A Genome Sequence Analysis System Built With Hypertable
•Download as PPT, PDF•
0 likes•1,055 views
The document describes a genome sequence analysis system built using Hypertable to store and analyze genomic sequence data from biological samples. The system uses a NoSQL database and schema design to store taxonomic data, sequence reads, genes and alignments. It enables applications like novel virus discovery, pathogen discovery in cancer samples, and a future depletion array technique.
Report
Share
Report
Share
![Application Development Team ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Recommended
A Genome Sequence Analysis System Built with Hypertable
Deep genome sequencing has revolutionized the fields of biology and medicine. Since January 2008, the capacity to generate sequence data has increased exponentially, far outpacing Moore's Law. The emergence of scalable NoSQL database technologies has made the analysis of this vast amount of sequence data not only feasible, but cost effective.
The University of California at San Francisco UCSF-Abbott Viral Detection and Discovery Center, led by director Charles Chiu, MD, PhD, Taylor Sittler, MD and the Hypertable development team have embarked upon a project to build a scalable software platform to facilitate deep sequencing analysis in diagnostic microbiology, transcriptomic analysis, and clinical / environmental metagenomics, areas for which existing commercial and academic solutions are sorely lacking. Doug Judd, the original creator of Hypertable, will present an overview of this genome sequencing analysis system. The presentation will cover the following topics:
Rationale for choosing NoSQL
Schema design
Sources and description of input data
Algorithms for generating and querying lookup tables
Table sizes and compression ratios
Lessons learned during system deployment
Practical Guide to the $1000 Genome (2014)
This document discusses the progress toward achieving the $1000 whole human genome and the challenges still remaining. It provides an overview of sequencing technologies like the HiSeq X Ten that can sequence a genome for around $1000 but requires large upfront investment. While costs are decreasing and technologies improving, lack of standards still pose issues for clinical adoption. However, trends toward more output, lower costs, and easier use point to genomics gradually becoming established in healthcare.
DATA ANALYSIS SOFTWARE: METAPY
1. The document compares the performance of different clustering tools and databases for classifying sequences from a known sample of 10 Phytophthora species.
2. It finds that Bowtie and DADA2 produced fewer misclassifications than other tools, while Blastclust performed the worst with high false positive rates.
3. Database quality was also shown to impact results, with trimmed databases focused on the ITS1 region outperforming those including non-target sequences.
ECCB 2014: Extracting patterns of database and software usage from the bioinf...
Presentation given at ECCB 2014, presenting my paper:
http://bioinformatics.oxfordjournals.org/content/30/17/i601.full
A Distributed Annotation Pipeline for MSSNG
Presented at the Analyze Boulder meet up in August, 2015, this presentation introduces the genome annotation pipeline built by BioTeam (https://bioteam.net) in support of Autism Speaks' MSSNG project. Built entirely on Google infrastructure it allows the MSSNG researchers to go from 10 Billion genome variants down to a more manageable 38 Million variants. These are then annotated with known biological information and integrated into the MSSNG Portal (https://research.mss.ng) for subsequent exploration and analysis.
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
In 2001, it cost ~$100M to sequence a single human genome. In 2014, due to dramatic improvements in sequencing technology far outpacing Moore’s law, we entered the era of the $1,000 genome. At the same time, the power of genetics to impact medicine has become evident. For example, drugs with supporting genetic evidence are twice as likely to succeed in clinical trials. These factors have led to an explosion in the volume of genetic data, in the face of which existing analysis tools are breaking down.
As a result, the Broad Institute began the open-source Hail project (https://hail.is), a scalable platform built on Apache Spark, to enable the worldwide genetics community to build, share and apply new tools. Hail is focused on variant-level (post-read) data; querying genetic data, as well as annotations, on variants and samples; and performing rare and common variant association analyses. Hail has already been used to analyze datasets with hundreds of thousands of exomes and tens of thousands of whole genomes, enabling dozens of major research projects.
vectorQC: 'A pipeline for assembling and annotation of vectors'
DNA vectors are widely used in molecular cloning, gene engineering, studies of gene expression and other applications. Sequence validation of a vector DNA is a crucial quality control step before using the vector. With the cost of sequencing rapidly decreasing it becomes cost-effective to ensure the vectors quality using high-throughput sequencing and bioinformatics analysis. VectorQC is an automatic pipeline for quality control of a collection of sequenced DNA vectors. The pipeline is built using the NextFlow framework and is distributed with the Docker container, which makes the pipeline easy to install, modify, and re-use on any Unix-compatible OS on a computer, cluster or cloud
Reorganizing the pacing guide
The document discusses reorganizing a pacing guide for inputting curriculum into a Curriculum Manager tool. It suggests structuring stories into units with no more than a few stories per unit. It provides directions to highlight skills in the pacing guide, label stories with difficulty levels, cut out and categorize stories by skills, and determine the order of skills and "odd ball" stories. The goal is to finalize a sequence and units of stories to input targets and resources for lessons in the Curriculum Manager tool.
Recommended
A Genome Sequence Analysis System Built with Hypertable
Deep genome sequencing has revolutionized the fields of biology and medicine. Since January 2008, the capacity to generate sequence data has increased exponentially, far outpacing Moore's Law. The emergence of scalable NoSQL database technologies has made the analysis of this vast amount of sequence data not only feasible, but cost effective.
