10% 7.5%
Combine: Distilled water 5.5 ml 4.85 ml
1.5M Tris-HCl 3.75ml 2.5 ml
10% SDS 150ul 100ul
30% Acrylamide/BIS 5.0 ml 2.5 ml
Degas solution for 15 min at room temperature using a vacuum pump.
3) Place a well forming comb completely into the assembled gel sandwich. With a marker
pen, place a mark on the plate 1 cm below the teeth of the comb. This will be the level to
which the separating gel is poured. Remove the comb.
4) Add 75ul 10%APS and 10ul TEMED to the deairated monomer solution and pour the
solution to the mark, using a 10cc syringe on angle.
5) Immediately overlay the monomer solution with water-butanol mixture (25% isoamyl
butanol).
6) Allow gel to polymerize for 1 hour.
7) 45 min later make stacking gel (4.5%).

343. 343
Combine: Distilled water 3.55ml
0.5M Tris-HCl, pH6.8 0.625ml
10% SDS 50 ul
30% acrylamide/Bis 0.75ml
Degas for 15 min at room temperature. Gel can be stored at 4C overnight.
8) Remove alcohol and rinse completely with distilled water. Dry the area above the
separating gel with filter paper before pouring the stacking gel.
9) Place a well forming comb in the gel sandwich.
10) Add 25ul 10%APS and 10ul TEMED, swirl gently to mix. Pour the solution until all the
teeth have been covered. Then properly align the comb and add monomer to fill
completely.
11) Allow gel to polymerize for 45 min. Remove comb by pulling it straight up slowly and
gently.
12) Rinse the wells completely with distilled water.
III. Assembling the upper buffer chamber
1) Release the clamp assemblies/gel sandwiches from the casting stand.
2) Lay the inner cooling core down flat on the bench. With the glass plates of the clamp
assembly facing the cooling core, carefully slide the clamp assembly wedges underneath
the locator slots on the inner cooling core until the inner glass plate of the gel sandwich
butts up against the notch in the U shaped gasket. Add buffer to rubber seals for better
contact.
3) Turn over the inner cooling core and attach another clamp assembly to the other side of the
core in the same manner.
IV. Preparing samples
This depends on the organism being used. For mycoplasma and bacteria whole cell samples, l
ng of protein can be diluted in 1 ml of loading buffer containing 2 to 10% SDS; 0.5 m Tris-HCl (pH
6.8), 10% glycerol, 5% 2-B mercaptoethanol; and 0.05% bromophenol blue. They are boiled for 5
minutes and electrophoresed in 1.5 mm thick 8% gels. For viruses such as IBDV, virions can be
pelleted by ultra centrifugation through sucrose cushions and added to the same sample buffer at 1 mg
protein/ml of buffer. For IBDV we use a 3% stacking and 12.5% separating gel. Molecular weight
standards should be added depending of the size of the sample proteins. Markers with different color
tracking dyes containing egg albumin, bovine albumin, glyceraldhyde-3-phosphate dehydrogenase,
carbonic anhydrase, trysinogen, trypsin inhibitor, and -lactalbumin are available. Biorad Lab sells a
Kaleidoscope Prestained Molecular Standard® from 8,800 to 219,000 daltons.

344. 344
V. Loading samples
1) Prepare running buffer by combining 60ml of 5x buffer with 240 ml of distilled water.
Store in freezer for 10 min prior to use.
Running buffer for the tank consists of:
Tris base 3.0 g pH 8.3
Glycine 14.4 g
SDS 10% 10.0 ml
DHB
2BO to 1,000 ml
2) Add buffer to wells, wash and remove.
3) Add approximately 115 ml of buffer to the upper buffer chamber. Fill until the buffer
reaches a level halfway between the short and long plates.
4) Pour the remainder of the buffer into the lower buffer chamber so that at least the bottom 1
cm of the gel is covered. Remove any air bubbles from the bottom of the gel by swirling the
lower buffer chamber with a pipette.
5) Load the samples and standards into the wells.
6) Run for 2 ½ hours at 72 volts.
VI. Removing the gel
1) Remove the cell lid and carefully pull the inner cooling core out of the lower chamber.
Pour off the upper buffer.
2) Lay the inner cooling core on its side. Push down on both sides of the cooling core latch and
up on the clamps until the clamp assembly is released. Slide the clamp assembly away from
the cooling core.
3) Loosen all four screws and remove glass plate.
4) Push one of the spacers out to the side of the plates without removing it.
5) Gently twist the spacer so that the upper plate pulls away from the gel. Remove gel gently.

345. 345
VII. Staining the gel
Gels can be stained with Coomassie blue R-250 (Serva Fine Biochemical, Inc., Westburg, NY)
in fixative solution for 1 hour and destained for 3 hr with fixative for molecular weight determinations.
Gels can be air dried under vacuum and photographed.
Immunoblotting
Antibodies can be used to detect proteins which are part of pathogenic microbes structure.
These antibodies are highly specific and form the core of rapid, sensitive tests for the detective and
differentiation of closely related organisms. Convention serologic assays such as ELISA, VN, AGP
and FA tests have been previously discussed. This section will discuss immunoblotting. Two
common immuno blott techniques include the Western blot and dot blot. In these tests, proteins are
immunobilized on membranes and then incubated with labeled antibodies for color detection.
In Western blots, proteins are first separated by electrophoresis in gels, as previously described,
and then transferred to a membrane; whereas for dot blots, nondenatured protein containing samples
are spotted directly on a membrane. After the transfer the following steps are used to detect the
presence of the antigens (Figure 1.0).
Blocking of protein binding sites
Binding the primary antibody
Washing to remove unbound primary antibody
Binding the anti-Ig-G conjugate which is labeled
Washing to remove unbound conjugate
Detection by Calorimetric reaction
Figure 1.0. Basic Steps in Immunodetection
Detection procedures usually take 3 hours. Nitrocellulose membranes are most often used for
Western and dot blots. Western transfer can be accomplished by electroelution (most common) from
acralymide gels using commercial devices or by passive diffusion using capillary type devices
previously described for nucleic acid transfer. With dot blots the samples can be transferred by
vacuum filtration using commercial devices or spotting 1 ul amounts on moistened membranes.
Western transfers require special buffers for antigen transfer. They most commonly use Tris-
HCl, glycine, methanol and SDS. Transfer efficiency can be monitored by staining the gel after
transfer to monitor the absence or diminishing of protein bands. A section of the gel can be stained
and cut prior to transfer and the staining of this section of the gel compared to the remaining section of
the gel after transfer and staining. The gel used for transfer can be stained with 0.1% amido black in

346. 346
20% methanol, 10% acetic acid or Ponceau S. Stain for 1 minute, destain in the same solution without
dye (india ink, amido black or Ponceau).
If the Western transfer efficiency is low, try longer transfer or higher transfer voltages. After
transfer, membranes can be wrapped in plastic and store moist at 4C. SDS (0.1%) in the transfer
buffer may improve transfer efficiency of large proteins and methanol improves binding of smaller
proteins to membranes. Insufficient contact between the gel and the membrane caused by air bubbles
may impede protein transfers.
Blocking, antibody incubation, and washing steps are commonly performed in buffered saline
solutions. In the blocking steps, the solution contains an agent to bind nonspecific receptor sites
present on the membrane. Washing solutions remove unbound antibody. Common solutions include
TBS and PBST. Common blocking agents include BSA (bovine serum albumin), gelatin or case in at
1% in TBS or PBST.
The antibody used will have a great impact on the sensitivity of a blotting system. The antibody
source will determine the type of second antibody to use and detection means. A variety of methods can
be used to produce antibodies in mice. Table 1.0 lists common methods for production of polyclonal
antibody.
Table 1.0. Common Polyclonal Antibody sources.
Animal Amount per Injection # Injections Amount of sera Typical sample bleed (serum)
Mice 5-50ug 3-4 2ml 100-200ul
Rabbits 50-1000ug 3-4 200ml 10ml
Chickens 50-1000ug 3 50ml 50ml
Rats 10-500ug 3-4 10ml 1ml
Another choice to be made is whether to use monoclonal or polyclonal antibodies in doing the
test. Table 1.1 lists the advantages and disadvantages for each type of antibody.

347. 347
Table 1.1. Monoclonal vs Polyclonal Antibodies.
Monoclonals Polyclonals
Specific for epitope Possible cross-reactivity
Possible low affinity Large population of affinities and epitope specificities
May be difficult to produce desired
antibody
Relatively fast to produce
Time-consuming to produce Limited quantities
Quantities theoretically unlimited Inexpensive
Expensive
Maybe difficult to reproduce antibodies from some
antigens
Can use impure antigens to produce
http://www.garlandscience.com/ECB/about.html
Published by Garland Publishing, a member of the Taylor & Francis Group.

