SlideShare a Scribd company logo
A Practical Guide to the $1000
Genome
Michael Heltzen, CEO & Co-Founder
Shawn C. Baker, Ph.D., CSO & Co-Founder
The Sequencing Marketplace
Match researchers with sequencing providers
Neutral stance
Unique perspective
Where to start?
How do I communicate it?
Pick 2, but not all 3…
The lab’s side of the problem
Overcapacity…
What is our value proposition?
What is an optimal customer for us?
Buyers don’t know what they want?
How do I price?
Should I generalize or specialize?
Technologies and needs change all the time…
Lack of standards
Why are standards so hard for us as an industry?
How does AllSeq work?
AllSeq connect researcher
with NGS sequencing
needs, to the most optimal
lab for each case
It works like this
Project design
& QA
Offers &
Picking a lab
Match
& talks
Human
and
diseases
Virus
and
Bacteria
Plants
and
Animals
Over to Shawn and the $1000 Genome
The $1000 genome is here!
(sort of…)
The HiSeq X Ten: What is it?
Data output:
– 600 Gb/day
– 1.8 Tb/run
– ~5 whole human genomes/day
– 1800 genomes per year
Patterned flow cells
Improved optics
What’s the catch?
$1000 Genome
=
$800 – sequencing
$135 – amortization
$65 – library prep
$1000 Genome
= $1M
$1000 Genome
= $10M
1 day = $5000
=
1 year = $1,800,000
=
1 year= $18,000,000
=
4 years = $72,000,000
=
Allseq.com/1000-genome
…ACCATGATCTAGCCGATTTCGA…
…TGGTACTAGATCGGCTAAAGCT…
Whole Genome vs Exome
Whole Genome
~2.8Gb = ~ 95% coverage
…ACCATGATCTAGCCGATTTCGA…
…TGGTACTAGATCGGCTAAAGCT…
Exome Sequencing
~40Mb = ~ 1.3% coverage
…ACCATGATCTAGCCGATTTCGA…
…TGGTACTAGATCGGCTAAAGCT…
Whole Genome vs Exome
WGS Exome
Price ✓
Coverage ✓
Uniformity ✓
Analysis ✓
HiSeq X Ten Dataset
HiSeq X Ten Dataset
NA12878D and NA12878J – Coriell Cell
Repository
Illumina TruSeq Nano, 2X150bp, 350bp insert
>120Gb, 87% >Q30
Analyzing the Data
Primary
• Base calling
• QC
Secondary
• Assembly
• Alignment
Tertiary
• Annotations
• Visualization
• Statistics
Reporting
• Research
• Clinical
IT Infrastructure/Data Management
Analyzing the Data
Primary
• Base calling
• QC
Secondary
• Assembly
• Alignment
Tertiary
• Annotations
• Visualization
• Statistics
Reporting
• Research
• Clinical
IT Infrastructure/Data Management
Analyzing the Data
@EAS54_6_R1_2_1_413_324
CCCTTCTTGTCTTCAGCGTTTCTCC
+
;;3;;;;;;;;;;;;7;;;;;;;88
@EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
+
;;;;;;;;;;;7;;;;;-;;;3;83
@EAS54_6_R1_2_1_443_348
GTTGCTTCTGGCGTGGGTGGGGGGG
+EAS54_6_R1_2_1_443_348
;;;;;;;;;;;9;7;;.7;393333
fastq file:
Data Analysis & Interpretation
Medical report:
Example from knomeDISCOVERY
Analyzing the Data
Long Reads: PacBio
~2kb  ~10kb
Long Reads: Moleculo
Moleculo  TruSeq Synthetic Long Reads
10kb ‘synthetic’ reads
Long Reads: Oxford Nanopore
Single Cell/Cell-Free DNA Sequencing
Moving Beyond the Genome
Credits: Darryl Leja (NHGRI), Ian Dunham (EBI)
Topic: Researchers vs. clinical.
Trends: Transition to the Clinic
Increased output
Lower cost
Rapid updates
Ease of use
Quick TAT
Stability
Researchers Clinicians
Approval trend: Transition to the Clinic
MiSeq Dx
– FDA clearance Nov 2013
– Will also submit 2500 and
NIPT assay
PGM
– Listed with FDA Sept 2014
Opportunities and challenges
What is great
– We are getting there…
– It is going faster and better/cheaper/faster
– More and more people are starting to understand
What is not so great
– We are not there yet
– We are not even as far as many people think we are
– Lack of standards (especially for the clinical market)
First: The bad part
Technical error sources:
– Sampling
– Sequencing
– Bioinformatics
– Interpretation
Lack of standards…
Then: The good part
Large steps in the right direction on all
fronts. Is it only a matter of time now…
The new genomics technologies are
slowly getting ripe for the clinic!
We are collectively making the world a
better place!
www.allseq.com
@allseq
info@allseq.com

