The document summarizes a study on characterizing the 16S rRNA gene of Flavobacterium columnare strains isolated from different fish species. The objectives were to characterize the 16S rRNA gene and construct a phylogenetic relationship among F. columnare strains. Samples were collected from fish in CIFA ponds and village ponds, and the 16S rRNA gene was amplified and sequenced. BLAST analysis showed similarity to F. columnare sequences. ClustalW alignment and phylogenetic analysis grouped the isolates. The study characterized the 16S rRNA gene to identify and establish relationships among F. columnare strains affecting freshwater aquaculture.

1. STUDY ON 16S rRNA gene of
Flavobacterium columnare
Guided by: Dr. B. K. Das
Principal Scientist
Fish Health Management Division
Central Institute of Freshwater Aquaculture
Kausalyaganga,Bhubaneswar
Presented by: Soumya Sankar Rath
(Roll No-14716V114013)

2. •Aquaculture is one of the fastest animal food producing sector in the world.
•Fish is a rich source of protein.
•Worldwide people obtained 25% protein from fish, but due to pathogenic bacteria, the
production rate is reducing day by day.
•The most frequently encountered bacterial agent associated with fish disease is
Flavobacterium columnare.
•It is an aerobic, gliding, Gram negative, long rod-shaped bacterium.
INTRODUCTION

3. CLASSIFICATION
• Kingdom: Bacteria
• Phylum: Bacteroidetes
• Class: Flavobacteria
• Order: Flavobacteriales
• Family: Flavobacteriaceae
• Genus: Flavobacterium
• Species: F. columnare

4. OBJECTIVES
• To characterize the 16S rRNA gene of F. columnare strain isolated
from different organs of freshwater fishes.
• To construct the phylogenetic relationship among the different
strains of F. columnare.

5. MATERIALS AND METHODS
• Sample collection: Samples were collected from the Freshwater fishes from CIFA ponds and village ponds
of Bhubaneswar.
• Colony Morphology: Colony morphology was studied by inoculating bacteria on TSA plates followed by
incubation for 24 hrs at 370C.
• Cell Morphology: Gram staining was done.
• Biochemical Tests: The isolates were processed for different biochemical test
• Oxidase Test
• Catalase Test
• Gelatin Test

6. • DNA Extraction: The DNA was extracted by using both CTAB and HipuraTM Kit
method)
• Quantity Analysis of isolated DNA: The concentration and quantity of the genomic
DNA obtained was determined by spectrophotometric analysis and agarose gel
electrophoresis.
• Quality checking of the Isolated DNA: The qualities of isolated DNA samples were
checked by 0.8% agarose gel electrophoresis.
• Primer design: primer design was done by using Primer 3 Plus Software.
MOLECULAR CHARACTERIZATION

7. – Amplification of 16S rRNA was done by taking (Forward primer- 5’
AAGAGTTTGATCCTGGCTCAG 3’, Reverse Primer-5’
GGTTACCTTGTTACGACTT 3’) obtained from Bangalore Genei.
– Both the amplification was carried out along with dNTP, MgCl2, 10X Assay
Buffer, Taq DNA Polymerase and genomic DNA.
AMPLIFICATION 16S RIBOSOMAL RNA

8. • Purification of PCR Products
– The purification of PCR products were done by MinElute Gel Extraction
Kit.
• Analysis of PCR-amplified products
– The PCR-amplified products were analyzed through 1.2% agarose gel
electrophoresis
• Sequencing of amplified PCR Products
– The amplified PCR products were sent to Eurofin Laboratory Pvt. Ltd. for
sequencing.