348. 348
I
Before an optimum amount of primary and secondary antibody can be determined for the
immunoblotting technique one must perform a checker board titration whose various dilutions of each
are used. These will result in the precise dilution of antibody to maximize sensitivity and minimize
background. Table 1.2 shows recommended antibody dilution ranges to try in a typical test.
Table 1.2 Recommended Antibody Dilution Ranges.
Sera Ascities fluids
and purified antibodies
Hybridoma tissue culture
fluids (monoclonals)
Second antibody
Conjugates
1:200 to 1:10,000
1:10 to 1:100
(1:1,000 to 1:5,000)
Common detection methods for immune blots include radiolabeled iodine and
calorimetric labels. Due to the hazards of radioactivity calorimetric, reactions using reporter enzymes
such as alkaline phosphatase (AP) or horseradish peroxidase (HRP) are becoming popular. The levels
of sensitivity of each system are listed in Table 1.3. The basis for the immunodetection using enzyme,
substrate and color reactant are essentially the same as for the previously discussed ELISA and need
not be discussed herein.
Table 1.3. Sensitivity of Various Detection Systems (24)
Methods of Detection Dot Blot Western Blot
125P
P
1ng 10ng
Alkaline Phosphatase
NBT/BCIP 5pg 25-50pg
Western Blue Substrate 5pg 25-50pg
Horseradish Peroxidase
4-Chloro-1-Naphthol 100pg 1ng
TMB Stabilized Substrate 25pg 100pg

349. 349
st
A typical setup for an immunodot blot is as follows:
Blot Detection
Biorad Immun-Blot Assay
1. Apply 5ul of antigen to the membrane by dot blotting through a microfiltration blotting
apparatus. Antigen concentrations of 1 mg/ml are normally used.
2. Wash membranes in TBS for 5 - 10 min at room temperature.
3. Immerse membrane into blocking solution. Gently agitate the solution using shaker platform,
for 30 min to 1 hour.
4. Remove the membrane from the blocking solution and transfer to a dish containing TTBS.
Wash for 5 min twice.
st
5. Transfer the membrane from the TTBS to a dish containing 1P
monoclonal 1/20 dilution). Incubate for 30 min to 1 hour.
P
antibody solution (for IBDV-
6. Remove the unbound 1P
P
antibody by washing twice with TTBS for 5 min. Repeat.
7. Dilute blotting grade second antibody HRP or AP conjugate 1:3000 by adding 33ul to 100 ml
antibody buffer. Dilute avoiding AP or HRP conjugate (for biotinylated standards detection)
nd
1:3000 by adding 33ul to the same solution. Remove the wash solution and add the 2P
P
antibody solution. Incubate 1 hour with gentle agitation.
8. Remove the conjugate solution. Wash the membrane for 5 min in TTBS. Repeat.
9. Wash in 100 ml TBS for 5 minutes. Repeat.
10. Prepare color development solution immediately before use.
11. Immerse the membrane in the color development solution. Allow the color development
to proceed (30 min) until all the bands are detected.
12. Stop the development by immersing the membrane in distilled water for 10 min.
13. Take a photo of the membrane because color will fade with time.
Figure 1.1 shows the two dimensional structure of a chicken IgG molecule. Antibodies are produced
when a foreign substance–the antigen–comes into contact with B cells, which reside in the lymph
nodes and spleen. Even before contact with an antigen, each of the resting B cells makes
immunoglobulin proteins but does not secrete them. Rather, the immunoglobulin molecules are
inserted into the B cell membranes and are used as antigen receptors. These receptors can signal the

350. 350
cell to divide and further differentiate when they bind antigens. Each B cell makes an antibody that
recognizes one and only one antigenic shape. Therefore, an antibody recognizing the protein shell of
poliovirus would not be expected to recognize cholera toxin, E. coli membranes, or zebra dander.
All antibody proteins on the B cell membrane have a very similar structure. Each consists of two pairs
of polypeptide subunits. There are two identical heavy chains and two identical light chains; the chains
are linked together by disulfide bonds (Figure 1.1). The specificity of the antibody molecule (i.e.,
whether it will bind to a poliovirus, an E. coli cell, or some other molecule) is determined by the amino
acid sequence of the variable region. This region is made up of the amino-terminal ends of the heavy
and light chains. The variable regions of the antibody molecules are attached to constant regions that
give the antibody its effector properties needed for inactivating the antigen.
The variable domain of the light chain is responsible for binding to antigen. Figure 1.2 shows how B
and T-cells interact to form antibody and cytotoxic lymphocytes. Figure 1.3 shows an immunodot blott
for determining the specificity of mouse monoclonal antibodies (MABs).
Figure 1.1. Antibody molecule Figure 1.2. Antibody production

351. 351
Figure 1.3. Dot Immunoblott of IBDV proteins using various MABs
Western Blotting
http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html
MiniTrans Blot
Biorad Apparatus
I. Preparing the Chamber
1. Prepare buffer and refrigerate. Buffer temperature should be 4 C at start of transfer.*
Trizma base 25 mM 3.03 g
Glycine 192 mM 14.40 g
Methanol v/v 20% 200 ml

352. 352
Water to 1,000ml total
2. Equilibrate the previously electrophoresed gels in transfer buffer for 15 min. Protein
samples are denatured and separated in a polyacrylamide gel as previously described in this
chapter.
3. Cut the membrane to the dimensions of the gel. Label to identify gel and orientation of
membrane. Wet the membrane by slowly adding it at a 4 deg angle into transfer buffer and
soak for 15 - 30 min.
4. Completely saturate filter paper and fiber pads by soaking in transfer buffer.
5. Install electrode in buffer chamber. Fill buffer tank half-full with transfer buffer (400 ml)
and install a 1-inch stir bar at bottom.
6. Install frozen cooling unit in chamber, next to electrode.*
*Trans blot must be done with cooling because of the high heat generated during the
electrophoretic transfer.
II. Assembling gel holder cassette** (Figures 1.4, 1.5, and 1.6)
Clear —(+)
gray —(-)
**always insert gel cassette so that the gray plastic faces the gray plastic of the cathode
electrode
1. Place the opened gel holder in glass dish — gray panel is flat on the bottom of the vessel.
2. Place a pre-soaked fiber pad on the gray panel of cassette, and then filter paper, then gel
(make sure no air bubbles are trapped between gel and filter paper).
3. Flood the surface of the gel with buffer and lower the pre-wetted membrane on top of gel.
Hold membrane at opposite ends — center portion will contact the gel first. Gradually
lower the ends. Roll a test tube over the top of membrane.
4. Flood the surface of membrane with buffer.
5. Complete the sandwich with filter paper, filter pad and then close the cassette.
6. Place gel holder in buffer tank. Gray panel of holder is facing the gray cathode electrode
panel.
7. Set tank on top of magnetic stirrer.

353. 353
8. Fill the tank with buffer to just above the level of the top row of circles on the gel holder
cassette. (Do not overfill)
9. Run at 100 volts for 1 hour (milliamps - 200 - 250)
10. Stain gel in Coomassie blue for 1 hr and destain for 1-3 hrs. Destaining solution 40%
methanol + 10% acetic acid.
11. Place nitrocellulose in transfer buffer. Store overnight in refrigerator or start the
Immunodetection process after 10 minutes of incubation.
Poured PAGE
Figure 1.4. Washing out wells of gel

354. 354
Figure 1.5. Removing agar from loading well.
Figure 1.6. Electrophoretic separation of proteins

355. 355
Avian Influenza
J.J. J.J. GGiiamambrbroonene11 anandd FF.. JJ.. HoHoeerrrr22
ltrtryy ScienScienccee DepDepaartrtmmeent,nt, AAuubbuurrnn UUnniivverersisittyy anandd
babammaa StateState VeteriVeterinnaaryry DiaDiaggnonosstticic
AlAlababamamaa AgrAgriiculculttuurree aanndd IInnduduststrriieess,,
AuAububurn,rn, AlAl 3366848499
Avian Influenza
Transfer of PAGE proteins to nitrocellulose membrane
Coomasse stain of PAGE. Top gel is before transfer and bottom is after. Middle well contains
molecular weight marker and right well contain APHIS IBDV

356. 356
III.Immunoblot Detection
1. Transfer the nitrocellulose to a blocking solution of 3% gelatin in TBS buffer for 30 minutes.
Membranes can be cut into strips and reacted with negative and positive antibody.
2. If polyclonal antibody is used, membranes are reacted with primer, or antibody prepared in
chickens against the organism in question at room temperature for 3 hours. If MAB is used as
the primary antibody, appropriate MAB containing hybridoma antibody is added and incubated
in a shaking platform for 3 hours. The amount and dilution of primary and secondary antibody
will depend on previously run checker board titrations using the Immunoblott procedure.
3. The membranes are then washed three times for 5 minutes each time with TBS — Tween 20
and then incubated by the secondary antibody (anti-chicken or anti-mouse IgG) HRP or AP
conjugated from BioRad, Inc.; Vector, Burlingame, CA; or Capeel Laboratories, Cochranville,
PA, for 1 hour.
4. The membranes are washed as before and then allowed to be visualized after addition of color
reactant (4-chloro-1-naphthol and HB
2BOB
2B for HRP or conjugate NPT/BCIP for AP conjugate).
5. Membranes should be reacted with this solution until a deep color appears (5 - 30 minutes),
then air dried and photographed.
Figure 1.7. Western blot of reovirus antigen using polyclonal AB