More Related Content

What's hot

Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical Research
David Ruau
 

What's hot (20)

SLAS Ultra-High-Throughput Screening Special Interest Group SLAS2017 Presenta...
SLAS Ultra-High-Throughput Screening Special Interest Group SLAS2017 Presenta...SLAS Ultra-High-Throughput Screening Special Interest Group SLAS2017 Presenta...
SLAS Ultra-High-Throughput Screening Special Interest Group SLAS2017 Presenta...
 
SLAS Screen Design and Assay Technology Special Interest Group SLAS2017 Prese...
SLAS Screen Design and Assay Technology Special Interest Group SLAS2017 Prese...SLAS Screen Design and Assay Technology Special Interest Group SLAS2017 Prese...
SLAS Screen Design and Assay Technology Special Interest Group SLAS2017 Prese...
 
2015 aem-grs-keynote
2015 aem-grs-keynote2015 aem-grs-keynote
2015 aem-grs-keynote
 
Phylogenetics: Making publication-quality tree figures
Phylogenetics: Making publication-quality tree figuresPhylogenetics: Making publication-quality tree figures
Phylogenetics: Making publication-quality tree figures
 
2014 bangkok-talk
2014 bangkok-talk2014 bangkok-talk
2014 bangkok-talk
 
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
 
2015 genome-center
2015 genome-center2015 genome-center
2015 genome-center
 
Giab ashg webinar 160224
Giab ashg webinar 160224Giab ashg webinar 160224
Giab ashg webinar 160224
 
ASHG 2015 Genome in a bottle
ASHG 2015 Genome in a bottleASHG 2015 Genome in a bottle
ASHG 2015 Genome in a bottle
 
3b. Biotechnolgies & Genomics - Jane Theaker
3b. Biotechnolgies & Genomics - Jane Theaker3b. Biotechnolgies & Genomics - Jane Theaker
3b. Biotechnolgies & Genomics - Jane Theaker
 
Genome simulation and applications
Genome simulation and applicationsGenome simulation and applications
Genome simulation and applications
 
GIAB-GRC workshop oct2015 giab introduction 151005
GIAB-GRC workshop oct2015 giab introduction 151005GIAB-GRC workshop oct2015 giab introduction 151005
GIAB-GRC workshop oct2015 giab introduction 151005
 
160627 giab for festival sv workshop
160627 giab for festival sv workshop160627 giab for festival sv workshop
160627 giab for festival sv workshop
 
Advancements in Wireless Technology for Single Unit Electrophysiology Recording
Advancements in Wireless Technology for Single Unit Electrophysiology RecordingAdvancements in Wireless Technology for Single Unit Electrophysiology Recording
Advancements in Wireless Technology for Single Unit Electrophysiology Recording
 
Jan2016 bina giab
Jan2016 bina giabJan2016 bina giab
Jan2016 bina giab
 
160628 giab for festival of genomics
160628 giab for festival of genomics160628 giab for festival of genomics
160628 giab for festival of genomics
 
