The human genome is full of repeated DNA sequences which come in various sizes and are classified according to the length of the core repeat units, the number of contiguous repeat units, and/or the overall length of the repeat region. DNA regions with short repeat units (usually 2-6 bp in length) are called Short Tandem Repeats (STR).
general information regarding single nucleotide polymorphism.
A Single Nucleotide Polymorphisms (SNP), pronounced “snip,” is a genetic variation when a single nucleotide (i.e., A, T, C, or G) is altered and kept through heredity.
The human genome is full of repeated DNA sequences which come in various sizes and are classified according to the length of the core repeat units, the number of contiguous repeat units, and/or the overall length of the repeat region. DNA regions with short repeat units (usually 2-6 bp in length) are called Short Tandem Repeats (STR).
general information regarding single nucleotide polymorphism.
A Single Nucleotide Polymorphisms (SNP), pronounced “snip,” is a genetic variation when a single nucleotide (i.e., A, T, C, or G) is altered and kept through heredity.
Feature story from the Garvan Institute of Medical Research's April 2013 issue of Breakthrough newsletter. More at https://www.garvan.org.au/news-events/newsletters
Insilico analysis of pkd genes in polycystic kidney disease patientsVeeramuthumariPandia1
The power point tells about the gene polymorphism alters the protein structure. Alteration in protein structure leads to malfunction of gene causes disease. PKD gnes-Polycystin 1 and 2 protein - Polycystic kidney disease.
Introduction
History
Tumor suppressor gene- pRB
- RB gene
- Role of RB in regulation of cell cycle
- Tumor associated with RB gene mutation
Tumor suppressor gene- p53
- What is p53 gene?
- Function of p53 gene
- How it regulates cell cycle
- What happen if p53 gene inactivated
- Cancer associated with p53 mutation
- Conclusion
- References
Whole Exome Sequencing at Stanford UniversityGolden Helix
Dr. Reza Sailani is a Research Fellow in the Genetics department at Stanford University. To provide an overview of his research, Sailani explains the following two recent studies he has conducted:
Association of AHSG with alopecia and mental retardation (APMR) syndrome: Alopecia with mental retardation syndrome (APMR) is a very rare autosomal recessive condition that is associated with total or partial absence of hair from the scalp and other parts of the body as well as variable intellectual disability. Here we present whole-exome sequencing results of a large consanguineous family segregating APMR syndrome with seven affected family members. Our study revealed a novel predicted pathogenic, homozygous missense mutation in the AHSG gene.
WISP3 mutation associated with Pseudorheumatoid Dysplasia: Progressive pseudorheumatoid dysplasia (PPD) is a skeletal dysplasia characterized by predominant involvement of articular cartilage with progressive joint stiffness. Here we report genetic characterization of a consanguineous family segregating an uncharacterized form of skeletal dysplasia. Whole exome sequencing in four affected siblings and parents resulted in identification of a loss of function homozygous mutation in the WISP3 gene leading to diagnosis of PPD in the affected individuals. The identified variant is rare and predicted to cause premature termination of the WISP3 protein.
Single Nucleotide Polymorphism (SNP)
Polymorphism is a generic term that means 'many shapes‘. It is the ability to appsear in different form .
A single nucleotide polymorphism (SNP) is a DNA sequence variation occurring when a single nucleotide - A, T, C, or G - in the genome differs between members of a species (or between paired chromosomes in an individual).
For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. For a variation to be considered a SNP, it must occur in at least 1% of the population.
CHARACTERISTICS OF SNP
• In human beings, 99.9 percent bases are same.
• Remaining 0.1 percent makes a person unique.
• Different attributes / characteristics / traits
• How a person looks, diseases he or she develops.
These variations can be:
Harmless (change in phenotype)
Harmful (diabetes, cancer, heart disease, Huntington's disease, and hemophilia )
Latent (variations found in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions e.g. susceptibility to lung cancer)
TYPES OF SNP
NON-CODING REGION
A segment of DNA that does comprise a gene and thus does not code for a protein .
CODING REGION
Regions of DNA/RNA sequences that code for proteins
Synonymous
A SNP in which both forms lead to the same polypeptide sequence is termed synonymous
(sometimes called a silent mutation).