357. 357
MONOCLONAL ANTIBODIES
Serum contains many different types of antibodies that are specific for a variety of antigens.
Using a mixed population of antibodies can create problems for a number of immunochemical
techniques. Therefore, the development of hybridomas, which are a pure population of antibodies
directed against one antigen or epitope, was a major discovery. Köhler and Milstein (1975) developed
a technique that permitted the growth of clonal populations of cells secreting antibody with a defined
specificity. In this technique an antibody secreting cell, isolated from the spleen of an immunized
mouse, is fused with a myeloma cell, a type of antibody producing B-cell tumor. These hybrid cells are
called hybridomas and can be maintained in vitro and will continue to secrete antibodies with the
defined specificity. These antibodies are called monoclonal antibodies (MAB).
MAB's are valuable tools that can be used in a variety of specific immunologic tests to
diagnose pathogens in tissues or body fluids. These can be used to differentiate between serotypes and
subtypes of a given pathogen in epidemiologic studies. They are highly specific reagents such that
they can recognize as few as six amino acids. Hybridoma secreting MABs can be frozen and stored
indefinitely and can be inoculated intraperitoneally into mice, and the resulting ascities fluid will be
rich in high titer MAB. The disadvantage of hybridomas are that they are very time consuming to
produce (3 to 6 months) and MABs can sometimes be too specific and unable to recognize other
important antigens.
Hybridomas are immortal somatic cell hybrids that secrete antibodies for an indefinite period of
time. Hybridomas are usually produced from fusion of immunized mouse spleen cells and myelomas
from BALB/c mice. Polyethylene glycol (PEG) is the most commonly used agent to fuse mammalian
cells. PEG fuses the plasma membranes of adjacent myeloma and the antibody—secreting mouse
spleen cell forming a single cell with two or more nuclei.
Even in the most efficient fusion, only about 1% of the starting cells are fused. Therefore, a
large number of unfused cells will still be in culture. Spleen cells from the mouse which do not fuse
will not survive in culture for more than 7 days. However, the unfused myeloma cells are well adapted
to cell culture and will continue to grow. These myeloma cells are generally eliminated by drug
selection. Commonly the myeloma cell has a mutation in one of the enzymes of the salvage pathways
of purine nucleotide biosynthesis. Selection with 8-azaquanine yields a cell line harboring a mutilated
hypoxanthine—quininephosphoribosyle transferase gene (HPRI). The addition of a compound that
blocks the De novo nucleotide synthesis pathway will force cells to use the salvage pathway. Cells
containing a nonfunctional HRPT protein will die in these conditions. Hybrids between myelomas
with a nonfunctional HPRT and cells with a functional HPRT will grow. Selections to kill nonfused
myeloma cells through this pathway are commonly done with the drug aminopterin.
Young female (+6 weeks of age) BALB/c mice are a good source for immunization. Proteins
can be partially purified microorganisms produced by ultra centrifugation or highly purified from
acrylamide gels or nitrocellulose strips. The best method for obtaining blood from mice is by
swabbing and cutting the tail vein. Samples taken from the eye are not recommended due to undue
stress and the possibility of permanent damage to the eye. Mice can be marked by ear or toe clipping.

358. 358
http://www.accessexcellence.org/RC/VL/GG/monoclonal.html
A typical method for testing antibody for mice is by immunodot blot ELISA on nitrocellulose. This
procedure is similar to the one previously mentioned in this section except: Follow the procedure as
outlined:
1. Protein of at least 10 ug/ml is blotted onto nitrocellulose using a pipette or vacuum manifold
apparatus. Air dry for 1 hour to fix protein to the strip.
2. Wash the sheet 3 times in PBS.
3. Incubate the sheet in a blocking solution of 3% BSA in PBS for 2 hours at room temperature.
4. Incubate the sheet in 1ul of undiluted hybridoma tissue culture supernatant (primary antibody)
in a humid atmosphere for 30 min.
5. Make 2 fold dilutions of the test MAB as well as dilutions of normal mouse serum.

359. 359
6. Wash the sheet 3 times in PBS, then 2 times for 5 mins each with PBS. (anti-mouse IgG).
7. Apply a second conjugate antibody (anti-mouse IgG) from a commercial source as listed in the
section on immunoblotting and incubated as wash as listed in step 6.
8. Apply the color development solution compatible with the enzyme and substrate as listed for
the immunoblott procedures.
9. Antibody titers from mice of 1/160 to 1/320 are considered high enough to use for hybridoma
production.
Mice are injected multiple times with an antigen and then tested for antibody response. For the
fusion, antibody-secreting spleen cells are prepared from the mice with high titers and mixed with
myeloma cells using PEG. After fusion, cells are diluted in selective medium to kill off nonfused
myeloma cells. About 1 week after fusion, cells from wells shown to produce the antibody of choice
are then single cell cloned. Several rounds of sub-cloning for detection of antibody are completed
before the hybridomas are expanded. Positive cell culture medium and hybridomas are then used or
frozen as needed.
The amount of antigen and immunization schedule will vary. An example of a typical
immunization schedule is apparent in Table 1.4.
Table 1.4
1. For each mouse, mix 250 l of antigen solution (10 to 50 ug of protein) with 20 l of
complete Freund's adjuvant. Inject 4 to 6 BALB/c female mice IP.
2. After 21 days, repeat the injections, but use incomplete Freund's adjuvant. Give the
third at 21 days after the first, this time by IV without adjuvant, using 100 ul of protein
4. Fuse splenocytes from mice with myeloma cells.
5. Selecting sub-cloning, testing and expansion of positive fused cells.
Once a good immune response has been produced, the development of hybridomas is ready to
start. Antibody producing spleen cells will be mixed with myeloma cells, fused with PEG solution,
and then diluted in selective media and plated in multi-well tissue culture dishes. About 1 week later,
fluid from wells containing growing fused cells are tested using an immunodot procedure as previously
described. Cells from positive wells are grown; single-cell cloned at least twice more and tested again
for antibody. Some hybridomas are genetically unstable and may be positive one time and negative
the next. Positive cells are expanded, and fluids and cells frozen for later use.
Hybridoma propagation demands sterile technique, good tissue culture facilities and workers
trained in other forms of cell culture methods. Prior to fusion, several solutions need to be prepared
and tested for sterility. To prepare PEG, melt PEG 1500 in a 50 water bath. Add 0.5 gr of PEG to a

360. 360
P
P
vial, cap the vial and autoclave and store at room temperature. To prepare hypoxanthine, aminopterin,
and thymidine selection (HAT) medium make two solutions, 100 x HT and 100 xA. 100x HT is made
by dissolving 136 mg of hypoxanthine and 38 mg of thymidine in 100 ml of HB
2B0. Heat gently at 70C.
To prepare 100 ml of 100x A, add 1.76 mg of aminopterin to 100 ml of HB
2BO. Add 0.5 ml of 1 N
NaOH to dissolve. Titrate with 1 N HCl to neutral pH. Filter sterilize the solutions independently.
Dispense 2.0 ml aliquots and store at -20C.
Preparation of Myeloma Cells
Three to five days before fusion, the immunized mouse is given a final boost. This boost
should be at least 3 weeks after the previous injection. A final boost is best given by intravenous
injection. The antigen should contain no adjuvant. Prior to the fusion, the myeloma cells must be
prepared. Myeloma cells should be thawed from liquid nitrogen at least 6 days prior to fusion.
Myeloma cells are grown in cell culture. The growth of myeloma cells as well as hydridomas will be
discussed in a latter section. One day prior to fusion, split the cells into fresh medium supplemented
with 10% serum. On the morning of the fusion, dilute 10 ml of the overnight culture with an equal
volume of medium supplemented with 20% fetal volume serum.
Preparing Splenocytes
Sacrifice the mouse according to method approved by the laboratory animal use committee.
Aseptically remove the spleen from the mouse and place it in a tissue culture dish containing 10 ml of
prewarmed medium without serum. Tease a portion of the spleen into very fine parts with a needle and
syringe. Transfer the cells to a centrifuge tube. Allow the suspension to sit for 2 minutes and remove
the supernatant for use in fusion. A spleen from a mouse contains approximately 108
lymphocytes.
Cell Fusion
1. Wash the splenocytes 2x by centrifugation at 400g for 5 min, in prewarmed medium without
serum. At the second centrifugation also spin 20 ml of myeloma cells (P3x63 Ag 8.653) from
CRL 1580: American Type Culture, Rockville, MD, in a separate tube. The myeloma cells
only need 1 washing. During the washes, melt 0.5 gr of PEG at 50C. Add 5 ml of warmed
medium without serum and transfer to at 37C bath.
2. After the washes, resuspend the cell pellets in medium (37 C) without serum and combine.
Centrifuge the cells at 800g for 5 min. Carefully remove and discard the medium.
3. Remove the 50% PEG and slowly add it to the cell pellet resuspending the cells by stirring with
a pipette. Add the PEG slowly over 1 min. Fill a 10 ml pipette with 10 ml of prewarmed
media without serum. Add 1 ml of the cells during a 1 min period, while stirring with a pipette.
Then add the remaining 9 ml over the next 2 min with stirring. Centrifuge the cells at 400 gr
for 5 min.
4. Remove the supernatant and resuspend the cells in 10 ml of medium with prewarmed 20% fetal
bovine serum (FBS) and 1 x HAT.

361. 361
5. Dispense 100 ul of cells into 20, 96—well microtiter plates using a multiple pipettor and place in a
COB
2B incubator at 37C.
6. Clones should be visible by microscopy at about day 4 and by eye about day 7.
7. Poorly growing cells may need to be fed at day 5 by replacing the old medium with fresh
medium.
Screening
Wells containing hybridomas (fused giant cells) are ready for screening for antibody production at 7 to
14 days. Aseptically remove the tissue culture supernatant and test it for reactivity to the
antigen used to immunize the mouse by dot immunoblott ELISA. False positive results may result due to
antibody produced by splenocytes which will die in culture during the first week. Therefore, fluids should be
retested again after sub-culturing the cells.
Another common feeder cell type is mouse macrophages. Mice are injected with 0.5 ml of pristane
or Freund's complete adjuvant into the peritoneum. These irritants will recruit macrophages into the
peritoneum. After 7 days, remove the ascities fluid and plate the macrophages as discussed with the spleen
cells.
Expansion and Freezing of Positive Clones
After a positive well has been identified, the cells should be transferred to 0.5 ml of medium with
20% FBS and 1 x HAT in a 24-well plate. After the cultures become dense, they should be transferred to a
large dish or small flask. At this time drug selection can be slowly removed by growing the cells in
medium without aminopterin. At this stage some cells can be frozen in liquid nitrogen (procedure to be
discussed later) and some cells used for sub-cloning, further testing and selection.
Hybridomas