Aug2015 salit standards architecture
Aug2015 salit standards architectureAug2015 salit standards architecture
Aug2015 salit standards architecture
 
Sreevani reddy bio pharmacy-bioinformatics-201902
Sreevani reddy bio pharmacy-bioinformatics-201902Sreevani reddy bio pharmacy-bioinformatics-201902
Sreevani reddy bio pharmacy-bioinformatics-201902
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical Research
 
Development of FDA MicroDB: A Regulatory-Grade Microbial Reference Database
Development of FDA MicroDB: A Regulatory-Grade Microbial Reference DatabaseDevelopment of FDA MicroDB: A Regulatory-Grade Microbial Reference Database
Development of FDA MicroDB: A Regulatory-Grade Microbial Reference Database
 

Viewers also liked

A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.
mkim8
 
Illumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencingIllumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencing
Cristian Cosentino, PhD
 

Viewers also liked (20)

A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.
 
Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platforms
 
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and Variants
 
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
 
NGx Sequencing 101-platforms
NGx Sequencing 101-platformsNGx Sequencing 101-platforms
NGx Sequencing 101-platforms
 
Illumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencingIllumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencing
 
Next-generation sequencing from 2005 to 2020
Next-generation sequencing from 2005 to 2020Next-generation sequencing from 2005 to 2020
Next-generation sequencing from 2005 to 2020
 
The Application of Next Generation Sequencing (NGS) in cancer treatment
The Application of Next Generation Sequencing (NGS) in cancer treatmentThe Application of Next Generation Sequencing (NGS) in cancer treatment
The Application of Next Generation Sequencing (NGS) in cancer treatment
 
Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS
Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGSCurso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS
Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS
 
Ngs intro_v6_public
 Ngs intro_v6_public Ngs intro_v6_public
Ngs intro_v6_public
 
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology Overview
 
Operating Systems - File Management
Operating Systems -  File ManagementOperating Systems -  File Management
Operating Systems - File Management
 
The Ultimate Guide to Creating Visually Appealing Content
The Ultimate Guide to Creating Visually Appealing ContentThe Ultimate Guide to Creating Visually Appealing Content
The Ultimate Guide to Creating Visually Appealing Content
 
Masters of SlideShare
Masters of SlideShareMasters of SlideShare
Masters of SlideShare
 
Halal logistics in malaysia and 5 continents
Halal logistics  in malaysia and 5 continentsHalal logistics  in malaysia and 5 continents
Halal logistics in malaysia and 5 continents
 
Les 5 forces de porter - comprendre l'outil
Les 5 forces de porter - comprendre l'outilLes 5 forces de porter - comprendre l'outil
Les 5 forces de porter - comprendre l'outil
 
10 Ways to Win at SlideShare SEO & Presentation Optimization
10 Ways to Win at SlideShare SEO & Presentation Optimization10 Ways to Win at SlideShare SEO & Presentation Optimization
10 Ways to Win at SlideShare SEO & Presentation Optimization
 

Similar to Practical Guide to the $1000 Genome (2014)

BioAssay Express: Creating and exploiting assay metadata
BioAssay Express: Creating and exploiting assay metadataBioAssay Express: Creating and exploiting assay metadata
BioAssay Express: Creating and exploiting assay metadata
Philip Cheung
 
Insights from Building the Future of Drug Discovery with Apache Spark with Lu...
Insights from Building the Future of Drug Discovery with Apache Spark with Lu...Insights from Building the Future of Drug Discovery with Apache Spark with Lu...
Insights from Building the Future of Drug Discovery with Apache Spark with Lu...
Databricks
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astro
webuploader
 
Building Secure Analysis and Storage Systems with Golden Helix
Building Secure Analysis and Storage Systems with Golden HelixBuilding Secure Analysis and Storage Systems with Golden Helix
Building Secure Analysis and Storage Systems with Golden Helix
Golden Helix
 
Letting Science Drive Technology at GlaxoSmithKline
Letting Science Drive Technology at GlaxoSmithKlineLetting Science Drive Technology at GlaxoSmithKline
Letting Science Drive Technology at GlaxoSmithKline
Docker, Inc.
 

