The power point tells about the gene polymorphism alters the protein structure. Alteration in protein structure leads to malfunction of gene causes disease. PKD gnes-Polycystin 1 and 2 protein - Polycystic kidney disease.
Next generation sequencing (NGS) can simultaneously detect aneuploidy and gene defects in single cells. It involves fragmenting DNA, sequencing short fragments, and using bioinformatics to map the fragments to the human genome. NGS can detect chromosome abnormalities and mutations with the same resolution as array comparative genomic hybridization. It also allows detection of mitochondrial DNA abnormalities and simultaneous analysis of aneuploidy and gene defects. In the future, whole gene sequencing may be possible. NGS is being used successfully for preimplantation genetic diagnosis and was used to produce the first baby born from NGS analysis.
1) The study found that the long non-coding RNA TUG1 and bone morphogenetic protein BMP-7 were overexpressed and underexpressed, respectively, in clinical periprosthetic tissues and cobalt-chromium particle stimulated osteoblasts.
2) Knockdown of TUG1 significantly inhibited apoptosis of particle-stimulated osteoblasts by targeting BMP-7.
3) In vivo experiments in a mouse osteolysis model showed that knockdown of TUG1 increased bone mineral density, suggesting TUG1 inhibition may provide a new approach for treating periprosthetic osteolysis after hip arthroplasty.
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...Enrique Moreno Gonzalez
Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion.
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
Next generation sequencing (NGS) has revolutionized cancer treatment by enabling high throughput DNA sequencing. This document discusses several applications of NGS in cancer treatment including whole exome sequencing of tumors from 25 patients to identify genetic mutations, using avatar mouse models to test proposed treatment strategies, detecting mutations in liquid biopsies, and identifying somatic mutations in leukemia patients. Challenges of NGS include analyzing large amounts of data, accurately interpreting variants, and addressing ethical issues.
Functional p53 is required for rapid restoration of daunorubicin-induced lesi...Enrique Moreno Gonzalez
This document summarizes a research article that studied the role of p53 in daunorubicin (DNR)-induced lesions in the spleen. The key findings were:
1) DNR treatment caused more rapid cell death and weight loss in the spleens of wild type mice compared to p53-null mice.
2) While wild type mouse spleens recovered normal morphology 8 days after DNR treatment, p53-null mouse spleens still had large necrotic lesions.
3) DNR treatment increased p21 levels in wild type mice but not p53-null mice, indicating p53 is required for p21 induction.
4) The results suggest p53
This study examined the effects of prolonged simvastatin (SIM) treatment on ischemia-reperfusion (I/R) induced acute kidney injury in rats. Rats were divided into four groups: sham, ischemia, I/R, and I/R+SIM treated. The I/R group showed intense inflammation, necrosis, and apoptosis in kidney tissue. The I/R+SIM group showed reduced inflammation and tissue damage. Biochemical analysis found increased oxidative stress and inflammation markers in the ischemia and I/R groups compared to control, but levels in the I/R+SIM group were similar to control. Histological analysis also showed more damage in ischemia and I/R groups versus control, while the I/R+
1) The study found that circ-LDLRAD3, STAT3 expression were upregulated while miR-876-3p expression was downregulated in pancreatic cancer tissues and cell lines compared to normal tissues/cells.
2) Knockdown of circ-LDLRAD3 suppressed pancreatic cancer cell proliferation, migration, and invasion.
3) Mechanistically, circ-LDLRAD3 was found to directly regulate miR-876-3p expression, and miR-876-3p targets STAT3. Downregulation of circ-LDLRAD3 inhibited cell proliferation, invasion and migration by regulating the miR-876-3p/STAT3 axis.
This document discusses using whole genome sequencing and variant prioritization tools to diagnose rare genetic diseases in individuals. It describes how sequencing the whole genome reveals millions of variants, but focusing on the exome and protein-coding regions reduces this to tens of thousands of variants. Further prioritization by effects on protein function, rarity, predicted damage, and inheritance patterns can narrow this down to a handful of likely disease-causing genes. The document presents a case study of a child with liver disease who was diagnosed with a rare genetic condition called PFIC2 after family-wide exome sequencing and analysis with the VAAST software prioritization tool. It concludes that genome sequencing should be a first-line test for undiagnosed
Next generation sequencing (NGS) can simultaneously detect aneuploidy and gene defects in single cells. It involves fragmenting DNA, sequencing short fragments, and using bioinformatics to map the fragments to the human genome. NGS can detect chromosome abnormalities and mutations with the same resolution as array comparative genomic hybridization. It also allows detection of mitochondrial DNA abnormalities and simultaneous analysis of aneuploidy and gene defects. In the future, whole gene sequencing may be possible. NGS is being used successfully for preimplantation genetic diagnosis and was used to produce the first baby born from NGS analysis.