The University of California at San Francisco UCSF-Abbott Viral Detection and Discovery Center, led by director Charles Chiu, MD, PhD, Taylor Sittler, MD and the Hypertable development team have embarked upon a project to build a scalable software platform to facilitate deep sequencing analysis in diagnostic microbiology, transcriptomic analysis, and clinical / environmental metagenomics, areas for which existing commercial and academic solutions are sorely lacking. Doug Judd, the original creator of Hypertable, will present an overview of this genome sequencing analysis system. The presentation will cover the following topics:
Rationale for choosing NoSQL
Schema design
Sources and description of input data
Algorithms for generating and querying lookup tables
Table sizes and compression ratios
Lessons learned during system deployment
Practical Guide to the $1000 Genome (2014)
This document discusses the progress toward achieving the $1000 whole human genome and the challenges still remaining. It provides an overview of sequencing technologies like the HiSeq X Ten that can sequence a genome for around $1000 but requires large upfront investment. While costs are decreasing and technologies improving, lack of standards still pose issues for clinical adoption. However, trends toward more output, lower costs, and easier use point to genomics gradually becoming established in healthcare.
DATA ANALYSIS SOFTWARE: METAPY
1. The document compares the performance of different clustering tools and databases for classifying sequences from a known sample of 10 Phytophthora species.
2. It finds that Bowtie and DADA2 produced fewer misclassifications than other tools, while Blastclust performed the worst with high false positive rates.
3. Database quality was also shown to impact results, with trimmed databases focused on the ITS1 region outperforming those including non-target sequences.
ECCB 2014: Extracting patterns of database and software usage from the bioinf...
Presentation given at ECCB 2014, presenting my paper:
http://bioinformatics.oxfordjournals.org/content/30/17/i601.full
A Distributed Annotation Pipeline for MSSNG
Presented at the Analyze Boulder meet up in August, 2015, this presentation introduces the genome annotation pipeline built by BioTeam (https://bioteam.net) in support of Autism Speaks' MSSNG project. Built entirely on Google infrastructure it allows the MSSNG researchers to go from 10 Billion genome variants down to a more manageable 38 Million variants. These are then annotated with known biological information and integrated into the MSSNG Portal (https://research.mss.ng) for subsequent exploration and analysis.
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
In 2001, it cost ~$100M to sequence a single human genome. In 2014, due to dramatic improvements in sequencing technology far outpacing Moore’s law, we entered the era of the $1,000 genome. At the same time, the power of genetics to impact medicine has become evident. For example, drugs with supporting genetic evidence are twice as likely to succeed in clinical trials. These factors have led to an explosion in the volume of genetic data, in the face of which existing analysis tools are breaking down.
As a result, the Broad Institute began the open-source Hail project (https://hail.is), a scalable platform built on Apache Spark, to enable the worldwide genetics community to build, share and apply new tools. Hail is focused on variant-level (post-read) data; querying genetic data, as well as annotations, on variants and samples; and performing rare and common variant association analyses. Hail has already been used to analyze datasets with hundreds of thousands of exomes and tens of thousands of whole genomes, enabling dozens of major research projects.
vectorQC: 'A pipeline for assembling and annotation of vectors'
DNA vectors are widely used in molecular cloning, gene engineering, studies of gene expression and other applications. Sequence validation of a vector DNA is a crucial quality control step before using the vector. With the cost of sequencing rapidly decreasing it becomes cost-effective to ensure the vectors quality using high-throughput sequencing and bioinformatics analysis. VectorQC is an automatic pipeline for quality control of a collection of sequenced DNA vectors. The pipeline is built using the NextFlow framework and is distributed with the Docker container, which makes the pipeline easy to install, modify, and re-use on any Unix-compatible OS on a computer, cluster or cloud
Reorganizing the pacing guide
The document discusses reorganizing a pacing guide for inputting curriculum into a Curriculum Manager tool. It suggests structuring stories into units with no more than a few stories per unit. It provides directions to highlight skills in the pacing guide, label stories with difficulty levels, cut out and categorize stories by skills, and determine the order of skills and "odd ball" stories. The goal is to finalize a sequence and units of stories to input targets and resources for lessons in the Curriculum Manager tool.
Bioinformatics MiRON
This document provides an overview and introduction to bioinformatics. It discusses the large amounts of biological sequence data that have been generated and how bioinformatics is needed to analyze this data computationally. The document outlines topics that will be covered, including databases, sequence alignment tools like BLAST, gene finding, and protein analysis. Practical workshops are described that will involve database searching, multiple sequence alignments, and interpreting results to understand molecular biology and solve biomedical problems. Questions are welcomed throughout the workshops.
poster
The document describes genomic analysis of Clostridium difficile (C. difficile) isolates to understand the emergence of pathogenicity. 17 C. difficile isolates were sequenced and assembled genomes were obtained. Comparative genomics identified genetic changes like horizontal gene transfer and recombination associated with antibiotic resistance and virulence traits. Machine learning will be used to analyze genomic features and predict the origin and evolution of pathogenic isolates.
NCBI
The National Center for Biotechnology Information (NCBI) was created in 1988 as part of the National Library of Medicine at NIH. It establishes public databases for biological research, develops software tools for sequence analysis, and disseminates biomedical information from its location in Bethesda, MD. NCBI houses several integrated databases including PubMed, GenBank, RefSeq, and UniGene that contain literature, sequences, gene information, and more.
2013 pag-equine-workshop
This document provides an overview and discussion of next-generation sequencing technologies by C. Titus Brown. It begins by outlining some basics of shotgun sequencing and how increasing density leads to squared increases in the number of sequences obtained. It then discusses current costs for Illumina sequencing and the amount of data needed for different applications. Some challenges and problems with sequencing data are also reviewed, such as systematic bias, genome assembly and scaffolding difficulties, reference gene models, and mRNA isoform construction. Emerging long-read sequencing technologies are also briefly discussed.