362. 362
P
P
Single-cell cloning
After a positive culture has been identified, the next step is to clone the antibody-producing
cell. The original positive well will often contain more than one clone and many may have unstable
assortment of chromosomes. Single-cell cloning will insure that only one clone is present to produce
only one monoclonal and that the secretion of the antibody can be stably maintained.
Isolating a stable clone is very time consuming, and because hybridoma cells have a very low
plating efficiency, single cell cloning is done in the presence of feeder cells, normally prepared from
mouse splenocytes, macrophages, thymocytes or fibroblasts.
Preparing Splenocyte Feeder Cell Cultures
1. The cells should be prepared 1 day prior to single-cell cloning. Sacrifice the mouse. Remove the
spleen and tease the cells apart as was done for the production of spleen cells for fusion.
2. Allow the large clumps to settle to the bottom of the tube and remove the cell suspension and transfer
to 100 ml of medium with 10% FBS. One spleen for 100 ml is about 108
cells.
3. Allow the cells to grow in a 96-well plate (50 ul of spleen cell solution) for 24 hrs. at 37C.
Single-cell Cloning by Limiting Dilution
1. Using a multi-well pipetter and 50 ul of medium with 20% FBS to each well of a 96 well plate.
The wells should already contain 50 ul of feeder cells giving 100 ul total volume/well.
2. Hybridomas should grow rapidly in a few days, 100 ul of cell suspensions from each well
should be serially diluted across the plate using an 8-well multi-pipetter.
3. Clones should be visible in 7 days. Select the best clones in the higher dilutions and either
repropagate, freeze or clone them again.
4. This will be determined primarily after testing the hybridoma supernatants against the antigen.
The test of choice should be the dot immunoblott ELISA, followed by the Western
immunoblott. The Western technique should show that the antibody is reacting against only
one or two proteins. Hybridomas may need to be sub-cloned 2 to 4 times depending on
specificity and stability in culture and reactivity in the immunological test. If the antigen is
from a virus supernatant fluid it can be used in an immunofluorescence test. Hybridoma cell
fluid is mixed with virus infected cells, and then after washing an anti-mouse IgG conjuncted
with fluorescence isocyanate from GIBCO Labs (Grand Island, NY) is used and the cells
examined under UV light.
Classing and Subclassing of Monoclonal Antibodies

363. 363
Often techniques for using MAB's require antibodies with specific properties. The properties
are unique to the antibody and affect the specificity and affinity for the antigen. A second set of
properties for monoclonal antibodies is determined by the structure of the remainder of the antibody.
These properties include the class or subclass of the heavy chain or the light chain. They will
determine the affinity for important secondary reagents used in various immunological assays. The
type and class of immunoglobulin can be distinguished by simple immunochemical assays that
measure the presence of the individual light and heavy chain polypeptidase. These techniques are
relatively straight forward and used antimmunoglobulin reagents, which can be bought in commercial
kits. These kits make use of antigen-capture ELISA. A commercial kit (Immuno Select Isotyping
System, GIBCO BRL, Gaithersburg, MD) is commonly used to determine class, sub-class, and light
chain of MABS. The kits are simple, straightforward and provide the Anti-Ig antibodies and reagents
to be run in a few hours.
Propagation of Hybridomas and Myelomas
These cell lines can be grown in a broad range of standard tissue culture media. The two most
commonly used are Dulbecco's Modified Eagle's (DME) and RPMI 1460 medium. These media are
usually supplemented with 10% FBS. Tissue culture media can be purchased in powder and liquid
form and 1 and 10x concentration from a variety of manufacturers. Penicillin and Streptomycin at 100
u/ml and 100 ug/ml, respectively or gentamicin at 50 ug/ml are also added to retard bacterial growth.
The use of serum free media has the advantage of less expense. When cells are grown at low density
as after fusions or single-cell cloning, supplementation with feeder cells (described in a previous
section) and/or 20% FBS is recommended.
Subculturing Cell lines
Most are easy to grow in vitro, they do not attach well to plastic or glass, and are transferred
readily by pipetting. Cells are healthy when their plasma membranes are smooth. Cells are dying when
they become granulated. Hybridomas are normally passed every 4 days or so by dilution at 1:10 or 1:20
with fresh media. The average doubling time is 24 hours. They can be grown in flasks or dishes. To
move cells from one medium to another they should be diluted 1:10 with new medium then slowly
diluted further when the cells are growing normally.
Cells can be shipped as frozen stocks in dry ice or as growing cells in liquid culture. Liquid
cells should be shipped at high density and filled with liquid medium. Cell lines can be stored by
slowly freezing cells in an appropriate media (92% FBS) and a cryoprotectant such as 8%
dimethylsulfoxide (DMSO). Cells are first centrifuge at 4C, resuspended in freezing media, placed in
a vial and slowly frozen at 1 /minute. This can be accomplished by placing the vial in a commercial
container which allows this slow freezing or placing the vial in an alcohol bath which produces a
similar effect. In both cases the material is placed in a -70C freezer for 8 hours before placing it in a
liquid nitrogen freezer. If these are not available, the cells can be cooled for 1 hr at 4C then 4 hours at
-20C, overnight at 70C and then placed at liquid nitrogen (-80C). Cells can be stored for a few months
at -70C. For most purposes the number of cells can be estimated by microscopic observation.

364. 364
5
However, if an exact count is needed cells can be counted using a Neubayer counting chamber®,
hemocytometer, or Coulter counter®. Cell viability can be determined by staining cells with a 0.25%
(wt/vol) of Trypan Blue vital exclusion dye. Vital dyes do not stain living intact cells.
For recovering cells from liquid nitrogen, slowly thaw the vial in 37C water bath. Occasionally
swirl the vial to hasten the process, but keep the top of tube away from the water. When the cells are
90% thawed, wipe the outside of the vial with 70% ethanol. Carefully remove the cell suspension and
the cells from the bottom of the vial and transfer to a centrifuge tube with 10 ml of cotton medium with
10% FBS at room temperature. Spin the suspension at 200 g for 5 min. Remove the medium and
resuspend the cells in 10 ml of medium with 10% FBS and place in a COB
2B incubator. Cells should
recover and start growth in 24 hr of plating, if not, remove a second vial from storage, and repeat the
process.
Collecting Hybridoma Supernatants
For most immunochemical methods, tissue culture supernatants can be used directly. When
collecting fluids for MAB production, wait for the cells to die then harvest the fluid. Remove the cell
debris by centrifugation. Spin the cultures at 1,000g for 10 min. Use the supernatant directly for the
test. Optimum dilutions of MAB fluids, secondary conjugated antibody and antigens will have to be
determined by checker board titrations.
Storing Tissue Culture Supernatants or Ascities
1. Fluids can be stored upon refrigeration for several months or at -20C for years. Culture fluid,
but not ascities fluid, may need to be buffered by the addition of 1m Tris (pH 8.0). Sodium
azide can also be added to avoid contamination at 0.02%.
2. Upon thawing, precipitation may occur from proteins salts or fats and can be removed by
centrifugation at 10,000 x g.
Production of High Titer MAB in Mice Ascitic fluid.
Ascitic or intraperitoneal fluid is often used to produce high titer MAB. Hybridoma fluid is
injected in the peritoneum of mice to produce a tumor. The tumor produces hybridoma cells which
secrete high titer antibody between 1 and 10 mg/ml.
1. Prime adult female mice of the same genetic type as your hybridomas by injecting 0.5 ml of
pristane or Freund's adjuvant into the peritoneum. These solutions act as an irritant to recruit
monocytes and lymphoid cells into the area.
2. After 7-14 days, inject 5 x 10P
P
growing hybridoma cells intraperitoneally in no more than 0.5
ml of PBS.

365. 365
P
P
3. After 1 to 2 weeks tap the ascitic fluid with an 18-gauge needle and a 5ml syringe. Many mice
will produce a second or third batch of fluid and the mouse can be bleed out and the serum used
as a source of MAB.
4. Incubate the fluid at 37C for 1 hr and transfer to 4C overnight.
5. Spin the fluid at 3,000 g for 10 min. Use the supernatant as your source of MAB.
Contamination by Bacteria, Fungi or Mycoplasma
The many cell manipulations involved in these procedures can often lead to contamination.
Contamination by bacteria or fungi usually results in a change in the color of the medium. If frozen,
uncontaminated stocks are available, it is best to destroy contaminated stocks. If not, contamination
may be handled by use of subculturing in fresh uncontaminated materials plus the addition of drugs
such as penicillin and streptomycin or gentamicin for controlling bacteria, or mycostatin for fungi and
lincomycin and streptomycin for mycoplasma. If this does not work, then cells can be single cell
cloned (subcloned) to remove most organisms and then add the drug(s). All incubators, hoods, media
and the like must also be decontaminated.
If these procedures still do not rid all of the microorganisms, the cells can be repassed in mice.
Female mice are injected with pristane or Freund's adjuvant as done for the production of feeder cells.
One week later inject the mice with 107
hybridoma cells. When Ascities develop, abdominal fluid, tap
the fluid and spin it at 400g for 5 min at room temperature. Remove the supernatant, and resuspend
the cells in 10ml of medium with 10% FBS and transfer to a culture plate in a COB
2B incubator. Handle
as for regular hybridomas, after subcloning retest the fluids for contamination and antibody production
of appropriate specificity.
Antigen Capture Assays
Antigen capture assays are highly sensitive methods for examining the presence of microbes in
infected tissues or cell cultures. These assays are more rapid and sensitive than traditional methods for
the isolation and identification of organisms, because they require only the presence of minute amounts
of antigen. These modified sandwich ELISA assays require MAB which is first bound to a 96 well
plate or sheet of nitrocellulose, then the antigen to be detected followed by antibody against the antigen
prepared in chickens, and then a conjugated antichicken IgG and a substrate and color reactant, usually
available in a commercial kit.
1. Add 50 ul (20ug/ml) of affinity-purified rabbit antimouse immunoglobulin in 50 mM carbonate
buffer (PH 9.0) to each well. Incubate for 2 hr at room temperature or overnight at 4C. The
concentration of reactants is usually determined prior, using an immunodot checkerboard ELISA
system where various dilutions of antibodies and antigen are used for optimization of the assay.
2. Treat each well with a blocking solution (PBS, 0.2% Tween 20 with 5% dried skim milk) for 1
hr then remove the material by aspiration or turning the wells upside down and taping the plate
gently.