1) The study found that the long non-coding RNA TUG1 and bone morphogenetic protein BMP-7 were overexpressed and underexpressed, respectively, in clinical periprosthetic tissues and cobalt-chromium particle stimulated osteoblasts.
2) Knockdown of TUG1 significantly inhibited apoptosis of particle-stimulated osteoblasts by targeting BMP-7.
3) In vivo experiments in a mouse osteolysis model showed that knockdown of TUG1 increased bone mineral density, suggesting TUG1 inhibition may provide a new approach for treating periprosthetic osteolysis after hip arthroplasty.
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...Enrique Moreno Gonzalez
Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion.
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
Next generation sequencing (NGS) has revolutionized cancer treatment by enabling high throughput DNA sequencing. This document discusses several applications of NGS in cancer treatment including whole exome sequencing of tumors from 25 patients to identify genetic mutations, using avatar mouse models to test proposed treatment strategies, detecting mutations in liquid biopsies, and identifying somatic mutations in leukemia patients. Challenges of NGS include analyzing large amounts of data, accurately interpreting variants, and addressing ethical issues.
Functional p53 is required for rapid restoration of daunorubicin-induced lesi...Enrique Moreno Gonzalez
This document summarizes a research article that studied the role of p53 in daunorubicin (DNR)-induced lesions in the spleen. The key findings were:
1) DNR treatment caused more rapid cell death and weight loss in the spleens of wild type mice compared to p53-null mice.
2) While wild type mouse spleens recovered normal morphology 8 days after DNR treatment, p53-null mouse spleens still had large necrotic lesions.
3) DNR treatment increased p21 levels in wild type mice but not p53-null mice, indicating p53 is required for p21 induction.
4) The results suggest p53
This study examined the effects of prolonged simvastatin (SIM) treatment on ischemia-reperfusion (I/R) induced acute kidney injury in rats. Rats were divided into four groups: sham, ischemia, I/R, and I/R+SIM treated. The I/R group showed intense inflammation, necrosis, and apoptosis in kidney tissue. The I/R+SIM group showed reduced inflammation and tissue damage. Biochemical analysis found increased oxidative stress and inflammation markers in the ischemia and I/R groups compared to control, but levels in the I/R+SIM group were similar to control. Histological analysis also showed more damage in ischemia and I/R groups versus control, while the I/R+
1) The study found that circ-LDLRAD3, STAT3 expression were upregulated while miR-876-3p expression was downregulated in pancreatic cancer tissues and cell lines compared to normal tissues/cells.
2) Knockdown of circ-LDLRAD3 suppressed pancreatic cancer cell proliferation, migration, and invasion.
3) Mechanistically, circ-LDLRAD3 was found to directly regulate miR-876-3p expression, and miR-876-3p targets STAT3. Downregulation of circ-LDLRAD3 inhibited cell proliferation, invasion and migration by regulating the miR-876-3p/STAT3 axis.
This document discusses using whole genome sequencing and variant prioritization tools to diagnose rare genetic diseases in individuals. It describes how sequencing the whole genome reveals millions of variants, but focusing on the exome and protein-coding regions reduces this to tens of thousands of variants. Further prioritization by effects on protein function, rarity, predicted damage, and inheritance patterns can narrow this down to a handful of likely disease-causing genes. The document presents a case study of a child with liver disease who was diagnosed with a rare genetic condition called PFIC2 after family-wide exome sequencing and analysis with the VAAST software prioritization tool. It concludes that genome sequencing should be a first-line test for undiagnosed
This document summarizes a research study that investigated the role of long non-coding RNA H19, microRNA miR-29b, and the gene FOXO4 in the apoptosis of retinal Müller cells in diabetic retinopathy. The study found that H19 and FOXO4 expression were increased, while miR-29b expression was decreased, in retinal tissue from diabetic rats and in retinal Müller cells treated with high glucose. Overexpression of H19 promoted retinal Müller cell apoptosis. Knockdown of H19 reversed the effects of high glucose by decreasing cell apoptosis and FOXO4 upregulation. Further experiments indicated that H19 is a target of miR-29b and inhibition of miR-29b
Ultrasound treatment was found to reverse drug resistance in non-small cell lung cancer cells by positively regulating the expression of the long non-coding RNA BANCR. Experiments showed ultrasound increased BANCR expression in drug-resistant cancer cells and tumor tissue in mice, reducing expression of drug efflux proteins P-gp and MRP involved in multidrug resistance. Overexpression of BANCR similarly decreased P-gp and MRP levels, while inhibiting BANCR increased their expression. Thus, ultrasound may reverse drug resistance by regulating BANCR and subsequent expression of resistance proteins.