Similar to Practical Guide to the $1000 Genome (2014) (20)

Next Gen Clinical Data Sciences
Next Gen Clinical Data SciencesNext Gen Clinical Data Sciences
Next Gen Clinical Data Sciences
 
Is one enough? Data warehousing for biomedical research
Is one enough? Data warehousing for biomedical researchIs one enough? Data warehousing for biomedical research
Is one enough? Data warehousing for biomedical research
 
MedChemica BigData What Is That All About?
MedChemica BigData What Is That All About?MedChemica BigData What Is That All About?
MedChemica BigData What Is That All About?
 
BioAssay Express: Creating and exploiting assay metadata
BioAssay Express: Creating and exploiting assay metadataBioAssay Express: Creating and exploiting assay metadata
BioAssay Express: Creating and exploiting assay metadata
 
Insights from Building the Future of Drug Discovery with Apache Spark with Lu...
Insights from Building the Future of Drug Discovery with Apache Spark with Lu...Insights from Building the Future of Drug Discovery with Apache Spark with Lu...
Insights from Building the Future of Drug Discovery with Apache Spark with Lu...
 
All In - Migrating a Genomics Pipeline from BASH/Hive to Spark (Azure Databri...
All In - Migrating a Genomics Pipeline from BASH/Hive to Spark (Azure Databri...All In - Migrating a Genomics Pipeline from BASH/Hive to Spark (Azure Databri...
All In - Migrating a Genomics Pipeline from BASH/Hive to Spark (Azure Databri...
 
High Performance Computing and the Opportunity with Cognitive Technology
 High Performance Computing and the Opportunity with Cognitive Technology High Performance Computing and the Opportunity with Cognitive Technology
High Performance Computing and the Opportunity with Cognitive Technology
 
CINECA webinar slides: Modular and reproducible workflows for federated molec...
CINECA webinar slides: Modular and reproducible workflows for federated molec...CINECA webinar slides: Modular and reproducible workflows for federated molec...
CINECA webinar slides: Modular and reproducible workflows for federated molec...
 
AIQC - ISCB 2022.pdf
AIQC - ISCB 2022.pdfAIQC - ISCB 2022.pdf
AIQC - ISCB 2022.pdf
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astro
 
informatics_future.pdf
informatics_future.pdfinformatics_future.pdf
informatics_future.pdf
 
Using Machine Learning to Automate Clinical Pathways
Using Machine Learning to Automate Clinical PathwaysUsing Machine Learning to Automate Clinical Pathways
Using Machine Learning to Automate Clinical Pathways
 
Life sciences big data use cases
Life sciences big data use casesLife sciences big data use cases
Life sciences big data use cases
 
Finding Emerging Topics Using Chaos and Community Detection in Social Media G...
Finding Emerging Topics Using Chaos and Community Detection in Social Media G...Finding Emerging Topics Using Chaos and Community Detection in Social Media G...
Finding Emerging Topics Using Chaos and Community Detection in Social Media G...
 
Building Secure Analysis and Storage Systems with Golden Helix
Building Secure Analysis and Storage Systems with Golden HelixBuilding Secure Analysis and Storage Systems with Golden Helix
Building Secure Analysis and Storage Systems with Golden Helix
 
Letting Science Drive Technology at GlaxoSmithKline
Letting Science Drive Technology at GlaxoSmithKlineLetting Science Drive Technology at GlaxoSmithKline
Letting Science Drive Technology at GlaxoSmithKline
 
Data Warehousing in Pharma: How to Find Bad Data while Meeting Regulatory Req...
Data Warehousing in Pharma: How to Find Bad Data while Meeting Regulatory Req...Data Warehousing in Pharma: How to Find Bad Data while Meeting Regulatory Req...
Data Warehousing in Pharma: How to Find Bad Data while Meeting Regulatory Req...
 
tranSMART Community Meeting 5-7 Nov 13 - Session 3: Pfizer’s Recent Use of tr...
tranSMART Community Meeting 5-7 Nov 13 - Session 3: Pfizer’s Recent Use of tr...tranSMART Community Meeting 5-7 Nov 13 - Session 3: Pfizer’s Recent Use of tr...
tranSMART Community Meeting 5-7 Nov 13 - Session 3: Pfizer’s Recent Use of tr...
 