9. – BLAST Analysis of F. columnare : After sequencing, database searches were conducted
with the BLAST (Basic Local Alignment Search Tool) algorithm provided by NCBI
(hhttp://blast.ncbi.nlm.nih.gov/ ).
– ClustalW Alignment of F. columnare :
ClustalW ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ) is a tool for aligning multiple
protein or nucleotide sequences.
– Phylogenetic Analysis of F.columnare : MEGA 4.0 software software was used to do
phylogenetic analysis.
BIOINFORMATICS TOOLS

10. BLAST Programme

11. ClustalW Programme

12. RESULTS
• Isolation of bacteria: (Table 1)
• Morphology of F. columnare : (Fig. 1)
• Identification
– Biochemical Test (Table 2)
• Catalase Test
• Oxidase Test
• Gelatin test
• Genome analysis
– Isolation of DNA
– Quantitative Analysis of isolated DNA
– Quality checking of the Isolated DNA (Fig. 2)
– Amplification of 16S rRNA gene and Analysis of PCR products: (Fig. 3)

13. – BLAST analysis of 16S rRNA (Table 3)
– Clustal analysis of 16S rRNA of F. columnare :(Table 5, 6, 7, 8, 9 and
10)(Fig. 4, 5, 6, 7, 8 and 9).
– Phylogenetic Analysis of F. columnare (Fig. 10, 11, 12, 13, 14 and 15)

14. Table 1: Isolation of F. columnare from different organs of catla, rohu, goldfish and anabas
Sl. No. Bacteria Code Species Organ Area Of Isolation
1 CFCCO41 Catla Operculum CIFA Research pond
2 CFCRVB43 Rohu Ventral belly CIFA Research pond
3 CFCGFG50 Gold fish Gill CIFA Research pond
4 CFCRG55 Rohu Gill CIFA Research pond
5 CFCCG62 Catla Gill Village pond BBSR
6 CFCCSL66 Catla Skin lesions CIFA Research pond
7 CFCACR72 Anabas Caudal region CIFA Research pond

15. Table 2: Biochemical test result of F. columnare from catla, rohu, goldfish and anabas
Sl. No. Organism Gram Staining Catalase Test Oxidase Test Gelatin
1 CFCCO41 - + - +
2 CFCRVB43 - + - +
3 CFCGFG50 - + - +
4 CFCRG55 - + - +
5 CFCCG62 - + - +
6 CFCCSL66 - + - +
7 CFCACR72 - + - +

16. Fig.1: Growth of F. columnare on TSA plates

17. Fig.2:DNA banding pattern of F. columnare; (lane 1) CFCCO41, (lane 2) CFCRVB43, (lane 3) CFCGFG50, (lane 4) CFCRG55, (lane 5) CFCCG62,
(lane 6) CFCCSL66, (lan e 7) CFCACR72
DNA ISOLATION AND PCR AMPLIFICATION
Fig.3:16S rRNA banding pattern of F. columnare; (lane 1) Marker(1.5 kb), (lane 2) CFCCO41, (lane 3) CFCRVB43, (lane 4) CFCGFG50, (lane 5)
CFCRG55, (lane 6) CFCCG62, (lane 7) CFCCSL66, (lane 8) CFCACR72

18. Table 3: BLAST Analysis of 16S rRNA of F. columnare from catla, rohu, goldfish and anabas
Sl. No. Organism Accession
No.
Description Total
Score
Query coverage Max
Idnt
1. CFCCO41 AY747592.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
746 100 % 75 %
2. CFCRVB43 AY747592.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
657 95% 74 %
3. CFCGFG50 AY842900.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
834 100 % 77 %
4. CFCRG55 AY747592.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
700 100 % 73%
5. CFCCG62 AY747592.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
764 100 % 75%
6. CFCCSL66 AY747592.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
832 100 % 76%
7. CFCACR72 AY747592.1 Flavobacterium columnare strain 16S ribosomal
RNA gene, partial sequence
783 99% 75%

19. Code Organism After
alignment
New Code Id No. Submitted base pair
MS 41 FC 41 CFCCO41 1629257 1128
MS 43 FC 43 CFCRVB43 1629259 1155
MS 50 FC 50 CFCGFG50 1629262 1157
MS 55 FC 55 CFCRG55 1629263 1216
MS 62 FC 62 CFCCG62 1629265 1151
MS 66 FC 66 CFCCSL66 1629267 1164
MS 72 FC 72 CFCACR72 1629269 1167
Table 4: Sequences submitted to NCBI GenBank.