1) The study investigated the role of the long non-coding RNA NNT-AS1 in progesterone resistance in endometrial cancer.
2) The researchers found that NNT-AS1 and survivin expression were increased, while miR-542-3p expression was decreased, in progesterone-resistant endometrial cancer cells.
3) Experiments showed that NNT-AS1 regulates progesterone resistance in endometrial cancer by functioning as a competing endogenous RNA for miR-542-3p, thereby regulating survivin expression.
The Knockout Rat Consortium (KORC) is a group of individuals and institutions working to create genetically modified rat models using techniques like transposon-based mutagenesis and chemical mutagenesis. The KORC database currently lists over 300 rat models, including models of SCID, p53 knockout, pain (Trpc4 knockout), hydrocephalus (Myo9a knockout), and obesity (Mc4r knockout). The goal of KORC is to generate rat models with single gene disruptions for every rat gene to provide a resource for the research community.
This study examined the role of the long non-coding RNA MEG3 in retinal ganglion cell apoptosis in a mouse model of acute glaucoma and in an in vitro model of oxygen-glucose deprivation and reoxygenation. The study found that MEG3 expression was increased in retinal tissues from the mouse glaucoma model and in retinal ganglion cells treated with oxygen-glucose deprivation. Knockdown of MEG3 using siRNA reduced retinal ganglion cell apoptosis following oxygen-glucose deprivation. Further experiments revealed that MEG3 directly interacts with the microRNA miR-106b, which targets the pro-apoptotic gene caspase-8. Thus, MEG3 increases retinal ganglion cell
- miR-449b expression was significantly decreased in human CRC tissues and cell lines compared to normal tissues, and was even lower in metastatic CRC tissues.
- Forced expression of miR-449b in CRC cells significantly inhibited cell migration and invasion in vitro.
- miR-449b was found to negatively regulate MMP2 in CRC cells, and overexpression of MMP2 reversed the inhibitory effects of miR-449b on cell invasion and migration.
Radiotherapy promotes the polarization of tumor-associated macrophages (TAMs) in mice with Lewis lung cancer into anti-tumor M1 macrophages. This is accompanied by increased expression of the long non-coding RNA lincRNA-p21 in the TAMs. TAMs exposed to radiation therapy suppress the viability and invasion of Lewis lung cancer cells in culture. Overexpression of lincRNA-p21 in TAMs enhances their anti-tumor effects, while decreasing lincRNA-p21 reduces the effects of radiation therapy, suggesting lincRNA-p21 plays a key role in the anti-tumor actions of radiotherapy in lung cancer.
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
This study used gene expression profiling to identify novel cell surface marker genes that are specifically upregulated in glioblastoma stem-like cells (GSCs). They found 19 such genes upregulated in GSCs compared to normal brain tissue, neural stem cells, and glioblastoma tumor samples. Validation by qRT-PCR in additional GSC lines confirmed differential upregulation. Immunoblotting showed that the expression of cadherin-19 (CDH19) protein was restricted to minimally infiltrative GSCs, but not detected in other GSC lines, glioblastoma cell lines, or normal neural cells. This suggests CDH19 could serve as a feasible marker for identifying, isolating and developing drugs targeting GSCs.
This document describes research investigating the potential of human endometrial stem cells (EnSCs) to differentiate into neural cells. EnSCs were isolated from endometrial biopsies and characterized by flow cytometry, showing expression of stem cell markers and lack of hematopoietic/endothelial markers. The EnSCs were induced to differentiate into neural cells using growth factors like bFGF, PDGF, and EGF. After induction, the cells expressed neural markers like MAP2, β3-tubulin, and NF-L at the mRNA and protein levels based on RT-PCR and immunocytochemistry. The results demonstrate that EnSCs can respond to signaling molecules and differentiate into neuronal-like cells, suggesting their potential
Los días 11 y 12 de diciembre de 2014, la Fundación Ramón Areces celebró el Simposio Internacional 'Neuropatías periféricas hereditarias. Desde la biología a la terapéutica' en colaboración con CIBERER-ISCIII y el Centro de Investigación Príncipe Felipe. El tipo más común de estas patologías es la enfermedad de Charcot-Marie-Tooth, un trastorno neuromuscular hereditario con una prevalencia estimada de 17-40 afectados por 100.000 habitantes. Durante estos dos días, investigadores mostraron sus avances en la mejora del diagnóstico y el tratamiento y, por ende, de la aproximación clínica y la calidad de vida de las personas afectadas por estas patologías.