Dgaston dec-06-2012
This document provides an overview of RNA-Seq analysis. It begins with considerations for RNA-Seq experiments such as computational requirements. It then describes the general RNA-Seq analysis workflow including short-read alignment, transcript reconstruction, abundance estimation, visualization, and statistics. The document focuses on explaining the "Tuxedo" analysis pipeline which includes Bowtie, Tophat, Cufflinks, Cuffmerge, Cuffdiff and CummeRbund. It provides examples of commands for each step and discusses alternative tools. The document concludes with resources for further information on RNA-Seq analysis.
Cool Informatics Tools and Services for Biomedical Research
This document provides an overview of bioinformatics tools and services for analyzing big data in biomedical research. It discusses traditional bioinformatics tools, analyzing genomic data from microarrays and next-generation sequencing without and with code, interpreting results using protein interaction networks and pathways, tools for data storage, cleaning and visualization, and making research reproducible. Galaxy, R, and programming are presented as useful for automated, reproducible analysis of large genomic datasets.
Using VarSeq to Improve Variant Analysis Research Workflows
Many questions must be answered when analyzing DNA sequence variants: How do I determine which variants are potentially deleterious? Is the sequencing quality sufficient? How do I prioritize the results? Which annotation sources may help answer my research question?
In this webinar presentation, we will review workflow strategies for quality control and analysis of DNA sequence variants using the VarSeq software package from Golden Helix. VarSeq is a powerful platform for analysis of DNA sequence variants in clinical and translational research settings. VarSeq provides researchers with easy access to curated public databases of variant annotation information, and also enables users to incorporate their own local databases or downloaded information about variants and genomic regions.
The presentation will include interactive demonstrations using VarSeq to analyze variants found by exome sequencing of an extended family with a complex disease. We will review strategies for assessing variant quality, applying genomic annotations, incorporating custom annotation sources, and creating variant filters in VarSeq. We will also demonstrate the PhoRank gene ranking algorithm and its application for prioritizing variants.
Using VarSeq to Improve Variant Analysis Research Workflows
In this webinar presentation, we will review workflow strategies for quality control and analysis of DNA sequence variants using the VarSeq software package from Golden Helix. VarSeq is a powerful platform for analysis of DNA sequence variants in clinical and translational research settings. VarSeq provides researchers with easy access to curated public databases of variant annotation information, and also enables users to incorporate their own local databases or downloaded information about variants and genomic regions.
Biomart Update
The document discusses BioMart, a data warehousing system that allows querying of biological data from multiple sources. It summarizes recent developments including MartBuilder for constructing data warehouses, MartView for viewing and querying data, and APIs and web services for programmatic access. It also outlines future plans such as a new configuration system and GUI framework to improve scalability, customizability, and user experience.
MutaDATABASE
The MutaDATABASE project aims to create a centralized and standardized database of human gene mutations called MutaDATABASE. It will collect all known human gene mutations related to monogenic diseases from existing databases and laboratories. The goal is for MutaDATABASE to become the most comprehensive mutation database by making submission of new mutations easy and encouraging participation. Key aspects include standardized formats, central access, free sharing of mutation data, and supporting software and groups to facilitate data sharing and review.
Bioinformatics t2-databases v2014
- The document outlines topics related to molecular biology databases including flat file sequence databases containing DNA, protein, and structure data, as well as relational databases.
- Examples of flat file formats like GenBank format are provided, showing how sequence data is stored in plain text files. Examples of sequence database resources like GenBank, EMBL, and DDBJ are also listed.
- The use of quality values assigned by Phred to base calls in DNA sequencing traces is discussed, and how these values are used by Phrap to determine consensus sequences from aligning multiple reads.
Bioinformatica t2-databases
This document provides an overview of bioinformatics databases and file formats for storing genetic sequence data. It discusses flat file databases like GenBank that store sequences in plain text formats. It also describes relational databases that allow querying across related data fields. Examples of biological relational databases and tools for working with sequence data files are also presented.
Practical 7 dna, rna and the flow of genetic information5
This document is a lab report for a biochemistry course that discusses DNA, RNA, and genetic information. The report summarizes databases that contain DNA and protein sequences, such as NCBI. It also discusses analyzing a DNA sequence to find an open reading frame and identify the encoded protein. Finally, the report discusses using BLAST to find homologous sequences and determine if sequences are homologous based on percent identity and E-values.
2012 03 01_bioinformatics_ii_les1
The document provides information about a bioinformatics course including the syllabus, topics, and schedule. The course focuses on using relational databases to manage and analyze large biological datasets. Topics include relation databases, web application development, genome browsers, text mining, and systems biology. The schedule lists the topics to be covered each class over 12 weeks from March to May.
Ashg2014 grc workshop_schneider
The document discusses updates to the human reference genome assembly GRCh38. It provides background on reference assemblies and describes how the Genome Reference Consortium manages and models genome assemblies. Key points include that GRCh38 contains refined centromere regions based on new data, novel sequence detections, and 261 alternate loci representing structural variants. The assembly is now incorporated into public sequence databases to improve access and use of the reference genome data.