Non synonymous
If a different polypeptide sequence is produced they are non synonymous . A non synonymous change may either be missense or nonsense, where a missense change results in a different amino acid, while a nonsense change results in a premature stop codon.
SNP Applications
• Gene discovery and mapping
• Association-based candidate polymorphism testing
• Diagnostics/risk profiling
• Response prediction
• Homogeneity testing/study design
• Gene function identification
Feature story from the Garvan Institute of Medical Research's April 2013 issue of Breakthrough newsletter. More at https://www.garvan.org.au/news-events/newsletters
Insilico analysis of pkd genes in polycystic kidney disease patientsVeeramuthumariPandia1
The power point tells about the gene polymorphism alters the protein structure. Alteration in protein structure leads to malfunction of gene causes disease. PKD gnes-Polycystin 1 and 2 protein - Polycystic kidney disease.
Introduction
History
Tumor suppressor gene- pRB
- RB gene
- Role of RB in regulation of cell cycle
- Tumor associated with RB gene mutation
Tumor suppressor gene- p53
- What is p53 gene?
- Function of p53 gene
- How it regulates cell cycle
- What happen if p53 gene inactivated
- Cancer associated with p53 mutation
- Conclusion
- References
Whole Exome Sequencing at Stanford UniversityGolden Helix
Dr. Reza Sailani is a Research Fellow in the Genetics department at Stanford University. To provide an overview of his research, Sailani explains the following two recent studies he has conducted:
Association of AHSG with alopecia and mental retardation (APMR) syndrome: Alopecia with mental retardation syndrome (APMR) is a very rare autosomal recessive condition that is associated with total or partial absence of hair from the scalp and other parts of the body as well as variable intellectual disability. Here we present whole-exome sequencing results of a large consanguineous family segregating APMR syndrome with seven affected family members. Our study revealed a novel predicted pathogenic, homozygous missense mutation in the AHSG gene.
WISP3 mutation associated with Pseudorheumatoid Dysplasia: Progressive pseudorheumatoid dysplasia (PPD) is a skeletal dysplasia characterized by predominant involvement of articular cartilage with progressive joint stiffness. Here we report genetic characterization of a consanguineous family segregating an uncharacterized form of skeletal dysplasia. Whole exome sequencing in four affected siblings and parents resulted in identification of a loss of function homozygous mutation in the WISP3 gene leading to diagnosis of PPD in the affected individuals. The identified variant is rare and predicted to cause premature termination of the WISP3 protein.
Single Nucleotide Polymorphism (SNP)
Polymorphism is a generic term that means 'many shapes‘. It is the ability to appsear in different form .
A single nucleotide polymorphism (SNP) is a DNA sequence variation occurring when a single nucleotide - A, T, C, or G - in the genome differs between members of a species (or between paired chromosomes in an individual).
For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. For a variation to be considered a SNP, it must occur in at least 1% of the population.
CHARACTERISTICS OF SNP
• In human beings, 99.9 percent bases are same.
• Remaining 0.1 percent makes a person unique.
• Different attributes / characteristics / traits
• How a person looks, diseases he or she develops.
These variations can be:
Harmless (change in phenotype)
Harmful (diabetes, cancer, heart disease, Huntington's disease, and hemophilia )
Latent (variations found in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions e.g. susceptibility to lung cancer)
TYPES OF SNP
NON-CODING REGION
A segment of DNA that does comprise a gene and thus does not code for a protein .
CODING REGION
Regions of DNA/RNA sequences that code for proteins
Synonymous
A SNP in which both forms lead to the same polypeptide sequence is termed synonymous
(sometimes called a silent mutation).
Non synonymous
If a different polypeptide sequence is produced they are non synonymous . A non synonymous change may either be missense or nonsense, where a missense change results in a different amino acid, while a nonsense change results in a premature stop codon.
SNP Applications
• Gene discovery and mapping
• Association-based candidate polymorphism testing
• Diagnostics/risk profiling
• Response prediction
• Homogeneity testing/study design
• Gene function identification
Single cell analysis has exploded recently mainly due to the development of high-throughput technologies such as NGS. Single cell analysis is being pursued by researchers in many areas including developmental science, cancer, biomarker discovery and more. This presentation covers some of the recent applications from developed by QIAGEN customers.