This document summarizes an experiment aiming to knockout the CTNNB1 gene in mouse embryonic stem cells using CRISPR-Cas9 genome editing. It describes designing a guide RNA targeting exon 10 of CTNNB1, cloning it into a vector, transforming E. coli, and testing primers for detecting knockout via PCR and qPCR. Prior studies showed CTNNB1 knockout embryos had defects in ectoderm and mesoderm development. The authors hypothesized knocking out CTNNB1 in stem cells would produce inviable embryos, similar to prior findings.
1) The study investigated the effects of gasdermin D on pyroptosis in a mouse model of sepsis-induced acute kidney injury.
2) The results showed that gasdermin D expression was increased in mice with sepsis-induced acute kidney injury and promoted inflammation and pyroptosis in kidney cells.
3) Downregulating gasdermin D decreased inflammation and pyroptosis, and the NLRP3 inflammasome was identified as an important target of gasdermin D in mediating inflammation during sepsis-induced acute kidney injury.
Cholestasis induces reversible accumulation of periplakin in mouse liverEnrique Moreno Gonzalez
Periplakin (PPL) is a rod-shaped cytolinker protein thought to connect cellular adhesion junctional complexes to cytoskeletal filaments. PPL serves as a structural component of the cornified envelope in the skin and interacts with various types of proteins in cultured cells; its level decreases dramatically during tumorigenic progression in human epithelial tissues. Despite these intriguing observations, the physiological roles of PPL, especially in noncutaneous tissues, are still largely unknown. Because we observed a marked fluctuation of PPL expression in mouse liver in association with the bile acid receptor farnesoid X receptor (FXR) and cholestasis, we sought to characterize the role of PPL in the liver and determine its contributions to the etiology and pathogenesis of cholestasis.
This study sequenced four genes (TNNT3, TNNI2, TPM2, MYH3) in 19 individuals with distal arthrogryposis (DA) to search for pathogenic mutations. No mutations were found in the sequenced regions for the 13 individuals with unclassified DA or 5 with Sheldon-Hall syndrome. A previously reported pathogenic mutation in MYH3 was identified in the single individual with Freeman-Sheldon syndrome, providing further evidence that mutations in this gene cause this condition. The results suggest that mutations in other regions of the genes or in non-coding regions may be responsible for the unclassified DA cases.
This study investigated the effects of Ginsenoside Rh2 on the STAT3 signaling pathway in human gastric cancer NCI-N87 cells. The results showed that Ginsenoside Rh2 treatment decreased phosphorylation of STAT3 and Jak2 proteins in NCI-N87 cells and inhibited IL-induced phosphorylation of these proteins. Ginsenoside Rh2 selectively inhibited phosphorylation of Tyr705 in the STAT3 molecule by downregulating phosphorylation of Jak2 protein specifically. Transfection of a CA-STAT3 plasmid reversed the G0/G1 phase arrest and apoptosis caused by Ginsenoside Rh2, indicating it acts by inhibiting the STAT3 pathway.
This document summarizes a study investigating the epigenetic changes that occur during the transdifferentiation of pancreatic acinar cells (HPACs) to hepatocyte-like cells. The study found that DNA methylation in HPACs peaks at 24 hours after treatment with dexamethasone, and the cells display phenotypic changes associated with hepatocytes after 7 days. The study also examined the promoter sequence of the SGK1 gene, which is involved in the transdifferentiation process. The results suggest therapeutic potential for producing hepatocytes from pancreatic cells to treat liver disease in a more cost-effective manner than current alternatives.
This study analyzed the diagnostic and prognostic value of CASC5 in lung adenocarcinoma. Bioinformatics analyses showed that CASC5 mRNA levels were increased in lung adenocarcinoma and correlated with poor survival. Immunohistochemistry also demonstrated increased CASC5 protein levels in lung adenocarcinoma compared to normal tissues. High CASC5 expression correlated with advanced T classification and poor prognosis, and was an independent prognostic indicator for lung adenocarcinoma patients.
Recombinant DNA technology allows scientists to isolate, clone, and manipulate specific genes. DNA from different species can be combined to produce new genetic combinations of value. Genes are cloned by inserting DNA fragments into vectors like plasmids, which are then inserted into host cells where they replicate numerous identical copies of the gene. This cloning process allows genes to be studied, sequenced, and modified in precise ways. Genetically modified organisms can then be produced by adding transgenes to organisms' genomes.