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Torsten Seemann discussed bioinformatic tools for diagnostic laboratories using whole genome sequencing (WGS). He explained that WGS generates large amounts of sequencing reads that can be assembled de novo or aligned to references to identify single nucleotide polymorphisms (SNPs) and characterize genomes. Key applications of WGS include diagnostic identification, antimicrobial resistance profiling, virulence factor detection, and high-resolution epidemiological typing through SNP analysis and phylogenetic trees. Seemann emphasized that WGS analysis requires metadata, domain expertise, and open data sharing for maximum public health benefit.
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ is a parallel implementation of the MAQ reference assembler that leverages Hadoop and MapReduce to enable MAQ to run in a distributed, parallel manner on large datasets. It addresses the computational challenges of reference assembly by splitting the input reads into chunks that are processed simultaneously. The MAQ algorithm is used to align reads to a reference sequence and call consensus genotypes. HPC-MAQ allows MAQ to scale to larger genomes by distributing the work across multiple nodes in a Hadoop cluster.
B Chapman - Toolkit for variation comparison and analysis
The document describes a toolkit for comparing variant calls from different variant callers and sequencing technologies. It proposes establishing a set of true variants by comparing calls across multiple callers and technologies on gold standard genomes. The toolkit includes a comparison architecture that analyzes variants, identifies real variants by summarizing metrics, and scales to large numbers of variants and samples. It also describes building analysis pipelines in Clojure and providing comparison results through a web interface with metrics. The goal is to help answer biological questions by determining true variants and prioritizing based on existing evidence.
Long vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is poised to replace short read
sequencing (e.g. Illumina).
a. What is the typical read length in short read sequencing, and what is the read length range for
long range sequencing?
b. What are the downsides for using short read sequencing for genome assembly/SNP calling,
and RNA isoform discovery/quantification?
c. Which genomic protocols and/or applications are expected to benefit the most from long read
sequencing?
1. Sequencing DNA that are accessible (e.g. ATAC-seq/DNASE-seq).
2. Measuring histone modifications (e.g. for ChIP-seq).
3. Measuring gene expression levels.
4. Measuring messenger RNA isoform diversity.
5. DNA sequencing for genome assembly.
6. DNA sequencing for variant calling (SNPs? Large structural variants?).
d. Bulk versus single cell. Most if not all genomics protocols described have been or can be
adapted to probe gene regulation in a single cell. What are some of the difficulties that make
measuring DNA, RNA, and/or protein more difficult in single cells? Select the answer that
applies.
1. The small number of molecules (DNA, RNA, protein) in a single cell is the general limiting
factor for single cell genomics.
2. Handling single cells is a lot more difficult because they tend to undergo apoptosis. c. Making
sure that you actually sequence one cell instead of multiple cells.
3. Finding a good way to dissociate cells is difficult for many tissue-types.
e. You attend a seminar and hear about a super cool approach called SUPER AWESOME DNA-
seq (SAD-seq). SAD-seq is able to measure, at nucleotide resolution, DNA bases that interact
with other DNA bases (DNA-DNA interactions). The speaker shows data that demonstrate SAD
seqs ability to recapitulate enhancer and promoter activity in two cancer-relevant cell lines (e.g.
HeLa cells and K562). The speaker further shows that SAD-seq can be used to identify
differentially expressed genes by comparing promoter activation. SAD-seq can do it all!
Naturally, you start to wonder whether you should be using SAD-seq in your project, or whether
you should start developing methods for analyzing SAD-seq. What are some important
questions you should ask yourself before jumping head in?.
Role of bioinformatics in life sciences research
1. The document discusses bioinformatics and summarizes some of its key applications and tools. It describes how bioinformatics merges biology and computer science to solve biological problems by applying computational tools to molecular data.
2. It provides examples of common bioinformatics tasks like retrieving sequences from databases, comparing sequences, analyzing genes and proteins, and viewing 3D structures.
3. The document lists several popular databases for nucleotide sequences, protein sequences, literature, and other biological data. It also introduces common bioinformatics tools for tasks like sequence alignment, translation, and structure analysis.
20240605 QFM017 Machine Intelligence Reading List May 2024
Everything I found interesting about machines behaving intelligently during May 2024
How to Get CNIC Information System with Paksim Ga.pptx
Pakdata Cf is a groundbreaking system designed to streamline and facilitate access to CNIC information. This innovative platform leverages advanced technology to provide users with efficient and secure access to their CNIC details.
More Related Content
Similar to A Genome Sequence Analysis System Built With Hypertable
Bioinformatics MiRON
This document provides an overview and introduction to bioinformatics. It discusses the large amounts of biological sequence data that have been generated and how bioinformatics is needed to analyze this data computationally. The document outlines topics that will be covered, including databases, sequence alignment tools like BLAST, gene finding, and protein analysis. Practical workshops are described that will involve database searching, multiple sequence alignments, and interpreting results to understand molecular biology and solve biomedical problems. Questions are welcomed throughout the workshops.
poster
The document describes genomic analysis of Clostridium difficile (C. difficile) isolates to understand the emergence of pathogenicity. 17 C. difficile isolates were sequenced and assembled genomes were obtained. Comparative genomics identified genetic changes like horizontal gene transfer and recombination associated with antibiotic resistance and virulence traits. Machine learning will be used to analyze genomic features and predict the origin and evolution of pathogenic isolates.
NCBI
The National Center for Biotechnology Information (NCBI) was created in 1988 as part of the National Library of Medicine at NIH. It establishes public databases for biological research, develops software tools for sequence analysis, and disseminates biomedical information from its location in Bethesda, MD. NCBI houses several integrated databases including PubMed, GenBank, RefSeq, and UniGene that contain literature, sequences, gene information, and more.