Advances and Applications Enabled by Single Cell TechnologyQIAGEN
Over the past 5 years, single-cell genomics have become a powerful technology for studying small samples and rare cells, and for dissecting complex populations such as heterogeneous tumors. Single-cell technology is enabling many new insights into diverse research areas from oncology, immunology and microbiology to neuroscience, stem cell and developmental biology. This webinar introduces single-cell technology and summarizes the newest scientific applications in various research areas, all in the context of current literature.
GTC group 8 - Next Generation SequencingYanqi Chan
DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. Discuss the application of next generation sequencing in cancer treatment.
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Reid Robison
Tute Genomics is cloud-based software that can rapidly analyze entire human genomes. The cost of whole genome sequencing is dropping rapidly and we are in the middle of a genomic revolution. Tute is opening a new door for personalized medicine by helping researchers & healthcare organizations analyze human genomes.
The Art of the Pitch: WordPress Relationships and SalesLaura Byrne
Clients don’t know what they don’t know. What web solutions are right for them? How does WordPress come into the picture? How do you make sure you understand scope and timeline? What do you do if sometime changes?
All these questions and more will be explored as we talk about matching clients’ needs with what your agency offers without pulling teeth or pulling your hair out. Practical tips, and strategies for successful relationship building that leads to closing the deal.
UiPath Test Automation using UiPath Test Suite series, part 4DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 4. In this session, we will cover Test Manager overview along with SAP heatmap.
The UiPath Test Manager overview with SAP heatmap webinar offers a concise yet comprehensive exploration of the role of a Test Manager within SAP environments, coupled with the utilization of heatmaps for effective testing strategies.
Participants will gain insights into the responsibilities, challenges, and best practices associated with test management in SAP projects. Additionally, the webinar delves into the significance of heatmaps as a visual aid for identifying testing priorities, areas of risk, and resource allocation within SAP landscapes. Through this session, attendees can expect to enhance their understanding of test management principles while learning practical approaches to optimize testing processes in SAP environments using heatmap visualization techniques
What will you get from this session?
1. Insights into SAP testing best practices
2. Heatmap utilization for testing
3. Optimization of testing processes
4. Demo
Topics covered:
Execution from the test manager
Orchestrator execution result
Defect reporting
SAP heatmap example with demo
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Essentials of Automations: Optimizing FME Workflows with ParametersSafe Software
Are you looking to streamline your workflows and boost your projects’ efficiency? Do you find yourself searching for ways to add flexibility and control over your FME workflows? If so, you’re in the right place.
Join us for an insightful dive into the world of FME parameters, a critical element in optimizing workflow efficiency. This webinar marks the beginning of our three-part “Essentials of Automation” series. This first webinar is designed to equip you with the knowledge and skills to utilize parameters effectively: enhancing the flexibility, maintainability, and user control of your FME projects.
Here’s what you’ll gain:
- Essentials of FME Parameters: Understand the pivotal role of parameters, including Reader/Writer, Transformer, User, and FME Flow categories. Discover how they are the key to unlocking automation and optimization within your workflows.
- Practical Applications in FME Form: Delve into key user parameter types including choice, connections, and file URLs. Allow users to control how a workflow runs, making your workflows more reusable. Learn to import values and deliver the best user experience for your workflows while enhancing accuracy.
- Optimization Strategies in FME Flow: Explore the creation and strategic deployment of parameters in FME Flow, including the use of deployment and geometry parameters, to maximize workflow efficiency.
- Pro Tips for Success: Gain insights on parameterizing connections and leveraging new features like Conditional Visibility for clarity and simplicity.
We’ll wrap up with a glimpse into future webinars, followed by a Q&A session to address your specific questions surrounding this topic.
Don’t miss this opportunity to elevate your FME expertise and drive your projects to new heights of efficiency.
Key Trends Shaping the Future of Infrastructure.pdfCheryl Hung
Keynote at DIGIT West Expo, Glasgow on 29 May 2024.
Cheryl Hung, ochery.com
Sr Director, Infrastructure Ecosystem, Arm.