The document summarizes several key studies from 2011 related to glomerular diseases, polycystic kidney disease, acute kidney injury, and transplantation. Notable findings include identification of bovine serum albumin as a potential antigen in membranous nephropathy, discovery of soluble urokinase receptor as a circulating factor in recurrent focal segmental glomerulosclerosis, and evidence that tolvaptan and metformin may be novel therapeutics for polycystic kidney disease by inhibiting vasopressin and mTOR pathways respectively.
ABSTRACT- Coronary artery disease (CAD) is suspected as a leading cause of mortality in developed countries. Due
to cholesterol and fat deposit plaque is forming into the inner walls of the arteries of the heart, which leads to narrowing
of blood vessels of heart and reduce the blood flow rate into heart. Proprotein convertase subtilisin-like kexin type 9
(PCSK9) is one of the candidate gene that regulate lipoprotein retention pathway of CAD development. It is a newly
discovered serine protease that plays a key role in LDL-C homeostasis by mediating LDL receptor (LDLR). The LDL
receptor is breakdown through a post transcriptional mechanism and induces the production of very low-density
lipoprotein in the fasting state. The aim of this study was to investigate the frequency of single nucleotide
polymorphism (SNP) of PCSK9 gene of 155 CAD patients and 102 ages matched healthy controls. Serum lipids
including total cholesterol (TC), triglycerides (TG), HDL, LDL, and VLDL were analyzed. PCR-RFLP analysis was
carried out to genotype regions carrying Eam 1104I restriction site in the PCSK9. Gene considering significant
difference in serum TC, TG, HDL-C, LDL-C and VLDL-C levels (P<0.001, <0.0001) of patients and control samples.
In CAD patients, G allele frequency is less than A allele frequency. G allele is responsible for decreasing the
LDL: HDL ratio which shows evidence in having its protecting effect on the occurrence of CAD in West Bengal Population.
Key-words- CAD, PCSK9, SNP, Eam1104I, Polymorphism, West Bengal population
This document summarizes a research study that investigated the role of long non-coding RNA H19, microRNA miR-29b, and the gene FOXO4 in the apoptosis of retinal Müller cells in diabetic retinopathy. The study found that H19 and FOXO4 expression were increased, while miR-29b expression was decreased, in retinal tissue from diabetic rats and in retinal Müller cells treated with high glucose. Overexpression of H19 promoted retinal Müller cell apoptosis. Knockdown of H19 reversed the effects of high glucose by decreasing cell apoptosis and FOXO4 upregulation. Further experiments indicated that H19 is a target of miR-29b and inhibition of miR-29b
Ultrasound treatment was found to reverse drug resistance in non-small cell lung cancer cells by positively regulating the expression of the long non-coding RNA BANCR. Experiments showed ultrasound increased BANCR expression in drug-resistant cancer cells and tumor tissue in mice, reducing expression of drug efflux proteins P-gp and MRP involved in multidrug resistance. Overexpression of BANCR similarly decreased P-gp and MRP levels, while inhibiting BANCR increased their expression. Thus, ultrasound may reverse drug resistance by regulating BANCR and subsequent expression of resistance proteins.
1) The study investigated the role of the long non-coding RNA NNT-AS1 in progesterone resistance in endometrial cancer.
2) The researchers found that NNT-AS1 and survivin expression were increased, while miR-542-3p expression was decreased, in progesterone-resistant endometrial cancer cells.
3) Experiments showed that NNT-AS1 regulates progesterone resistance in endometrial cancer by functioning as a competing endogenous RNA for miR-542-3p, thereby regulating survivin expression.
The Knockout Rat Consortium (KORC) is a group of individuals and institutions working to create genetically modified rat models using techniques like transposon-based mutagenesis and chemical mutagenesis. The KORC database currently lists over 300 rat models, including models of SCID, p53 knockout, pain (Trpc4 knockout), hydrocephalus (Myo9a knockout), and obesity (Mc4r knockout). The goal of KORC is to generate rat models with single gene disruptions for every rat gene to provide a resource for the research community.
This study examined the role of the long non-coding RNA MEG3 in retinal ganglion cell apoptosis in a mouse model of acute glaucoma and in an in vitro model of oxygen-glucose deprivation and reoxygenation. The study found that MEG3 expression was increased in retinal tissues from the mouse glaucoma model and in retinal ganglion cells treated with oxygen-glucose deprivation. Knockdown of MEG3 using siRNA reduced retinal ganglion cell apoptosis following oxygen-glucose deprivation. Further experiments revealed that MEG3 directly interacts with the microRNA miR-106b, which targets the pro-apoptotic gene caspase-8. Thus, MEG3 increases retinal ganglion cell
- miR-449b expression was significantly decreased in human CRC tissues and cell lines compared to normal tissues, and was even lower in metastatic CRC tissues.