2013 pag-equine-workshop
This document provides an overview and discussion of next-generation sequencing technologies by C. Titus Brown. It begins by outlining some basics of shotgun sequencing and how increasing density leads to squared increases in the number of sequences obtained. It then discusses current costs for Illumina sequencing and the amount of data needed for different applications. Some challenges and problems with sequencing data are also reviewed, such as systematic bias, genome assembly and scaffolding difficulties, reference gene models, and mRNA isoform construction. Emerging long-read sequencing technologies are also briefly discussed.
Dgaston dec-06-2012
This document provides an overview of RNA-Seq analysis. It begins with considerations for RNA-Seq experiments such as computational requirements. It then describes the general RNA-Seq analysis workflow including short-read alignment, transcript reconstruction, abundance estimation, visualization, and statistics. The document focuses on explaining the "Tuxedo" analysis pipeline which includes Bowtie, Tophat, Cufflinks, Cuffmerge, Cuffdiff and CummeRbund. It provides examples of commands for each step and discusses alternative tools. The document concludes with resources for further information on RNA-Seq analysis.
Cool Informatics Tools and Services for Biomedical Research
This document provides an overview of bioinformatics tools and services for analyzing big data in biomedical research. It discusses traditional bioinformatics tools, analyzing genomic data from microarrays and next-generation sequencing without and with code, interpreting results using protein interaction networks and pathways, tools for data storage, cleaning and visualization, and making research reproducible. Galaxy, R, and programming are presented as useful for automated, reproducible analysis of large genomic datasets.
Using VarSeq to Improve Variant Analysis Research Workflows
Many questions must be answered when analyzing DNA sequence variants: How do I determine which variants are potentially deleterious? Is the sequencing quality sufficient? How do I prioritize the results? Which annotation sources may help answer my research question?
In this webinar presentation, we will review workflow strategies for quality control and analysis of DNA sequence variants using the VarSeq software package from Golden Helix. VarSeq is a powerful platform for analysis of DNA sequence variants in clinical and translational research settings. VarSeq provides researchers with easy access to curated public databases of variant annotation information, and also enables users to incorporate their own local databases or downloaded information about variants and genomic regions.
The presentation will include interactive demonstrations using VarSeq to analyze variants found by exome sequencing of an extended family with a complex disease. We will review strategies for assessing variant quality, applying genomic annotations, incorporating custom annotation sources, and creating variant filters in VarSeq. We will also demonstrate the PhoRank gene ranking algorithm and its application for prioritizing variants.
Using VarSeq to Improve Variant Analysis Research Workflows
In this webinar presentation, we will review workflow strategies for quality control and analysis of DNA sequence variants using the VarSeq software package from Golden Helix. VarSeq is a powerful platform for analysis of DNA sequence variants in clinical and translational research settings. VarSeq provides researchers with easy access to curated public databases of variant annotation information, and also enables users to incorporate their own local databases or downloaded information about variants and genomic regions.
Biomart Update
The document discusses BioMart, a data warehousing system that allows querying of biological data from multiple sources. It summarizes recent developments including MartBuilder for constructing data warehouses, MartView for viewing and querying data, and APIs and web services for programmatic access. It also outlines future plans such as a new configuration system and GUI framework to improve scalability, customizability, and user experience.
MutaDATABASE
The MutaDATABASE project aims to create a centralized and standardized database of human gene mutations called MutaDATABASE. It will collect all known human gene mutations related to monogenic diseases from existing databases and laboratories. The goal is for MutaDATABASE to become the most comprehensive mutation database by making submission of new mutations easy and encouraging participation. Key aspects include standardized formats, central access, free sharing of mutation data, and supporting software and groups to facilitate data sharing and review.
Bioinformatics t2-databases v2014
- The document outlines topics related to molecular biology databases including flat file sequence databases containing DNA, protein, and structure data, as well as relational databases.
- Examples of flat file formats like GenBank format are provided, showing how sequence data is stored in plain text files. Examples of sequence database resources like GenBank, EMBL, and DDBJ are also listed.
- The use of quality values assigned by Phred to base calls in DNA sequencing traces is discussed, and how these values are used by Phrap to determine consensus sequences from aligning multiple reads.
Bioinformatica t2-databases
This document provides an overview of bioinformatics databases and file formats for storing genetic sequence data. It discusses flat file databases like GenBank that store sequences in plain text formats. It also describes relational databases that allow querying across related data fields. Examples of biological relational databases and tools for working with sequence data files are also presented.
Practical 7 dna, rna and the flow of genetic information5
This document is a lab report for a biochemistry course that discusses DNA, RNA, and genetic information. The report summarizes databases that contain DNA and protein sequences, such as NCBI. It also discusses analyzing a DNA sequence to find an open reading frame and identify the encoded protein. Finally, the report discusses using BLAST to find homologous sequences and determine if sequences are homologous based on percent identity and E-values.
2012 03 01_bioinformatics_ii_les1
The document provides information about a bioinformatics course including the syllabus, topics, and schedule. The course focuses on using relational databases to manage and analyze large biological datasets. Topics include relation databases, web application development, genome browsers, text mining, and systems biology. The schedule lists the topics to be covered each class over 12 weeks from March to May.
Ashg2014 grc workshop_schneider
The document discusses updates to the human reference genome assembly GRCh38. It provides background on reference assemblies and describes how the Genome Reference Consortium manages and models genome assemblies. Key points include that GRCh38 contains refined centromere regions based on new data, novel sequence detections, and 261 alternate loci representing structural variants. The assembly is now incorporated into public sequence databases to improve access and use of the reference genome data.