The key trends across hardware, cloud and open-source; exploring how these areas are likely to mature and develop over the short and long-term, and then considering how organisations can position themselves to adapt and thrive.
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...DanBrown980551
Do you want to learn how to model and simulate an electrical network from scratch in under an hour?
Then welcome to this PowSyBl workshop, hosted by Rte, the French Transmission System Operator (TSO)!
During the webinar, you will discover the PowSyBl ecosystem as well as handle and study an electrical network through an interactive Python notebook.
PowSyBl is an open source project hosted by LF Energy, which offers a comprehensive set of features for electrical grid modelling and simulation. Among other advanced features, PowSyBl provides:
- A fully editable and extendable library for grid component modelling;
- Visualization tools to display your network;
- Grid simulation tools, such as power flows, security analyses (with or without remedial actions) and sensitivity analyses;
The framework is mostly written in Java, with a Python binding so that Python developers can access PowSyBl functionalities as well.
What you will learn during the webinar:
- For beginners: discover PowSyBl's functionalities through a quick general presentation and the notebook, without needing any expert coding skills;
- For advanced developers: master the skills to efficiently apply PowSyBl functionalities to your real-world scenarios.
SAP Sapphire 2024 - ASUG301 building better apps with SAP Fiori.pdfPeter Spielvogel
Building better applications for business users with SAP Fiori.
• What is SAP Fiori and why it matters to you
• How a better user experience drives measurable business benefits
• How to get started with SAP Fiori today
• How SAP Fiori elements accelerates application development
• How SAP Build Code includes SAP Fiori tools and other generative artificial intelligence capabilities
• How SAP Fiori paves the way for using AI in SAP apps
PHP Frameworks: I want to break free (IPC Berlin 2024)Ralf Eggert
In this presentation, we examine the challenges and limitations of relying too heavily on PHP frameworks in web development. We discuss the history of PHP and its frameworks to understand how this dependence has evolved. The focus will be on providing concrete tips and strategies to reduce reliance on these frameworks, based on real-world examples and practical considerations. The goal is to equip developers with the skills and knowledge to create more flexible and future-proof web applications. We'll explore the importance of maintaining autonomy in a rapidly changing tech landscape and how to make informed decisions in PHP development.
This talk is aimed at encouraging a more independent approach to using PHP frameworks, moving towards a more flexible and future-proof approach to PHP development.
DevOps and Testing slides at DASA ConnectKari Kakkonen
My and Rik Marselis slides at 30.5.2024 DASA Connect conference. We discuss about what is testing, then what is agile testing and finally what is Testing in DevOps. Finally we had lovely workshop with the participants trying to find out different ways to think about quality and testing in different parts of the DevOps infinity loop.
2. Basics of NGS
• Fragmentation of DNA into a Library of smaller fragments.
• Libraries are then sequenced to be duplicated.
• Bioinformatics piece together the small fragments to create a map
and reference it to the human genome.
3. Differences between methods
PCR
Detects aneuploidy
Detects gene defects
Detects mitotic errors
1-2 month of Preparation
Requires affected proband
Applicable to any case
* Karyomapping using BlueGnome
PCR +
aCGH
SNP
Next Gen
arrays* Sequencing
no
yes
no
yes
no
yes
yes
yes
yes
yes
no
yes
yes
yes
no
no
yes
no
yes
yes
yes
no
no
yes
4. Next Generation Sequencing (NGS)
Fragmentation Each region of the genome
sequenced multiple times
GTACCATAGGATACGACTTGCAGCGGCA
ATATTGCGTATA
Millions of short sequences produced
CAGCGGCAGATGATTCGGGGATATTG
AGGATACGACTTGCAGCGGCAGATGATT
TGCGTATAGG
Sequences are compared to the known human
CAGATGATTCGGGGATATTGCGTA
genome
ACCATAGGATACGACTTGCAGCGGC
TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA
Known sequence (CFTR gene chromosome 7)
Mutations identified and amount of DNA (aneuploidy) revealed
7. PGD for aneuploidy and gene defects
using NGS: Method
• With WGA only <10% is sequenced
• Solution: enrich the sequences of interest prior to NGS. An
aliquot of the WGA product was used to amplify by PCR the CF
ΔF508 mutation site on a cell line
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.