- Forced expression of miR-449b in CRC cells significantly inhibited cell migration and invasion in vitro.
- miR-449b was found to negatively regulate MMP2 in CRC cells, and overexpression of MMP2 reversed the inhibitory effects of miR-449b on cell invasion and migration.
Radiotherapy promotes the polarization of tumor-associated macrophages (TAMs) in mice with Lewis lung cancer into anti-tumor M1 macrophages. This is accompanied by increased expression of the long non-coding RNA lincRNA-p21 in the TAMs. TAMs exposed to radiation therapy suppress the viability and invasion of Lewis lung cancer cells in culture. Overexpression of lincRNA-p21 in TAMs enhances their anti-tumor effects, while decreasing lincRNA-p21 reduces the effects of radiation therapy, suggesting lincRNA-p21 plays a key role in the anti-tumor actions of radiotherapy in lung cancer.
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
This study used gene expression profiling to identify novel cell surface marker genes that are specifically upregulated in glioblastoma stem-like cells (GSCs). They found 19 such genes upregulated in GSCs compared to normal brain tissue, neural stem cells, and glioblastoma tumor samples. Validation by qRT-PCR in additional GSC lines confirmed differential upregulation. Immunoblotting showed that the expression of cadherin-19 (CDH19) protein was restricted to minimally infiltrative GSCs, but not detected in other GSC lines, glioblastoma cell lines, or normal neural cells. This suggests CDH19 could serve as a feasible marker for identifying, isolating and developing drugs targeting GSCs.
This document describes research investigating the potential of human endometrial stem cells (EnSCs) to differentiate into neural cells. EnSCs were isolated from endometrial biopsies and characterized by flow cytometry, showing expression of stem cell markers and lack of hematopoietic/endothelial markers. The EnSCs were induced to differentiate into neural cells using growth factors like bFGF, PDGF, and EGF. After induction, the cells expressed neural markers like MAP2, β3-tubulin, and NF-L at the mRNA and protein levels based on RT-PCR and immunocytochemistry. The results demonstrate that EnSCs can respond to signaling molecules and differentiate into neuronal-like cells, suggesting their potential
Los días 11 y 12 de diciembre de 2014, la Fundación Ramón Areces celebró el Simposio Internacional 'Neuropatías periféricas hereditarias. Desde la biología a la terapéutica' en colaboración con CIBERER-ISCIII y el Centro de Investigación Príncipe Felipe. El tipo más común de estas patologías es la enfermedad de Charcot-Marie-Tooth, un trastorno neuromuscular hereditario con una prevalencia estimada de 17-40 afectados por 100.000 habitantes. Durante estos dos días, investigadores mostraron sus avances en la mejora del diagnóstico y el tratamiento y, por ende, de la aproximación clínica y la calidad de vida de las personas afectadas por estas patologías.
This document summarizes an experiment aiming to knockout the CTNNB1 gene in mouse embryonic stem cells using CRISPR-Cas9 genome editing. It describes designing a guide RNA targeting exon 10 of CTNNB1, cloning it into a vector, transforming E. coli, and testing primers for detecting knockout via PCR and qPCR. Prior studies showed CTNNB1 knockout embryos had defects in ectoderm and mesoderm development. The authors hypothesized knocking out CTNNB1 in stem cells would produce inviable embryos, similar to prior findings.
1) The study investigated the effects of gasdermin D on pyroptosis in a mouse model of sepsis-induced acute kidney injury.
2) The results showed that gasdermin D expression was increased in mice with sepsis-induced acute kidney injury and promoted inflammation and pyroptosis in kidney cells.
3) Downregulating gasdermin D decreased inflammation and pyroptosis, and the NLRP3 inflammasome was identified as an important target of gasdermin D in mediating inflammation during sepsis-induced acute kidney injury.
Cholestasis induces reversible accumulation of periplakin in mouse liverEnrique Moreno Gonzalez
Periplakin (PPL) is a rod-shaped cytolinker protein thought to connect cellular adhesion junctional complexes to cytoskeletal filaments. PPL serves as a structural component of the cornified envelope in the skin and interacts with various types of proteins in cultured cells; its level decreases dramatically during tumorigenic progression in human epithelial tissues. Despite these intriguing observations, the physiological roles of PPL, especially in noncutaneous tissues, are still largely unknown. Because we observed a marked fluctuation of PPL expression in mouse liver in association with the bile acid receptor farnesoid X receptor (FXR) and cholestasis, we sought to characterize the role of PPL in the liver and determine its contributions to the etiology and pathogenesis of cholestasis.