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Torsten Seemann discussed bioinformatic tools for diagnostic laboratories using whole genome sequencing (WGS). He explained that WGS generates large amounts of sequencing reads that can be assembled de novo or aligned to references to identify single nucleotide polymorphisms (SNPs) and characterize genomes. Key applications of WGS include diagnostic identification, antimicrobial resistance profiling, virulence factor detection, and high-resolution epidemiological typing through SNP analysis and phylogenetic trees. Seemann emphasized that WGS analysis requires metadata, domain expertise, and open data sharing for maximum public health benefit.
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ is a parallel implementation of the MAQ reference assembler that leverages Hadoop and MapReduce to enable MAQ to run in a distributed, parallel manner on large datasets. It addresses the computational challenges of reference assembly by splitting the input reads into chunks that are processed simultaneously. The MAQ algorithm is used to align reads to a reference sequence and call consensus genotypes. HPC-MAQ allows MAQ to scale to larger genomes by distributing the work across multiple nodes in a Hadoop cluster.
B Chapman - Toolkit for variation comparison and analysis
The document describes a toolkit for comparing variant calls from different variant callers and sequencing technologies. It proposes establishing a set of true variants by comparing calls across multiple callers and technologies on gold standard genomes. The toolkit includes a comparison architecture that analyzes variants, identifies real variants by summarizing metrics, and scales to large numbers of variants and samples. It also describes building analysis pipelines in Clojure and providing comparison results through a web interface with metrics. The goal is to help answer biological questions by determining true variants and prioritizing based on existing evidence.
Long vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is poised to replace short read
sequencing (e.g. Illumina).
a. What is the typical read length in short read sequencing, and what is the read length range for
long range sequencing?
b. What are the downsides for using short read sequencing for genome assembly/SNP calling,
and RNA isoform discovery/quantification?
c. Which genomic protocols and/or applications are expected to benefit the most from long read
sequencing?
1. Sequencing DNA that are accessible (e.g. ATAC-seq/DNASE-seq).
2. Measuring histone modifications (e.g. for ChIP-seq).
3. Measuring gene expression levels.
4. Measuring messenger RNA isoform diversity.
5. DNA sequencing for genome assembly.
6. DNA sequencing for variant calling (SNPs? Large structural variants?).
d. Bulk versus single cell. Most if not all genomics protocols described have been or can be
adapted to probe gene regulation in a single cell. What are some of the difficulties that make
measuring DNA, RNA, and/or protein more difficult in single cells? Select the answer that
applies.
1. The small number of molecules (DNA, RNA, protein) in a single cell is the general limiting
factor for single cell genomics.
2. Handling single cells is a lot more difficult because they tend to undergo apoptosis. c. Making
sure that you actually sequence one cell instead of multiple cells.
3. Finding a good way to dissociate cells is difficult for many tissue-types.
e. You attend a seminar and hear about a super cool approach called SUPER AWESOME DNA-
seq (SAD-seq). SAD-seq is able to measure, at nucleotide resolution, DNA bases that interact
with other DNA bases (DNA-DNA interactions). The speaker shows data that demonstrate SAD
seqs ability to recapitulate enhancer and promoter activity in two cancer-relevant cell lines (e.g.
HeLa cells and K562). The speaker further shows that SAD-seq can be used to identify
differentially expressed genes by comparing promoter activation. SAD-seq can do it all!
Naturally, you start to wonder whether you should be using SAD-seq in your project, or whether
you should start developing methods for analyzing SAD-seq. What are some important
questions you should ask yourself before jumping head in?.
Role of bioinformatics in life sciences research
1. The document discusses bioinformatics and summarizes some of its key applications and tools. It describes how bioinformatics merges biology and computer science to solve biological problems by applying computational tools to molecular data.
2. It provides examples of common bioinformatics tasks like retrieving sequences from databases, comparing sequences, analyzing genes and proteins, and viewing 3D structures.
3. The document lists several popular databases for nucleotide sequences, protein sequences, literature, and other biological data. It also introduces common bioinformatics tools for tasks like sequence alignment, translation, and structure analysis.
Similar to A Genome Sequence Analysis System Built With Hypertable (20)
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical Research
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
B Chapman - Toolkit for variation comparison and analysis
B Chapman - Toolkit for variation comparison and analysis
Long vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is po.pdf
Recently uploaded
20240605 QFM017 Machine Intelligence Reading List May 2024
Everything I found interesting about machines behaving intelligently during May 2024
How to Get CNIC Information System with Paksim Ga.pptx
Pakdata Cf is a groundbreaking system designed to streamline and facilitate access to CNIC information. This innovative platform leverages advanced technology to provide users with efficient and secure access to their CNIC details.
Uni Systems Copilot event_05062024_C.Vlachos.pdf
Unlocking Productivity: Leveraging the Potential of Copilot in Microsoft 365, a presentation by Christoforos Vlachos, Senior Solutions Manager – Modern Workplace, Uni Systems
UiPath Test Automation using UiPath Test Suite series, part 6
Welcome to UiPath Test Automation using UiPath Test Suite series part 6. In this session, we will cover Test Automation with generative AI and Open AI.
UiPath Test Automation with generative AI and Open AI webinar offers an in-depth exploration of leveraging cutting-edge technologies for test automation within the UiPath platform. Attendees will delve into the integration of generative AI, a test automation solution, with Open AI advanced natural language processing capabilities.