366. 366
3. The antigen to be captured (infected allantoic, cell culture fluid or bursal homogenate) mixed
with PBS and EDTA 1:1 (1 bursa ground in 1 ml of PBS and EDTA) is clarified by low speed
centrifugation (800 x g for 5 min) to remove cell debris.
4. Control wells are treated with uninfected allantoic or cell culture fluid tissues.
5. Each well containing the attached MAB and treated antigen is then reacted with block solution
for 1 hr at room temperature.
6. Blocking solution is removed and the wells incubated with homologous chicken serum diluted
1:2000 for 1 hour. The homologous serum is antisera produced in the chicken against the
microbe used as capture antigen. After each incubation step, the wells are evacuated and rinsed
5 times with PBS containing 0.2% Tween 20.
7. The wells are then incubated with goat antichicken conjugate (diluted 1:2,000) from Southern
Biotechnology Associates, Birmingham, AL, for 1 hr.
8. The wells are then evacuated and rinsed as before and incubated with Substrate Solution
prepared by dissolving one O-phenylene-diamine tablet (Zymed Laboratories Inc., San
Francisco, CA) in 12ml of citrate phosphate buffer (ph 5.0) containing 0.03% hydrogen
peroxidase.
9. After incubation for 10 min in the dark, the enzyme substrate reaction is stopped by the
addition of 100 ul of 1M sulfuric acid per well.
10. Optical densities (OD) are measured at 490 nm with an automatic ELISA (spectrophotometer)
reader (Dynatec, Flow General or Bio-Teck Instruments).
11. Other negative controls include negative MAB's, control chicken serum from SPF birds, and
heterologous, capture antigen from an organism other then those which the MAB or chicken
antibody were prepared against (Figure 1.7).
12. The status of the sample is determined by comparing the OD reading for the sample (S) with
the reading obtained for the negative sample (N). The negative sample is from uninfected
fluids or tissues. If the S/N value is equal to 2 or better, the sample is considered positive for
antigen.

367. 367
Figure 1.8. AC ELISA for IBDV

368. 368
ANTIGEN CAPTURE ELISA FOR IBDV
Materials and Reagents
96 well flat bottomed, polysterene microtiter plates
Carbonate-bicarbonate buffer, pH 9.6 (Sigma C-3041)
Coating antibody - rabbit IgG anti-IBDV (commercial), dilute 1:1000
Washing buffer (Sigma P-3563) 10 mM PBS, 0.05% Tween 20 pH 7.4
Diluent - 2% non-dairy whitener (Coffee Mate) in PBS (filter before use)
IBDV monoclonal antibody (from Australia), dilute 1:50
Conjugate - Anti-mouse IgG-HRP (H+L) (KPL), dilute 1:1000
Substrate - ABTS-HB
2BOB
2 B(KPL)
Sample preparation
1) a: Cell culture - Spin infected cell culture over a 40% sucrose cushion at 27,000 RPM for
1½ hr. Suspend pellet in PBS.
b) Bursa - Weigh bursa and add PBS to give a 10% suspension. Homogenize in Virtis.
Harvest supernatant. Centrifuge at 2,000 X G for 10 min and take supernatant.
2) Add equal volume of freon to cell culture or bursal suspension.
3) Spin at 12,000 x g for 30 min.
4) Take aqueous phase. Store in -70C.
Method
1) Coat all wells of plate with 100 of coating antibody diluted 1:1000 in CB buffer. Seal
plate with cellotate and leave at room temperature overnight.
2) Wash plate 3 times with washing buffer allowing buffer to remain in the wells for at least 1
min for each wash.
3) Add duplicate 100 volumes of test samples. Incubate for 1 hour.
4) Wash plates 3 times.
5) Add 100 of Mabs diluted 1:50. Incubate for 1 hour.
6) Wash 3 times.
7) Add 100 of HRP conjugate diluted 1:1000. Incubate for 1 hour.
8) Wash 3x, then flood plate with distilled water using wash bottle.
9) Add 100 ul of substrate to all wells. KPL-ABTS-HB
2B0B
2B mix - no preparation or dilution
10) Incubate on plate shaker at room temperature for 20 min. Read after 1 hour.

369. 369
11) Read on ELISA reader at 405 nm.
Table of Contents

370. 370
Immunoperoxidase Test
Immunoperoxidase methods are used for the detection of antigens in diagnostic tests. The
incorporation of an avidin-biotin-peroxidasemethod is highly sensitive and specific and can detect
antigens in formalin-fixed, paraffin-embedded tissues.
The immunoperoxidase test offers advantages over other antigen detection systems. It requires
only a regular light microscope, can be used with formalin-fixed paraffin embedded tissues sections,
which can be stained for immunoperoxidase and then restained for microscopic evaluation, allowing
the observer to correlate the numbers, and intensity of immunoperoxidase-stained cells with
microscopic pathology. This allows for a rapid definitive diagnosis, since the presence of antigen in
close proximity of the lesions gives the observer strong evidence that the microbe in question caused
the signs.
The avidin-biotin-peroxidasecomplex (ABC) method is performed on paraffin-embedded formalin
fixed tissue sections as follows:
The method employs a Vectastin ABC Kit® from Vector Lab, Inc., Burlingame, CA. Another popular
Kits is the Multispecies Kit® from Signet, Lab. Inc., Medham, Mass.
IMMUNOPEROXIDASE
Vectastatin-ABC Kit-Modified
1. Deparaffinize and hydrate tissue sections through xylenes or other clearing agents and graded
alcohol series as follows:
a. xylene -3 min
b. xylene -3 min
c. 100% ethanol -2 min
d. 100% ethanol -2 min
e. 95% ethanol -2 min
2. Rinse for 5 min in distilled water.
3. Incubate the sections for 30 min in 0.3% HB
2B0B
2B in methanol.
4. Wash in PBS buffer for 20 min.
5. Exposure of hidden antigen
a. Pre-heat 1% trypsin solution in 0.5% CaClB
2B for 30 min.
b. Place the hydrated sections vertically in a rack, suspended in the solutions and gently stir.
c. Wash in PBS for 20 min.
6. Incubate sections for 20-30 min. with diluted 1% normal horse serum as a blocking step.

371. 371
7. Blot excess serum from sections.
8. Incubate sections for 30 min with primary MAB positive and negative antiserum diluted in
buffer. The dilution must be determined from hybridomas or Ascities by trial and error bases
or checkerboard titration in an immunodot test. We use the fluid at 1:20 dilution for IBDV.
9. Wash slides for 10 min in buffer (2 changes).
10. Incubate sections for 30 min with diluted biotinylated antimouse solution from horse origin
(1/200) from Vector Lab.
11. Wash slides for 10 min in buffer.
12. Incubate sections for 45 min with Vectastatin ABC reagent.
13. Wash slides for 10 min in buffer.
14. Incubate sections for 3 to 5 min in peroxidase substrate solution (diaminobenzidine tetra
hydrochloride solution).
15. Wash sections for 5 min in tap water.
16. Dehydrate tissues through graded alcohols (reverse of procedure 1). Follow 1e to 1a.
17. Counterstain, clean and mount.
a. 10 dips in hematoxylin (1 min)
b. 10 dips in eosin add permount and coverslip
18. View under normal light microscope; look for yellow-brown positively stained granules near
areas of microscopic pathology.
19. Negative controls include tissues from SPF birds and negative MAB's (Figure 1.9).
Figure 1.9. Immunoperoxidase test for IBDV in bursa

372. 372
References
Cruz-Coy, J.S., J.J. Giambrone, and V.S. Panangala, 1993. Production and characterization of
monoclonal antibodies against variant A infectious bursal disease virus. Avian Dis. 37:406-
411.
Cruz-Coy, J.S. J.J. Giambrone, and F.J. Hoerr, 1993. Immunohistochemical detection of infectious
bursae disease virus in formalin-fixed, paraffin-embedded chicken tissues using monoclonal
antibody. Avian Dis. 37:577-581.
Harlow, E. and D. Lane, 1988. "Monoclonal Antibodies" "Growing Hybridomas" and
"Immunoblotting" in Antibodies a Laboratory Manual. Cold Spring Harbor Laboratory, NY.
pp. 139-282, 471-510.
Köhler, G. and Milstein, 1975. Continuous cultures of fused cells secreting antibody
of predefined specificity nature 256:495-497.
Naqi, S.A., K. Karaca, and B. Bauman, 1993. A monoclonal antibody based antigen capture enzyme-
linked immunosorbent assay for identification of infectious bronchitis virus serotypes. Avian
Path 22:555-564.
Promega, 1993. "Electrophoresis/staining of Proteins" and Immunoblotting." In Proteins: Tips and
Techniques. Promega, Co., Madison, WI. pp. 3-23.
Snyder, D.B., D.P. Lana, P.K. Savage, F.S. Yancey, S.A. Mengel, and W.W. Marquart, 1988.
Differentiation of infectious bursal disease virus directly from infected tissues with neutralizing
monoclonal antibodies: Evidence of a major antigenic shift in recent field isolates. Avian Dis.
32:535-539.
Table of Contents

