2. Basics of NGS
• Fragmentation of DNA into a Library of smaller fragments.
• Libraries are then sequenced to be duplicated.
• Bioinformatics piece together the small fragments to create a map
and reference it to the human genome.
3. Differences between methods
PCR PCR + SNP Next Gen
aCGH arrays* Sequencing
Detects aneuploidy no yes yes yes
Detects gene defects yes yes yes yes
Detects mitotic errors no yes no yes
1-2 month of Preparation yes yes no no
Requires affected proband no no yes no
Applicable to any case yes yes no yes
* Karyomapping using BlueGnome
4. Next Generation Sequencing (NGS)
Each region of the genome
sequenced multiple times
Fragmentation
GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA
Millions of short sequences produced
CAGCGGCAGATGATTCGGGGATATTG
AGGATACGACTTGCAGCGGCAGATGATT
TGCGTATAGG
Sequences are compared to the known human
CAGATGATTCGGGGATATTGCGTA
ACCATAGGATACGACTTGCAGCGGC
genome
TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA
Known sequence (CFTR gene chromosome 7)
Mutations identified and amount of DNA (aneuploidy) revealed
7. PGD for aneuploidy and gene defects
using NGS: Method
• With WGA only <10% is sequenced
• Solution: enrich the sequences of interest prior to NGS. An
aliquot of the WGA product was used to amplify by PCR the CF
ΔF508 mutation site on a cell line
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.
• Conclusion: useful for DIRECT mutation analysis and aneuploid
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
8. PGD for aneuploidy and gene defects
using NGS: Results
Cystic fibrosis gene (CFTR) DF508 mutation sequenced in a single blastomere
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
9. • 38 blastocysts from 13 couples with structural chromosomal
abnormalities
• Whole genome sequence by Illumina HiSeq2000
• Results: 0.07x depth with average 5.5% genome coverage
• 26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%)
unbalanced only, 2 (5%) unbalanced and aneuploid
• Highly concordant with SNP array results
Yin et al (2013) Biol Reprod 88, 69
10. • 21 blastocysts from couples at risk of cystic fibrosis and one of
Walker-Warburg syndrome
• Whole genome amplification was followed by targeted Taqman
amplification of mutation site, sequenced by Ion Torrent and 8
barcoded samples per chip
• Real time qPCR used for 24 chromosome aneuploidy testing
• 17 (81%) blastocysts euploid, 4 (19%) aneuploid
• 100% concordance of mutation status with STR and minisequencing
Treff et al (2013) Fertility and Sterility 99, 1377-1384
11. PGD for aneuploidy and gene defects
using NGS: Results
• A homozygotic cell line for ΔF508 was used
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.
• Conclusion: this method can be use for DIRECT mutation
analysis and aneuploid
• Other methods such as SNPs can only do haplotype analysis
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
12. Summary Next Gene Sequencing
Current Advantages:
- Same resolution for chromosome abnormalities than aCGH
- Detection of mitochondrial DNA: potentially useful
- Simultaneous detection of aneuploidy and gene defects
Future advantages:
- Whole gene sequencing
13. Vendors of Next Generation Sequencing
Company Models Benchtop Chemistry
Roche (454) GS FLX/GS
Junior
Yes Pyrosequencing
Illumina MiSeq/HiSeq/Ge
nome Analyzer
Yes Sequencing by synthesis
Ion Torrent PGM/Proton/SO
LiD 4
Yes Semiconductor sequencing
PACBio PACBIO RS II No SMRT technology
14. Vendors of Next Generation Sequencing or
Equivalent
Company Models Benchtop Chemistry
Oxford Nanopore
Technologies
GridION System/MinION No Nanopore Sensing
RainDance Technologies ThunderStorm
System/RDT 1000
Yes High-Throughput/Low-
Med Targeted Sequencing
Helicos (Bankrupt) N/A N/A N/A
Complete Genomics Proprietary Sequencing N/A Proprietary (Long
Fragment Reads?)
15. Ion Torrent for Aneuploidy Validation
• 10 single cells from cell lines with known aneuploidies
• 40 embryo cells (previously diagnosed using aCGH)
• Calculated amount of sequence from each chromosome
• 50/50 (100%) of samples gave a result
• 48 separate aneuploidies detected
• 100% diagnostic accuracy (in a blinded experiment)
16. First baby born from NGS
First NGS baby:
David Levy
A collaboration of
Reprogenetics-US and
Reprogenetics-UK
(Dagan Wells) and Main
Line Fertility (Dr.
Glassner)
17. Helpful tools for NGS
• https://genohub.com/next-gen-sequencing-services/