Throughout the session, participants will discover how this synergy empowers testers to automate repetitive tasks, enhance testing accuracy, and expedite the software testing life cycle. Topics covered include the seamless integration process, practical use cases, and the benefits of harnessing AI-driven automation for UiPath testing initiatives. By attending this webinar, testers, and automation professionals can gain valuable insights into harnessing the power of AI to optimize their test automation workflows within the UiPath ecosystem, ultimately driving efficiency and quality in software development processes.
What will you get from this session?
1. Insights into integrating generative AI.
2. Understanding how this integration enhances test automation within the UiPath platform
3. Practical demonstrations
4. Exploration of real-world use cases illustrating the benefits of AI-driven test automation for UiPath
Topics covered:
What is generative AI
Test Automation with generative AI and Open AI.
UiPath integration with generative AI
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Let's Integrate MuleSoft RPA, COMPOSER, APM with AWS IDP along with Slack
Discover the seamless integration of RPA (Robotic Process Automation), COMPOSER, and APM with AWS IDP enhanced with Slack notifications. Explore how these technologies converge to streamline workflows, optimize performance, and ensure secure access, all while leveraging the power of AWS IDP and real-time communication via Slack notifications.
Essentials of Automations: The Art of Triggers and Actions in FME
In this second installment of our Essentials of Automations webinar series, we’ll explore the landscape of triggers and actions, guiding you through the nuances of authoring and adapting workspaces for seamless automations. Gain an understanding of the full spectrum of triggers and actions available in FME, empowering you to enhance your workspaces for efficient automation.
We’ll kick things off by showcasing the most commonly used event-based triggers, introducing you to various automation workflows like manual triggers, schedules, directory watchers, and more. Plus, see how these elements play out in real scenarios.
Whether you’re tweaking your current setup or building from the ground up, this session will arm you with the tools and insights needed to transform your FME usage into a powerhouse of productivity. Join us to discover effective strategies that simplify complex processes, enhancing your productivity and transforming your data management practices with FME. Let’s turn complexity into clarity and make your workspaces work wonders!
Video Streaming: Then, Now, and in the Future
In his public lecture, Christian Timmerer provides insights into the fascinating history of video streaming, starting from its humble beginnings before YouTube to the groundbreaking technologies that now dominate platforms like Netflix and ORF ON. Timmerer also presents provocative contributions of his own that have significantly influenced the industry. He concludes by looking at future challenges and invites the audience to join in a discussion.
Large Language Model (LLM) and it’s Geospatial Applications
Large Language Model (LLM) and it’s Geospatial Applications.
みなさんこんにちはこれ何文字まで入るの？40文字以下不可とか本当に意味わからないけどこれ限界文字数書いてないからマジでやばい文字数いけるんじゃないの？えこ...
ここ3000字までしか入らないけどタイトルの方がたくさん文字入ると思います。
Mind map of terminologies used in context of Generative AI
Mind map of common terms used in context of Generative AI.
Introducing Milvus Lite: Easy-to-Install, Easy-to-Use vector database for you...
Join us to introduce Milvus Lite, a vector database that can run on notebooks and laptops, share the same API with Milvus, and integrate with every popular GenAI framework. This webinar is perfect for developers seeking easy-to-use, well-integrated vector databases for their GenAI apps.
Securing your Kubernetes cluster_ a step-by-step guide to success !
Today, after several years of existence, an extremely active community and an ultra-dynamic ecosystem, Kubernetes has established itself as the de facto standard in container orchestration. Thanks to a wide range of managed services, it has never been so easy to set up a ready-to-use Kubernetes cluster.
However, this ease of use means that the subject of security in Kubernetes is often left for later, or even neglected. This exposes companies to significant risks.
In this talk, I'll show you step-by-step how to secure your Kubernetes cluster for greater peace of mind and reliability.
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Join Maher Hanafi, VP of Engineering at Betterworks, in this new session where he'll share a practical framework to transform Gen AI prototypes into impactful products! He'll delve into the complexities of data collection and management, model selection and optimization, and ensuring security, scalability, and responsible use.
UiPath Test Automation using UiPath Test Suite series, part 5
Welcome to UiPath Test Automation using UiPath Test Suite series part 5. In this session, we will cover CI/CD with devops.
Topics covered:
CI/CD with in UiPath
End-to-end overview of CI/CD pipeline with Azure devops
Speaker:
Lyndsey Byblow, Test Suite Sales Engineer @ UiPath, Inc.
National Security Agency - NSA mobile device best practices
Threats to mobile devices are more prevalent and increasing in scope and complexity. Users of mobile devices desire to take full advantage of the features
available on those devices, but many of the features provide convenience and capability but sacrifice security. This best practices guide outlines steps the users can take to better protect personal devices and information.
“I’m still / I’m still / Chaining from the Block”
“An Outlook of the Ongoing and Future Relationship between Blockchain Technologies and Process-aware Information Systems.” Invited talk at the joint workshop on Blockchain for Information Systems (BC4IS) and Blockchain for Trusted Data Sharing (B4TDS), co-located with with the 36th International Conference on Advanced Information Systems Engineering (CAiSE), 3 June 2024, Limassol, Cyprus.