373. 373
APPENDIX
1. Selected List of Suppliers
Amersham Corp.
236 South Clearbrook Drive
Arlington Heights, IL 60005
(800) 323-3950 FAX: (312) 593-8236
American Optical Scientific Instruments
Reinhert Jung Inc.
P.O. Box 123-T
Buffalo, NY 14240
American Type Culture Company
12301 Parklwan Drive
Rockville, MD 20852
Amicon Corp.
Scientific Systems Division
72 Cherry Hill Drive
Beverely, MA 01915
(800) 343-0696 FAX: (508) 777-6204
Analytab
Division of Sherwood Medical Co.
1831-T Olive
St. Louis, MO 63103
APHIS-Biologics
National Veterinary Service Lab.
P.O. Box 844
Amos, IA 50010
API Analytab Products
200 Express Street
Plainview, NY 11805
Baxter Scientific Products
1210 Waukegan Road
McGraw Park, IL 60085
(800) 633-7369 FAX: (312) 473-2114
Beckman Instruments
P.O. Box 6764

374. 374
Somerset, NJ 08875-6764
(800) 742-2345 FAX: (201) 560-1448
Bethesda Research Lab (BRL)
See GIBCO/BRL
Bio-Rad Laboratories
1000 Alfred Nobel Drive
Hercules, CA 94547
(800) 424-6723 fax: (415) 724-3167
Boehringer Mannheim Biochemicals
P.O. Box 50414
Indianapolis, IN 46250
(800) 262-1640 FAX: (317) 576-2754
Brinkmann Instruments
Subsidiary of Sybron Corp.
Cantiaque Road
Westbury, NY 11590
(516) 334-7500 FAX: (516) 334-7506
Difco Laboratories
P.O. Box 331058
Detroit, MI 48232-7058
(800) 521-0851 FAX: (313) 591-3530
DuPont New Products
549 Albany Street
Boston, MA 02118
(800) 551-2121 FAX: (617) 426-3038
Dynatech Laboratories
14340 Sully Field Circle
Chantilly, VA 22021
(703) 631-7800 FAX: (703) 631-7816
Eastman Kodak
343 State Street
Rochester, NY 14652-3512
(800) 225-5352 FAX: (716) 722-3179
Enzo Biochem
40 Oak Drive
Syosset, NY 11791
(800) 221-7705 FAX: (516) 496-0830

375. 375
Fisher Scientific
711 Forbes Avenue
Pittsburgh, PA 15219
(412) 562-8300
FMC BioProducts
191 Thomaston Street
Rockland, ME 04841
(800) 341-1574 FAX: (207) 594-3491
Fotodyne
16700 West Victor Road
New Berlin, WI 53151
(800) 362-3686 FAX: (414) 785-7013
GIBCO/BRL
3175 Staley Road
Grand Island, NY 14072
(800) 828-6686 FAX: (800) 331-2286
ICN Flow
3300 Hyland Avenue
Costa Mesa, CA 92626
(800) 368-3569 FAX: (714) 557-4872
IDEXX Corp.
100 Fore Street
Portland, ME 04101
Intervet (Azko, In)
P.O. Box 318
Millsboro, DE 19966
Invitrogen
11588 Sorrento Valley Road
San Diego, CA 92121
(800) 544-4684 FAX: (619) 259-8683
Kirkegaard and Perry Laboratories
2 Cessna Court
Gaithersburg, MD 20879
Miles Laboratories
195 W. Birch Street
Kankakee, IL 60901
(800) 227-9412 FAX: (815) 937-8285

376. 376
Millipore
80 Aslby Road
Bedford, MA 01730
(800) 225-1380 FAX: (617) 275-8200
Neagen Corporation
620 Lesher Place
Lansing, MI 48912-1509
Perkin-Elmer Cetus
761 Main Avenue
Norwalk, CT. 06859
(203) 762-1000 FAX: (203) 762-6855
Pharmacia LKB Biotechnology
800 Centennial Avenue
Piscataway, NJ 08855
(800) 526-3593 FAX: (201) 457-8643
Pierce Chemical
P.O.Box 117
Rockford, IL 61103
(800) 874-3723 FAX: (815) 968-7316
Promega
2800 Woods Hollow Road
Madison, WI 53711
(800) 356-9526 FAX: (608) 273-6967
Rainin Instrument
Mack Road
Woburn, MA 01801
(617) 935-3050 FAX: (617) 938-8157
Rock Diagnostics
One Sunset Avenue
Monclair, NJ 07042-5199
Sarstedt
P.O. Box 468
Newton, NC 28658-0468
(800) 257-5101 FAX: (704) 465-4003

377. 377
Schleicher and Schuell
10 Optical Avenue
Keene, NH 03431
(800) 256-4024 FAX: (603) 357-3627
Sigma Chemical
P.O. Box 14508
St. Louis, MO 63178
(800) 325-3010 FAX: (800) 325-5025
Fort Dodge Animal Health, Inc.
9401 Indian Creek Parkway
Overland Park, KS 66225-5945
Stratagene
11099 W. Torrey Pines Road
LaJolla, CA 92037
(800) 424-5444 FAX: (619) 535-5430
Vector Laboratories
30 Ingold Road
Burlingame, CA 940620
(800) 227-3666 FAX: (415) 697-0039
Virtis Co.
Gardiner, NY 12525
Whatman Laboratory Products
9 Bridewell Place
Clifton, NJ 07014
(800) 631-7290 FAX: (201) 472-6949
Wheaton
1000 North 10th Street
Millville, NJ 08332
(800) 225-1437 FAX: (609) 825-1368
Table of Contents

378. 378
Major sites for Molecular Biology on the world wide web
National Center for Biotechnology Information (NCBI) -- Genbank
Baylor College of Medicine Genome Center
Cold Spring Harbor Laboratory
The Sanger Center
The Genome Data Base Server at Johns Hopkins University
Harvard Biological Laboratories
The Jackson Laboratory WWW Server
W.M.Keck Center for Genome Information
LBNL Human Genome Sequencing Center
European Molecular Biology Laboratory at Heidelberg
European Bioinformatics Institute, U.K.
The ExPASy Molecular Biology Server
Genethon WWW Server (Fr)
The International Center for Genetic Engineering and Biotechnology (SBASE)
http://www.garlandscience.com/ECB/about.html
http://www.vaccines.com/
http://www.ivis.org/ http://avianflu.typepad.com/ http://www.aphis.
usda.gov/vs/ceah/ncahs/nahms/poultry/index.htm http://www.aphis.
usda.gov/lpa/news/2005/10/animhealt2004.html
http://arbl.cvmbs.colostate.edu/hbooks/genetics/biotech/index.html
2. Procedures for Preparation of Buffers
Ammonium acetate, 10m
Dissolve 385.4g Ammonium acetate in 150 ml HB
2BO
Add HB
2BO to 500 ml
Ammonium persulfate 10%
10g ammonium persulfate (Bio-Rad)
HB
2BO to 100 ml total volume
Store refrigerated for 2 weeks
CaClB
2B, 1m
147g CaClB
2B X 2HB
2BO
ddHB
2BO to 1 liter
Carbonate buffer, pH 9.2, 0.1m
1.36g sodium carbonate
7.35g sodium bicarbonate
950 ml ddHB
2BO
Adjust pH to 9.2 with 1m NaCl or 1m NaOH, if necessary

379. 379
Add ddHB
2BO to 1 liter
Crystal Violet Solution
Stock Solutions
Solution A:
Crystal violet 2 g (90% dye content)
Ethanol (95%) 20ml
Solution B:
Ammonium oxalate 0.8 g
ddHB
2BO 80ml
Staining Solution
Mix 1 part of Sol A to 9 parts of Sol B.
CsCl solutions
density = 1.3g 1 ml : 31.24g CsCl + 68.76 ml HB
2BO
density = 1.5g 1 ml : 45.41g CsCl + 54.59 ml HB
2BO
density = 1.7g 1 ml : 56.24g CsCl + 43.76 ml HB
2BO
Deionized Formamide
Mix 50 ml of formamide and 5g of mixed-bed, ion-exchange resin (Bio-Rad AG 501 - x8,
20 to 50 mesh) and stir 30 min at room temperature. Filter through Whatman Paper, dispense
into 1 ml aliquots, and store at -20C.
Denhardts Solution, 100 x
10g Ficoll 400
10g polyvinylpyrrolidone
10g BSA (Pentax Fraction V)
HB
2BO to 500 ml
Filter and store at -20C in 25 — ml aliquots
Dithiothreitol (DTT), 1m
Dissolve 15.45g DTT in 100ml HB
2BO
Store at -20C
DNAase buffer (10X)
0.5 M Tris-HCl
0.06 M MgClB
2B
0.1 M DDT

380. 380
EDTA (ethylene diamine tetraacetic acid), 0.5 m
Dissolve 186.1g NaB
2B EDTA. 2 HB
2BO in 700 ml HB
2BO
Adjust pH to 8.0 with 10m NaOH (50 ml)
Add HB
2BO to 1 liter
Ethidium bromide solution
100 x stock solution, 0.5 mg 1 ml:
50 mg ethidium bromide
100 ml HB
2BO
Working solution, 0.5 /ml: Dilute stock 1:1000 for gels.
Protect from light and store in the refrigerator.
HAT (hypoxanthine/aminopterin/thymidine) medium
0.1 mM nonessential amino acids
100 hypoxanthine
0.4 aminopterin
16 thymidine
Use glass distilled water and sterilize medium through 0.22 um filter.
HEPES Buffer
5.96 g Hepes
8.19 g NaCl
0.15 g CaCl
dd HB
2BO
PH w/ 1 N NaOH
HCL, 1m
Mix in the following order:
913.8 ml HB
2BO
86.2 ml concentrated HCl
KCl, 1m
74.6g KCl
HB
2BO to 1 liter
MgClB
2B, 1M
20.3g MgClB
2B X 6 HB
2BO
HB
2BO to 100 ml
Mg 50B
4B, 1M
24.6g Mg 50B
4B X 7 HB
2BO
HB
2BO to 100 ml
NaCl, 5 M
292g NaCl