Pistoia alliance debates analytics 15-09-2015 16.00
Pistoia alliance debates   analytics 15-09-2015 16.00Pistoia alliance debates   analytics 15-09-2015 16.00
Pistoia alliance debates analytics 15-09-2015 16.00
 
2015 bioinformatics personal_genomics_wim_vancriekinge
2015 bioinformatics personal_genomics_wim_vancriekinge2015 bioinformatics personal_genomics_wim_vancriekinge
2015 bioinformatics personal_genomics_wim_vancriekinge
 

Recently uploaded

Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Sérgio Sacani
 
The importance of continents, oceans and plate tectonics for the evolution of...
The importance of continents, oceans and plate tectonics for the evolution of...The importance of continents, oceans and plate tectonics for the evolution of...
The importance of continents, oceans and plate tectonics for the evolution of...
Sérgio Sacani
 
Pests of sugarcane_Binomics_IPM_Dr.UPR.pdf
Pests of sugarcane_Binomics_IPM_Dr.UPR.pdfPests of sugarcane_Binomics_IPM_Dr.UPR.pdf
Pests of sugarcane_Binomics_IPM_Dr.UPR.pdf
PirithiRaju
 
extra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdfextra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdf
DiyaBiswas10
 
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
Scintica Instrumentation
 
Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...
Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...
Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...
muralinath2
 
Pests of Green Manures_Bionomics_IPM_Dr.UPR.pdf
Pests of Green Manures_Bionomics_IPM_Dr.UPR.pdfPests of Green Manures_Bionomics_IPM_Dr.UPR.pdf
Pests of Green Manures_Bionomics_IPM_Dr.UPR.pdf
PirithiRaju
 
Mammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also FunctionsMammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also Functions
YOGESH DOGRA
 

Recently uploaded (20)

Lab report on liquid viscosity of glycerin
Lab report on liquid viscosity of glycerinLab report on liquid viscosity of glycerin
Lab report on liquid viscosity of glycerin
 
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
 
Topography and sediments of the floor of the Bay of Bengal
Topography and sediments of the floor of the Bay of BengalTopography and sediments of the floor of the Bay of Bengal
Topography and sediments of the floor of the Bay of Bengal
 
The importance of continents, oceans and plate tectonics for the evolution of...
The importance of continents, oceans and plate tectonics for the evolution of...The importance of continents, oceans and plate tectonics for the evolution of...
The importance of continents, oceans and plate tectonics for the evolution of...
 
Shuaib Y-basedComprehensive mahmudj.pptx
Shuaib Y-basedComprehensive mahmudj.pptxShuaib Y-basedComprehensive mahmudj.pptx
Shuaib Y-basedComprehensive mahmudj.pptx
 
Citrus Greening Disease and its Management
Citrus Greening Disease and its ManagementCitrus Greening Disease and its Management
Citrus Greening Disease and its Management
 
SCHIZOPHRENIA Disorder/ Brain Disorder.pdf
SCHIZOPHRENIA Disorder/ Brain Disorder.pdfSCHIZOPHRENIA Disorder/ Brain Disorder.pdf
SCHIZOPHRENIA Disorder/ Brain Disorder.pdf
 
National Biodiversity protection initiatives and Convention on Biological Di...
National Biodiversity protection initiatives and  Convention on Biological Di...National Biodiversity protection initiatives and  Convention on Biological Di...
National Biodiversity protection initiatives and Convention on Biological Di...
 