20. Seq A Name Length Seq B Name Length Score
1 CFCCO41 1128 2 CFCCG62 1151 96.37
1 CFCCO41 1128 3 CFCCSL66 1164 98.76
1 CFCCO41 1128 4 ATCC 1477 76.95
2 CFCCG62 1151 3 CFCCSL66 1164 97.48
2 CFCCG62 1151 4 ATCC 1477 75.76
3 CFCCSL66 1164 4 ATCC 1477 77.32
Table 5: Clustal Analysis of 16S rRNA gene of F. columnare from gill, operculum and skin of catla.
Table 6: Clustal Analysis of 16S rRNA of F. columnare from gill and ventral belly of rohu.
Seq A Name Length Seq B Name Length Score
1 CFCRVB43 1155 2 CFCRG55 1216 81.47
1 CFCRVB43 1155 3 ATCC 1477 74.98
2 CFCRG55 1216 3 ATCC 1477 73.6
Note: 1: CFCCO41; 2: CFCCG62; 3: CFCCSL66; 4: F. columnare 16S ribosomal RNA, partial sequence, strain: ATCC 49513

21. Table 7: Clustal Analysis of 16S rRNA of F. columnare from gill of goldfish and caudal region of anabas
Seq A Name Length Seq B Name Length Score
1 CFCGFG50 1157 2 CFCACR72 1167 93.09
1 CFCGFG50 1157 3 ATCC 1477 77.27
2 CFCACR72 1167 3 ATCC 1477 76.52
Table 8: Clustal Analysis of 16S rRNA of F. columnare from gill of goldfish, rohu and catla
Seq A Name Length Seq B Name Length Score
1 CFCGFG50 1157 2 CFCRG55 1216 93.26
1 CFCGFG50 1157 3 CFCCG62 1151 92.79
1 CFCGFG50 1157 4 ATCC 1477 77.27
2 CFCRG55 1216 3 CFCCG62 1151 97.05
2 CFCRG55 1216 4 ATCC 1477 73.6
3 CFCCG62 1151 4 ATCC 1477 75.76

22. Seq A Name Length Seq B Name Length Score
1 CFCCO41 1128 2 CFCRVB43 1155 81.91
1 CFCCO41 1128 3 CFCCSL66 1164 98.76
1 CFCCO41 1128 4 CFCACR72 1167 98.14
1 CFCCO41 1128 5 ATCC 1477 76.95
2 CFCCO41 1155 3 CFCCSL66 1164 82.08
2 CFCRVB43 1155 4 CFCACR72 1167 81.82
2 CFCRVB43 1155 5 ATCC 1477 74.98
3 CFCCSL66 1164 4 CFCACR72 1167 98.8
3 CFCCSL66 1164 5 ATCC 1477 77.32
4 CFCACR72 1167 5 ATCC 1477 76.52
Table 9: Clustal Analysis of 16S rRNA of F. columnare from operculum and ventral belly of rohu, skin lesion of catla and
caudal region of anabas.