381. 381
HB
2BO to 1 liter
NaOH, 10M
Dissolve 400g NaOH in 450 ml HB
2BO
Add HB
2BO to 1 liter
NET buffer
100 mM NaCl
10 mM TrisHCl, pH 7.4
1 mM EDTA
Filter Sterilize
Phenol/chloroform/isoamy/alcohol
Mix 40 to 50 parts, phenol (equilibrated in 150 mM NaCl, 50 mM Tris HCl, pH 7.5, 1
mM EDTA) with 50 to 60 parts chloroform and 1 part isoamyl alcohol. Add 8-hydroxy
quinoline to 0.1%. Store in aliquots at -20C and discard after 6 months.
Phenol equilibrated with TLE
Equilibrate freshly liquefied phenol (250ml for a 15g prep) with TLE solution (See
recipe in this section) on the day of preparation. First, extract with an equal volume of TLE
solution plus 0.5 ml of 15 m NaOH (this should bring the pH close to 8.0), then extract two
more times with TLE.
Phosphate-buffered saline (PBS) 10x, liter
10g NaCl
2g KCl
11.5g NaB
2BHPOB
4B X 7 HB
2BO
2g KHB
2BO HPOB
4B
RNA Extraction buffer
10 mM Tris pH 7.5
10 mM NaCl
10mM EDTA
0.2 % SDS
0.1% DEPC (add last)
Sodium acetate, 3M
Dissolve 408g sodium acetate X 3 HB
2BO in HB
2BO
Adjust pH to 5.2 with 3 M acetic acid
Add HB
2BO to 1 liter
Sodium phosphate buffer, pH 7.0, 0.1M
Prepare 1M solutions of NaB
2BHPOB
4B and NaHB
2BPOB
4B.
Mix 5.77 ml NaB
2B HPOB
4B with 4.23 ml NaHB
2BPOB
4B; add HB
2BO to 100 ml. The pH will be
7.0. Autoclave for sterility.

382. 382
SSC, 20x
3M NaCl (175g 1 liter)
0.3 M NaB
3B citrate X 2 HB
2BO (88g 1 liter)
Adjust pH 7.0 with 1 mHB
2BO
SSPE, 2x
0.36 m NaCl
20 mM NaHB
2B POB
4B, pH 7.4
20 mM EDTA, pH 7.4
TAE electrophoresis buffer
50x stock solution, pH 8.5;
242g Tris base
57.1 ml glacial acetic acid
37.2g NaB
2B EDTA X 2HB
2BO
HB
2BO to 1 liter
TBE electrophoresis buffer
10x stock solution
108g Tris Base
55g boric acid
40 ml 0.5 M EDTA, pH 8.0
HB
2BO to 1 liter
TE buffer, pH 7.4, 7.5 or 8.0
10m TrisCl, pH 7.4, 7.5 or 8.0
1m MEDTA, pH 8.0
TNE or NET buffer, 10x
0.1 M Tris base
10 mM EDTA
2.0 mNaCl
Adjust pH to 7.4 with concentrated HCl
Triethanolamine (TEA) buffer (0.1m TEA)
Add 18.57g Triethanolamine-L1 to 900 ml water.
Dissolve and adjust pH to 8.0 with NaOH. Adjust to 1 liter with water for 0.1m
solution. Use same day.
Tris Buffer, pH 8.6
to 900 ml HB
2BO, add:
6.06g Tris-Cl (0.05m Final) Titrate with HCl to pH 86
8.77g NaCl (0.15m final) Add HB
2BO to 1 liter
0.2g NaNB
3B (0.02% final)
Tris-buffered saline (TBS)

383. 383
P
P
Solution A: Solution B:
80g 1 liter NaCl 15g/liter CaClB
2B
3.8g/liter KCl 10g/liter Mg ClB
2B
2g/liter NaB
2BHPOB
4B Filter sterilize
30g/liter Tris Base Store at -20C
Adjust pH to 7.5
Filter sterilize
Store at -20C
For 100 ml, add 10ml solution A to 89 ml HB
2BO. While stirring rapidly, add 1ml solution B
slowly, drop by drop. Filter sterilize and store at 40C. Before use, pipette solution well for
thorough dispersion of salts.
Tris/EDTA solution
10mM TrisHCl
1.5 mM EDTA
10% (v/v) glycerol
10 mM monothiaglycerol (or 1mM DTT), pH 7.4
Tryptose Phosphate Broth (TPB)
500 ml TPB
2X 106
U Penicillin G
2g streptomycin
Table of contents

384. 384
3.Commonly Used Abbreviations
AB
260B absorbance at 260
A adenine
Ab antibody
AE avian encephalomyelitis
Ag antigen
AGP agar gel precipitation
AI Avian influenza
AMV avian myeloblastosis virus
ATP adenosine 5'-triphosphate
BG brilliant green
BH brain heart infusion
bp base pair
CEF chicken embryo fibroblasts
cDNA Complementary deoxyribonucleic acid
C cure
CMI Cell mediated immunity
CK Chicken kidney
CPE Cytopathic effect
CTP cytidine 5'-triphosphate
ddCTP dideoxcytidine triphosphate
DEA diethyl amine
DEAE diethyl aminoethyl
DEPC diethyl pyrocarbonate
DMF dimethyl formamide
DMSO dimethyl sulfoxide
DNA deoxyribonucleic acid
DNAase deoxyribonuclease
dNTP deoxynucleoside triphosphate
DTH Delayed type hypersensitivity
DTT dithiotheitol
dUtP deoxyuridine triphosphate
EDTA ethylenediamine tetra acetic acid
ELISA enzyme-linked immunosorbent assay
E. coli Escherichia coli
FBS fetal bovine serum
FCS fetal calf serum
FITCH fluorescein isothiocynate
g gravity
GPP guanosine 5'-diphosphate
HAT hypoxanthine/aminopterin/thymidine medium
HA hemagglutination
Ig immunoglobulin
HI hemagglutination inhibition

385. 385
IP immunoperoxidase assay
LT laryngotracheitis
MAb Monoclonal antibody
MD Marek's disease
MOPS 3-(N-morpholine) propane sulfonic acid
MP melting point
MRNA messenger ribonucleic acid
NAD nicotinamide adenine dinucleotide
ND Newcastle disease
ODB
260B optical density at 260 nm
Oligo oligonucleotide
PAGE polyacrylamide gel electrophoresis
PBS phosphate buffered saline
PCR polymerase chain reaction
PEG polyethylene glycol
Pristane 2, 6, 10, 14-tetramethyl pentadecane
RBC Red blood cell
RE restriction endonuclease
RFLP restriction-fragment-length polymorphisms
RNA ribonucleic acid
RNAase ribonuclease
rRNA ribosomal ribonucleic acid
RT reverse transcriptase
SDS sodium dodecyl sulfate
SSC sodium chloride/sodium citrate buffer
T thymine
TAF Tris/acetate (buffer)
Tag Thermus aquaticus DNA polymerase
Table of Contents

386. 386
GLOSSARY
Antiparallel: The manner in which two complementary polynucleotides base-pair to one another; the
5' and 3' ends of each molecule are reversed in relation to each other, so that the 5' end of one strand
is aligned with the 3' end of the other strand.
Autoradiograph (also autoradiogram): A photographic record of the spatial distribution of radiation in
an object or specimen. It is made by placing the object very close to a photographic film or
emulsion.
Autoradiography: The process by which an autoradiograph is made.
Base-pairing: The formation of hydrogen bonds between the nitrogenous bases of two nucleic acid
molecules.
β particle: An elementary particle emitted from a nucleus during radioactive decay. It has a single
electrical charge. A negatively charged β particle is identical to an electron. A positively charged β
particle is known as positron.
Biotin: A small vitamin used to label nucleic acids for chromogenic or chemi-luminescent detection.
Biotechnology: The use of microorganisms and plant and animal cells to produce useful materials,
such as food, medicine, and other chemicals.
Buoyant density: A measure of the ability of a substance to float in a standard fluid. For example,
differences in the buoyant densities of RNA and DNA allow them to be separated in a gradient of
cesium chloride.
Cesium chloride (CsCl): A dense salt used for isopycnic separation of nucleic acids. CsCl is
commonly used to pellet RNA, and in other applications, to purify plasmid DNA.
Chemiluminescence: A nonisotopic hybridization detection technique. Chemiluminescence is the
production of visible light by chemical reaction.
Clone: A collection of genetically equivalent cells or molecules.
Cloning: A series of manipulations designed to isolate and propagate a specific nucleic acid sequence
or cell for characterization, storage, or further amplification.
Complementary DNA (cDNA): DNA enzymatically synthesized in vitro from an RNA template, by
reverse transcription. Single-stranded cDNA may be used directly, or a second strand of cDNA,
complementary to the first, can be synthesized as well, for the propagation of a permanent
biochemical record in the form of a cDNA library.