SAMPLING.pptx for analystical chemistry sample techniques
SAMPLING.pptx for analystical chemistry sample techniquesSAMPLING.pptx for analystical chemistry sample techniques
SAMPLING.pptx for analystical chemistry sample techniques
 
Predicting property prices with machine learning algorithms.pdf
Predicting property prices with machine learning algorithms.pdfPredicting property prices with machine learning algorithms.pdf
Predicting property prices with machine learning algorithms.pdf
 
INSIGHT Partner Profile: Tampere University
INSIGHT Partner Profile: Tampere UniversityINSIGHT Partner Profile: Tampere University
INSIGHT Partner Profile: Tampere University
 
Pests of sugarcane_Binomics_IPM_Dr.UPR.pdf
Pests of sugarcane_Binomics_IPM_Dr.UPR.pdfPests of sugarcane_Binomics_IPM_Dr.UPR.pdf
Pests of sugarcane_Binomics_IPM_Dr.UPR.pdf
 
Transport in plants G1.pptx Cambridge IGCSE
Transport in plants G1.pptx Cambridge IGCSETransport in plants G1.pptx Cambridge IGCSE
Transport in plants G1.pptx Cambridge IGCSE
 
Comparative structure of adrenal gland in vertebrates
Comparative structure of adrenal gland in vertebratesComparative structure of adrenal gland in vertebrates
Comparative structure of adrenal gland in vertebrates
 
Hemoglobin metabolism_pathophysiology.pptx
Hemoglobin metabolism_pathophysiology.pptxHemoglobin metabolism_pathophysiology.pptx
Hemoglobin metabolism_pathophysiology.pptx
 
extra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdfextra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdf
 
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
 
Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...
Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...
Circulatory system_ Laplace law. Ohms law.reynaults law,baro-chemo-receptors-...
 
Pests of Green Manures_Bionomics_IPM_Dr.UPR.pdf
Pests of Green Manures_Bionomics_IPM_Dr.UPR.pdfPests of Green Manures_Bionomics_IPM_Dr.UPR.pdf
Pests of Green Manures_Bionomics_IPM_Dr.UPR.pdf
 
Mammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also FunctionsMammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also Functions
 

Practical Guide to the $1000 Genome (2014)

Editor's Notes

  1. Often “don’t know where to start”? What is my need? That service provider is the best for me… Even the experienced people get confused…
  2. How do I communicate it (and the providers different lingo and tech terms). It is not just technical things, but also the practical things… Do I really have to speak to all those people…
  3. You can often just pick two of the following: price, turnaround time and quality * Quality is different from buyer to buyer.
  4. Use our online software to make a “Project Design” of your sequencing project Get QA and questions from AllSeq if relevant Get matched with 5-10 of the most optimal labs Get prices and terms + chat/write with them directly
  5. We see all kinds of projects: Human and disease, plants and animals & virus, fungus and bacteria. This year we have had app. 100 sequencing projects that have been entered on the marketplace.
  6. Huge area of development Show overall spectrum of analysis and scope of who covers what Focus on the annotation and reporting
  7. Huge area of development Show overall spectrum of analysis and scope of who covers what Focus on the annotation and reporting
  8. Process discussion with your doctor sample collection sample prep sequencing data analysis data interpretation
  9. MAP = 500 labs High error rates (~20-25%), but improving Outputs ~200-500Mb, 1Gb internal runs PromethION = multiple ASICs or flow cells Up to 100k pores Could generate 300-400Gb per day
  10. Just the beginning Trascriptome, Epigenome, Metagenome
  11. How are researchers and clinical people different – progress and updates vs. stability and be consistent (due to liability) Why is a researcher work in the hospital not always a clinical case – as it is research Where is the doctor and geneticist in all of this – how is the set up….
  12. Technical error sources: Sampling: Single cell single molecule Sequencing technologies (application, short reads, different error profiles) Bioinformatics (less than optimal reference genomes and databases) Lack of standards, so people are on the same page when it comes to the errors