23. Seq A Name Length Seq B Name Length Score
1 CFCCO41 1128 2 CFCRVB43 1155 81.91
1 CFCCO41 1128 3 CFCGFG50 1157 93.26
1 CFCCO41 1128 4 CFCRG55 1216 98.05
1 CFCCO41 1128 5 CFCCG62 1151 96.37
1 CFCCO41 1128 6 CFCCSL66 1164 98.76
1 CFCCO41 1128 7 CFCACR72 1167 98.14
1 CFCCO41 1128 8 ATCC 1477 76.95
2 CFCRVB43 1155 3 CFCGFG50 1157 78.87
2 CFCRVB43 1155 4 CFCRG55 1216 81.47
2 CFCRVB43 1155 5 CFCCG62 1151 81.06
2 CFCRVB43 1155 6 CFCCSL66 1164 82.08
2 CFCRVB43 1155 7 CFCACR72 1167 81.82
2 CFCRVB43 1155 8 ATCC 1477 74.98
3 CFCGFG50 1157 4 CFCRG55 1216 93.26
3 CFCGFG50 1157 5 CFCCG62 1151 92.79
3 CFCGFG50 1157 6 CFCCSL66 1164 94.3
3 CFCGFG50 1157 7 CFCACR72 1167 93.09
3 CFCGFG50 1157 8 ATCC 1477 77.27
4 CFCRG55 1216 5 CFCCG62 1151 97.05
4 CFCRG55 1216 6 CFCCSL66 1164 98.97
4 CFCRG55 1216 7 CFCACR72 1167 98.89
4 CFCRG55 1216 8 ATCC 1477 73.6
5 CFCCG62 1151 6 CFCCSL66 1164 97.48
5 CFCCG62 1151 7 CFCACR72 1167 96.79
5 CFCCG62 1151 8 ATCC 1477 75.76
6 CFCCSL66 1164 7 CFCACR72 1167 98.8
6 CFCCSL66 1164 8 ATCC 1477 77.32
7 CFCACR72 1167 8 ATCC 1477 76.52
Table 10: Clustal Analysis of 16S rRNA of F. columnare from gill, operculum, skin lesions of catla (C. catla),
gill and ventral belly of rohu (L. rohita), gill of goldfish (C. auratus) and caudal region of anabas (A. testudineus)

24. Fig. 4: Clustal Analysis of 16S rRNA of F. columnare from gill, operculum, and skin lesion of catla.

25. Fig.5 : Clustal Analysis of 16S rRNA of F. columnare from gill and ventral belly of rohu.

26. Fig. 6: Clustal Analysis of 16S rRNA of F. columnare from gill of goldfish and caudal region of anabas.

27. Fig. 7: Clustal Analysis of 16S rRNA of F. columnare from gill of goldfish and caudal region of anabas

28. Fig. 8: Clustal Analysis of 16S rRNA of F. columnare from operculum of rohu, ventral belly of rohu, skin lesion of catla and caudal region of anabas

29. Fig.9 : Clustal Analysis of 16S rRNA of F. columnare from gill, operculum, skin lesions of catla (C. catla), gill, and ventral belly of rohu (L. rohita), gill of
goldfish (C. auratus) and caudal region of anabas (A. testudineus)

30. Fig.10: Phylogenetic tree of F. columnare from gill, operculum, and skin of catla.
Fig.11: Phylogenetic tree of F. columnare from gill and ventral belly of rohu.

31. Fig.13: Phylogenetic tree of F. columnare from operculum and ventral belly of rohu, skin lesion of catla and caudal region of anabas.
Fig.12: Phylogenetic tree of F. columnare from gill of goldfish and caudal region of anabas.

32. Fig.22: Phylogenetic tree of F. columnare from gill, operculum, skin lesions of
catla (C. catla), gill, and ventral belly of rohu (L. rohita), gill of goldfish (C. auratus) and
caudal region of anabas (A.s testudineus)
Fig.21: Phylogenetic tree of F. columnar from operculum of rohu,
ventral belly of rohu skin lesion of catla and caudal region of anabas

33. CONCLUSION
•Amplification of 16S rRNA is done to identify the Flavobacterium columnare strains which
were isolated from different organs of different diseased fish.
•From the BLAST analysis of 16S rRNA, we found that all the strains showed 72% to 98%
similarity with Flavobacterium columnare strains in GenBank.
•From the ClustalW alignment it was conclude that, the strains isolated from same species and
different species showed 86% to 95% similarity.
•After analyzing the phylogenetic tree it could be stated that there may exist a tissue preference
for different strains of F. columnare even in the same species.

34. • Sequencing the 16S rRNA gene enables querying a database such
as GenBank to yield an alternative identification without the need
for any additional laboratory work.

35. THANK YOU