387. 387
10
Curie (Ci): A basic unit for measuring radioactivity in a sample. One curie is equivalent to 3.7 × 10P
P
becquerel (i.e., disintegrations per second).
Denaturation (of nucleic acids): Conversion of DNA or RNA from a double-stranded state to a single-
stranded state. This can mean dissociation of a double-stranded molecule into its two constituent
single strands, or the elimination of intramolecular base-pairing.
Diethyl pyrocarbonate (DEPC): A chemical used to purge reagents of nuclease activity. DEPC is
carcinogenic and should be handled with extreme care. See text for details.
Differentiation: The process of biochemical and structural changes by which cells become specialized
in form and function.
Dimethyl sulfoxide (DMSO): A reagent used in conjunction with glyoxal to denature RNA before
electrophoresis.
DNA Polymerase I: A prokaryotic enzyme capable of synthesizing DNA from a DNA template.
Dot blot: A membrane-based technique for the quantitation of specific RNA or DNA sequences in a
sample. The sample is usually "dot" configured onto a filter by vacuum filtration through a
manifold (see also Slot blot). Dot blots lack the qualitative component associated with
electrophoretic assays.
Downstream: Sequences in the 3' direction (further away in the direction of expression) compared to
some reference point. For example, the initiation codon is located downstream from the 5' cap in
eukaryotic mRNA.
Electrophoretogram: A photograph of a gel made after electrophoresis, which records the spatial
distribution of macromolecules in the gel.
Electrophoresis: A type of chromatography in which macromolecules (i.e., proteins and nucleic acids)
are resolved through a matrix based on electrical charge.
Enzyme-linked immunosorbent assay (ELISA): An assay that detects an antigen-antibody complex via
an enzyme reaction.
Formaldehyde (HCHO): A commonly used denaturant of RNA. It should be handled with care, in a
fume hood. Formaldehyde is a teratogen and a liver carcinogen.
Formamide: An organic solvent/denaturant, commonly used to lower the melting temperature (TB
mB) of
double-stranded duplexes, it is used with formaldehyde to denature RNA before electrophoresis.
Formamide also permits lower temperatures in hybridization reactions. Formamide is a teratogen
and carcinogen.
Genome: All the chromosomal DNA found in a cell. It may be useful to distinguish nuclear genomic
DNA from the mitochondrial genome.
Glyoxal: A reagent commonly used to denature RNA before electrophoresis.

388. 388
Hybridization: The formation of hydrogen bonds between two nucleic acid molecules that
demonstrate some degree of complementarity. The specificity of hybridization is a direct function
of the stringency of the system in which the hybridization is being conducted.
Hydrogen bonding (see also Base-pairing): The highly directional attraction of an electropositive
hydrogen atom to an electronegative atom such as oxygen or nitrogen.
Hyperpolymer: A collection of labeled probe molecules that have hybridized to a target sequence and
with each other, in an overlapping fashion, such that a tail of labeled molecules is attached to the
target sequence. This phenomenon occurs when breakage of a nucleic acid occurs during labeling,
as in nick translation, or as a result of failure to seal the backbone during probe synthesis, as in
random priming. The effect is an amplification of the signal, which translates into shorter
autoradiographic exposure time. Because of this hyperpolymerization, a slight loss in resolution is
observed.
Ionizing radiation: Any radiation that displaces electrons from atoms or molecules, resulting in the
formation of ions; α, ß, and γ radiation are all forms of ionizing radiation.
Isotope: One of two or more atoms with the same atomic number but different atomic weights.
Library: A collection of clones that partially or completely represent the complexity of genomic DNA
or cDNA from a defined biological source, one or several members of which are of immediate
interest to the investigator. Members of the library, which consist of cDNA or genomic DNA
sequences ligated into a suitable vector, may be selected or retrieved from it by nucleic acid
hybridization or antibody recognition (in the case of expression vectors).
Methylmercuric hydroxide (Methyl mercury): An extremely toxic reagent used to denature RNA
before electrophoresis or other chromatographic application. Methylmercuric hydroxide should be
avoided in favor of other denaturation options whenever possible.
MOPS: (3-[N-morpholino]propanesulfonic acid): A key component of the buffering system used in
conjunction with formaldehyde/agarose gel electrophoresis of RNA.
Northern blot analysis: A technique for transferring electrophoretically chromat-orgraphed RNA from a
gel matrix, usually agarose, onto a filter paper, for subsequent immobilization and hybridization. The
information gained from Northern blot analysis is used to qualitatively and quantitatively assess the
expression of specific genes.
Oligonucleotide: A short, artificially synthesized, single-stranded DNA molecule that can function as
a nucleic acid probe or a molecular primer.
Phosphate buffered saline (PBS): An isotonic salt solution frequently used to wash residual growth
medium from a cell monolayer. 10X PBS (per liter) = 40 g NaCl, 1g KCl, 5.75g NaB
2BHPOB
4B, 1g
KHB
2BPOB
4B.
Photon: A particle that has no mass but is able to transfer electromagnetic energy.
Post-transcriptional regulation: Any event that occurs after transcription and influences any of the
subsequent steps involved in the ultimate expression of a gene. Reference to posttranscriptional

389. 389
regulation usually refers to events between the termination of transcription and before assembly of
the translation apparatus.
Post-translational regulation: Any event that occurs after synthesis of the primary peptide that
influences any of the subsequent steps involved in the ultimate expression of the gene. Reference to
post-translational regulation usually refers to the efficiency of the events that modify a peptide, such
as glycosylation, methylation, hydroxylation, and so forth.
Precursor RNA (also hnRNA or pre-mRNA): An unspliced RNA molecule; the primary product of
transcription.
Primer: A short nucleic acid molecule, which on base pairing with a complementary sequence,
provides a free 3'-OH for any of a variety of primer extension-dependent reactions.
Probe: Usually, labeled nucleic acid molecules, either DNA or RNA, used to hybridize to
complementary sequences in a library, or which are among the target sequences present in a nucleic
acid sample, as in the Northern blot, Southern blot, or nuclease protection analyses.
Quinone: Oxidation product of phenol. Quinones compromise the quality of RNA preparations by
cross linking nucleic acid molecules and breaking phosphodiester bonds.
Radiochemical: A chemical containing one or more radioactive atoms.
Radiolysis: The physical breakage of DNA or RNA probe that occurs when these molecules are
radiolabeled to extremely high specific activity. The degree of breakage is a direct function of the
elapsed time following probe synthesis.
Radionuclide: An unstable isotope of an element that decays spontaneously, and in so doing, emits
radiation.
Renaturation: The reassociation of denatured, complementary strands of DNA or RNA.
Retrovirus: A virus with an RNA genome that propagates via conversion of its genetic material into
double-stranded DNA.
Reverse transcriptase: Also known as RNA-dependent DNA polymerase. A retroviral enzyme that
polymerizes a cDNA molecule from an RNA template. A common shorthand for reverse
transcriptase is R. T'ase. Two types of reverse transcriptase are available: AMV (source: Avian
myeloblastosis virus) and M-MuLV (also M-MLV) (source: Moloney-Murine leukemia virus).
The M-MuLV variety lacks DNA endonuclease activity and is much lower in ribonuclease H
activity, thereby making it the preferred enzyme for cDNA synthesis reactions. More recently, a
polymerase from the thermophilic eubacterium Thermus thermophilus was found to possess a very
efficient reverse transcriptase activity at elevated temperature, and has been coupled successfully to
RNA amplification by the polymerase chain reaction also known as RT-PCR.
Ribonuclease (RNase): A family of resilient enzymes that rapidly degrade RNA molecules. Control
of RNase activity is a key consideration in all manipulations involving RNA.

390. 390
Ribonuclease A (RNase A): An enzyme with activity directed against single-stranded regions of RNA
(pyrimidine-specific); it cleaves (Py)pN bonds to yield a 3' phosphate.
Ribonucleic acid (RNA): A polymer of ribonucleoside monophosphates, synthesized by an RNA
polymerase. RNA is the product of transcription.
Sodium dodecyl sulfate (SDS): An ionic detergent (see specific protocols for buffer formulations).
Slot blot: A membrane-based technique for the quantification of specific RNA or DNA sequences in a
sample. The sample is usually "slot" configured onto a filter by vacuum filtration through a
manifold (see also dot blot). Slot blots lack the qualitative component associated with
electrophoretic assays.
Saline sodium citrate (SSC): A salt solution frequently used for blotting of nucleic acids and for post
hybridization washes (see specific protocols for buffer formulations).
Saline sodium phosphate-EDTA (SSPE): A salt solution frequently used for blotting of nucleic acids
and for post hybridization filter washes (see specific protocols for buffer formulations).
Southern blot analysis: A technique for transferring electrophoretically chromat-orgraphed DNA from a
gel matrix, usually agarose, onto a filter paper, for subsequent immobilization and hybridization. The
information gained from Southern blot analysis is used to qualitatively and quantitatively assess the
organization of specific genes or other loci.
Specific activity: The amount of radioactivity per unit mass of a radioactive material. It is most
frequently expressed in curies per millimole of material (Ci/mmol).
Stringency: A measure of the ability of double-stranded nucleic acid molecules to remain base-paired;
it is also a measure of the ability of single-stranded nucleic acid molecules to discriminate between
molecules with a high degree of complementarity. High stringency conditions favor stable
hybridization only between nucleic acid molecules with a high degree of complementarity. As
stringency is lowered, a proportional increase in nonspecific hybridization is favored.
Target: Single-stranded DNA or RNA sequences that are complementary to a nucleic acid probe.
Target sequences may be immobilized on a solid support or may be available for hybridization in
solution.
TEMED: N,N,N',N'-tetramethylethylene-diamine.
Template: A macromolecular informational blueprint for the synthesis of another macromolecule; one
of the strands of a particular gene locus acts as the template upon which RNA is polymerized.
TB
m B(melting temperature): That temperature at which 50% of all possible duplexes are dissociated into
their constituent single strands. In order to facilitate formation of all possible duplexes,
hybridization is conducted below the TB
mB-20 C.
Transcription: The process by which RNA molecules are synthesized from a DNA template.

391. 391
Translation: The process by which peptides are synthesized from the instructions encoded with an
RNA template.
Upstream: Sequences in the 5' direction in comparison with some reference point. For example, the
5'-cap in eukaryotic mRNA is located upstream from the initiation codon.
Vanadyl ribonucleoside complexes (VDR or VRC): An RNase inhibitor frequently added to gentle
RNA lysis buffers in order to control RNase activity. VDR functions as an RNA analog.
Western blot analysis: A technique for transferring electrophoretically chromat-orgraphed protein
from a polyacrylamide gel matrix onto a filter paper for subsequent characterization by antigen-anti-
body recognition. The information gained from Western blot analysis is used to qualitatively and
quantitatively assess the prevalence of specific polypeptides.
TABLE OF CONTENTS