This study sequenced four genes (TNNT3, TNNI2, TPM2, MYH3) in 19 individuals with distal arthrogryposis (DA) to search for pathogenic mutations. No mutations were found in the sequenced regions for the 13 individuals with unclassified DA or 5 with Sheldon-Hall syndrome. A previously reported pathogenic mutation in MYH3 was identified in the single individual with Freeman-Sheldon syndrome, providing further evidence that mutations in this gene cause this condition. The results suggest that mutations in other regions of the genes or in non-coding regions may be responsible for the unclassified DA cases.
This study investigated the effects of Ginsenoside Rh2 on the STAT3 signaling pathway in human gastric cancer NCI-N87 cells. The results showed that Ginsenoside Rh2 treatment decreased phosphorylation of STAT3 and Jak2 proteins in NCI-N87 cells and inhibited IL-induced phosphorylation of these proteins. Ginsenoside Rh2 selectively inhibited phosphorylation of Tyr705 in the STAT3 molecule by downregulating phosphorylation of Jak2 protein specifically. Transfection of a CA-STAT3 plasmid reversed the G0/G1 phase arrest and apoptosis caused by Ginsenoside Rh2, indicating it acts by inhibiting the STAT3 pathway.
This document summarizes a study investigating the epigenetic changes that occur during the transdifferentiation of pancreatic acinar cells (HPACs) to hepatocyte-like cells. The study found that DNA methylation in HPACs peaks at 24 hours after treatment with dexamethasone, and the cells display phenotypic changes associated with hepatocytes after 7 days. The study also examined the promoter sequence of the SGK1 gene, which is involved in the transdifferentiation process. The results suggest therapeutic potential for producing hepatocytes from pancreatic cells to treat liver disease in a more cost-effective manner than current alternatives.
This study analyzed the diagnostic and prognostic value of CASC5 in lung adenocarcinoma. Bioinformatics analyses showed that CASC5 mRNA levels were increased in lung adenocarcinoma and correlated with poor survival. Immunohistochemistry also demonstrated increased CASC5 protein levels in lung adenocarcinoma compared to normal tissues. High CASC5 expression correlated with advanced T classification and poor prognosis, and was an independent prognostic indicator for lung adenocarcinoma patients.
Recombinant DNA technology allows scientists to isolate, clone, and manipulate specific genes. DNA from different species can be combined to produce new genetic combinations of value. Genes are cloned by inserting DNA fragments into vectors like plasmids, which are then inserted into host cells where they replicate numerous identical copies of the gene. This cloning process allows genes to be studied, sequenced, and modified in precise ways. Genetically modified organisms can then be produced by adding transgenes to organisms' genomes.
The document summarizes several key studies from 2011 related to glomerular diseases, polycystic kidney disease, acute kidney injury, and transplantation. Notable findings include identification of bovine serum albumin as a potential antigen in membranous nephropathy, discovery of soluble urokinase receptor as a circulating factor in recurrent focal segmental glomerulosclerosis, and evidence that tolvaptan and metformin may be novel therapeutics for polycystic kidney disease by inhibiting vasopressin and mTOR pathways respectively.
ABSTRACT- Coronary artery disease (CAD) is suspected as a leading cause of mortality in developed countries. Due
to cholesterol and fat deposit plaque is forming into the inner walls of the arteries of the heart, which leads to narrowing
of blood vessels of heart and reduce the blood flow rate into heart. Proprotein convertase subtilisin-like kexin type 9
(PCSK9) is one of the candidate gene that regulate lipoprotein retention pathway of CAD development. It is a newly
discovered serine protease that plays a key role in LDL-C homeostasis by mediating LDL receptor (LDLR). The LDL
receptor is breakdown through a post transcriptional mechanism and induces the production of very low-density
lipoprotein in the fasting state. The aim of this study was to investigate the frequency of single nucleotide
polymorphism (SNP) of PCSK9 gene of 155 CAD patients and 102 ages matched healthy controls. Serum lipids
including total cholesterol (TC), triglycerides (TG), HDL, LDL, and VLDL were analyzed. PCR-RFLP analysis was
carried out to genotype regions carrying Eam 1104I restriction site in the PCSK9. Gene considering significant
difference in serum TC, TG, HDL-C, LDL-C and VLDL-C levels (P<0.001, <0.0001) of patients and control samples.