Presentation of the OECD Artificial Intelligence Review of Germany
Consult the full report at https://www.oecd.org/digital/oecd-artificial-intelligence-review-of-germany-609808d6-en.htm
Recently uploaded (20)
20240605 QFM017 Machine Intelligence Reading List May 2024
20240605 QFM017 Machine Intelligence Reading List May 2024
How to Get CNIC Information System with Paksim Ga.pptx
How to Get CNIC Information System with Paksim Ga.pptx
UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6
Let's Integrate MuleSoft RPA, COMPOSER, APM with AWS IDP along with Slack
Let's Integrate MuleSoft RPA, COMPOSER, APM with AWS IDP along with Slack
Essentials of Automations: The Art of Triggers and Actions in FME
Essentials of Automations: The Art of Triggers and Actions in FME
Large Language Model (LLM) and it’s Geospatial Applications
Large Language Model (LLM) and it’s Geospatial Applications
みなさんこんにちはこれ何文字まで入るの？40文字以下不可とか本当に意味わからないけどこれ限界文字数書いてないからマジでやばい文字数いけるんじゃないの？えこ...
みなさんこんにちはこれ何文字まで入るの？40文字以下不可とか本当に意味わからないけどこれ限界文字数書いてないからマジでやばい文字数いけるんじゃないの？えこ...
Mind map of terminologies used in context of Generative AI
Mind map of terminologies used in context of Generative AI
Introducing Milvus Lite: Easy-to-Install, Easy-to-Use vector database for you...
Introducing Milvus Lite: Easy-to-Install, Easy-to-Use vector database for you...
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Monitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR Events
UiPath Test Automation using UiPath Test Suite series, part 5
UiPath Test Automation using UiPath Test Suite series, part 5
National Security Agency - NSA mobile device best practices
National Security Agency - NSA mobile device best practices
Presentation of the OECD Artificial Intelligence Review of Germany
Presentation of the OECD Artificial Intelligence Review of Germany
A Genome Sequence Analysis System Built With Hypertable
- 1. A Genome Sequence Analysis System Built with Hypertable Doug Judd CEO, Hypertable, Inc.
- 5. Why NoSQL?
- 6. Source: Nature 458, 719-724 (2009)
- 7. Source: wired.com, February 2011
- 8. Genomics 101
- 12. Example Reads File GTGGATAGGGGGAGACTAATGTAGTATGATTATCATCATCAACAGAAGCTATGACACCAGGATAAA CATTTCTTATTGCTGAAAGTATTCTATTGTAGAGATGTACCACAATTTGGTTTCTGGTTTTGTATT GGGAGGATACTAGGGATTACTGAAGCCAACTTTGCAGACTCATACATTTGACTAGACACAGCC ACATTACAGTTTTCTGAGGAAAATTCTTAAGATGTTACCCCAAAACATAGCATTTTAAATTAAAAC GGACCGGCTGAAGCCATGGCAGAAGAACATAAATTGTGAAGATTTCATGGGCATTTATTAGTT GGAAGTGATAAGTGTCCATGAAATCTTCACAATTTATGTTCAGAGATTGCAGTAAAGACAGGTGTA AAGACACAGCAAAGCTAAGAGGACCCAACACACGGTAGGGTCGGGGACCTTGGAGAAACATGG TGGCTTCTTCCTACATGCTTGTGATAGATGACCAAAAAACATTTGTTGAGTTGATGAATAGTACAA AAAAGGGGCGGATAATAAATGAAAAGGGAATGTGCTGTTATTTCCTACTAAGATCAGAAAGAG ATATAAACAAAAGCTGTCATCACTTAGGGACTTCAGCCACATAAAACAATGTCAGGCTAGTCACTT AGAGCTTTGGGACTAGTTGAGTGGCAGCTTAACAAAGCAACGCAATATCCATAGGGATTGGGG ATATTTACATCTAGTGGATTCTACCAGTATGGTGGTCTTATGTGGACTGCACGTGGTTTTCTAGTA AGATAGCAGCTCTTCCCAAATTTATTTATAATTGTGGCATTATTTATAATATCAAAATATTAT GTTGCCAAAGGAGATTAACATTTGAGTCAGTGGGCGGGGTAAGGCCGACCTACCCTTAATCTGGTG GAGAAAGAAGCTGCTAATGGAGTTTAAAAGGTTACTGTCATTAATGAAAAATAAATTTACAGC CAGACATTTATGAACAGAAATGGGAAAAACACACTAGGAAAGCACTGCAAAGACTAATCTGTCTTT AAAGGAGATAGAGTGACTCCAGGCCCCTTAGAAATGACTATACCTGGCAGAGCATGCCAACTG ATGGGCTCGAGTCCTCACAAATATGAATTCCCCCTAAGTCTTGAGAGGTCATTTGTGCATTTGGAA GGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATCGTGAAAATGGTCATACTGCCCA GCGGGGTTTTTTTTTGTTTCATATTAACTTTAAAGTAGTTTTTTTCCATTTTGTGAAGAAAGACAT AAAGAACCAAGGCTAATAGTTGTTTGAGTTGTACTTACCATGTTGTTAAATGTCACCTCACAC CGCTGCCAGCCTATCAGAGCCGGGAATTACACCGTGCTTGGAGTTCTGGCACAGATCCACAGCTAC AGTTCTTCATTGTAAGAAATGGATGCTAACATGTAACAAGAAAACATCTGAAGGTTAAACTCA AATAAATGGGTTAATAGTTTGTCTTTCGGTCTTCATACTTTCAATATAAGTGGTTTACTTAGCCGA
- 16. Schema Design
- 21. Applications
Editor's Notes
- Improvements in the rate of DNA sequencing over the past 30 years and into the future