• Conclusion: useful for DIRECT mutation analysis and aneuploid
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
8. PGD for aneuploidy and gene defects
using NGS: Results
Cystic fibrosis gene (CFTR) F508 mutation sequenced in a single blastomere
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
9. •
38 blastocysts from 13 couples with structural chromosomal
abnormalities
•
Whole genome sequence by Illumina HiSeq2000
•
Results: 0.07x depth with average 5.5% genome coverage
•
26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%)
unbalanced only, 2 (5%) unbalanced and aneuploid
•
Highly concordant with SNP array results
Yin et al (2013) Biol Reprod 88, 69
10. •
21 blastocysts from couples at risk of cystic fibrosis and one of
Walker-Warburg syndrome
•
Whole genome amplification was followed by targeted Taqman
amplification of mutation site, sequenced by Ion Torrent and 8
barcoded samples per chip
•
Real time qPCR used for 24 chromosome aneuploidy testing
•
17 (81%) blastocysts euploid, 4 (19%) aneuploid
•
100% concordance of mutation status with STR and minisequencing
Treff et al (2013) Fertility and Sterility 99, 1377-1384
11. PGD for aneuploidy and gene defects
using NGS: Results
• A homozygotic cell line for ΔF508 was used
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.
• Conclusion: this method can be use for DIRECT mutation
analysis and aneuploid
• Other methods such as SNPs can only do haplotype analysis
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
12. Summary Next Gene Sequencing
Current Advantages:
- Same resolution for chromosome abnormalities than aCGH
- Detection of mitochondrial DNA: potentially useful
- Simultaneous detection of aneuploidy and gene defects
Future advantages:
- Whole gene sequencing
13. Vendors of Next Generation Sequencing
Company
Models
Benchtop Chemistry
Roche (454)
GS FLX/GS
Junior
Yes
Illumina
MiSeq/HiSeq/Ge Yes
nome Analyzer
Sequencing by synthesis
Ion Torrent
PGM/Proton/SO
LiD 4
Yes
Semiconductor sequencing
PACBio
PACBIO RS II
No
SMRT technology
Pyrosequencing
14. Vendors of Next Generation Sequencing
or Equivalent
Company
Models
Benchtop
Chemistry
Oxford Nanopore
Technologies
GridION System/MinION
No
Nanopore Sensing
RainDance Technologies
ThunderStorm
System/RDT 1000
Yes
High-Throughput/LowMed Targeted Sequencing
Helicos (Bankrupt)
N/A
N/A
N/A
Complete Genomics
Proprietary Sequencing
N/A
Proprietary (Long
Fragment Reads?)
15. Ion Torrent for Aneuploidy Validation
• 10 single cells from cell lines with known aneuploidies
• 40 embryo cells (previously diagnosed using aCGH)
•
•
•
•
Calculated amount of sequence from each chromosome
50/50 (100%) of samples gave a result
48 separate aneuploidies detected
100% diagnostic accuracy (in a blinded experiment)
16. First baby born from NGS
First NGS baby:
David Levy
A collaboration of
Reprogenetics-US and
Reprogenetics-UK
(Dagan Wells) and Main
Line Fertility (Dr.
Glassner)
17. Helpful tools for NGS
• https://genohub.com/next-gen-sequencing-services/
Editor's Notes
Above is Illumina created pictureBarcode adapters contain sequences that are optimized to provide equal representation of all barcodes in a pool
Usinga different approach i.e. Using an initial targeted PCR to enrich the region in which the mutation is located Treff and colleagues have shown accurate mutation detation and 100% concordance with STR and minisequencing. However, for aneuploidy parallel analysis by real time qPCR was used.... So not clear that there is any advantage in using the sequencer as minisequencing is well established and accurate etc...
Pyrosequencing – taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymaticallySequencing by synthesis - massively parallel sequencing of short reads using solid phase sequencing by reversible terminatorsSemiconductor sequencing – millions of wells capture chemical information that is related to a nucleotide.SMRT Technology – Phospholinked nucleotides are introduced to the DNA strand – occurs in real time
Nanopore sensing – events that create characteristic disruption in current.