In CAD patients, G allele frequency is less than A allele frequency. G allele is responsible for decreasing the
LDL: HDL ratio which shows evidence in having its protecting effect on the occurrence of CAD in West Bengal Population.
Key-words- CAD, PCSK9, SNP, Eam1104I, Polymorphism, West Bengal population
Identification of the Enrichment Pathways of Catalase in Multiple Primary Tumorsdaranisaha
Reactive oxygen species (ROS) has been detected in almost all cancers, which it involves many aspects of carcinogenesis and tumor progression. We previously reported a novel oncogenic role of manganese superoxide dismutase (MnSOD; SOD2) in invasive lung adenocarcinoma (LUAD) by upregulating forkhead box protein M1 (FOXM1) and matrix metalloproteinase-2 (MMP2) expression. In this study, we used a comprehensive analysis and further evaluated the effects of a hydrogen peroxide (H2O2) scavenger, catalase (CAT) in The Cancer Genome Atlas (TCGA) datasets of the different cancer types.
DNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomaskomalicarol
Renal cell carcinoma (RCC) refers to a group of tumors that develop from the epithelium of the kidney tubes, including clear cell
RCC, papillary RCC, and chromophobe RCC. Most clear cell renal
carcinomas have a large histologic subtype, genetic or epigenetic
genetic von Hippel-Lindau (VHL). A comprehensive analysis of
the genetic modification genome suggested that chromosome 3p
loss and chromosome gains 5q and 7 may be a significant copy
defect in the development of clear kidney cell cancer. A more potent renal cell carcinoma may develop if chromosome 1p, 4, 9,
13q, or 14q is also lost. Renal carcinogenesis is not associated with
chronic inflammation or histological changes. However, regional hypermethylation of DNA in CpG C-type islands has already
accumulated in cancer-free kidney tissue, implying that the presence of malignant kidney lesions may also be detected by modified
DNA methylation. Modification of DNA methylation in cancerous
kidney tissue may advance kidney tissue to epigenetic mutations
and genes, leading to more serious cancers and even determining
a patient’s outcome
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Alexandra Papadopoulou
This study analyzed mutations in the BRAF and RAS family genes in 33 thyroid carcinoma samples from Greek patients. The samples represented the common types of thyroid cancer seen in the general population. DNA was extracted from tissue biopsies and tested for mutations in BRAF codon 600 and RAS codons 12, 13 and 61 via PCR and sequencing. No mutations were found in BRAF or the RAS genes tested. While the sample size was representative of thyroid cancer prevalence, the results need validation in a larger cohort given the reported mutually exclusivity of mutations and variability in prevalence depending on carcinoma type. A previous Greek study found higher mutation rates than reported literature, highlighting genetic differences between populations.
1. The study found that lncRNA PCAT29 was downregulated in renal carcinoma tissues, while the expression of FLOT1 was upregulated.
2. Overexpression of PCAT29 inhibited cell proliferation, invasion, and migration of renal carcinoma cells by downregulating FLOT1.
3. In a mouse model of renal carcinoma, overexpression of PCAT29 inhibited tumor growth, suggesting PCAT29 suppresses renal carcinoma progression by downregulating FLOT1.
Whole exome sequencing was performed on a cohort of patients with DOORS syndrome to identify the genetic basis. Homozygous or compound heterozygous mutations in the TBC1D24 gene were identified in several patients. Further analysis showed that the mutations cause loss of function of the TBC1D24 protein, implicating defective vesicular trafficking as the potential cause of DOORS syndrome. However, further studies are still needed to fully understand the role of TBC1D24 and the genetic heterogeneity of this rare disorder.
This document provides an overview of the management of secondary hyperparathyroidism (SHPT) in dialysis patients and beyond. It discusses the physiological basis of calcium and phosphorus homeostasis and the role of parathyroid hormone (PTH), vitamin D, and fibroblast growth factor 23 (FGF23). The presentation reviews guidelines for monitoring mineral metabolism and treating SHPT, including medical therapies like vitamin D analogs and calcimimetics, as well as surgical parathyroidectomy. It also addresses special considerations for managing SHPT in kidney transplant candidates and recipients to help control mineral metabolism and improve transplant outcomes.
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...Cornell University
Background: Peptidylarginine deiminase enzymes (PADs) convert arginine residues to citrulline in a process called citrullination or deimination. Recently, two PADs, PAD2 and PAD4, have been linked to hormone signaling in vitro and the goal of this study was to test for links between PAD2/PAD4 and hormone signaling in vivo.
Methods: Preliminary analysis of Padi2 and Padi4 single knockout (SKO) mice did not find any overt reproductive defects and we predicted that this was likely due to genetic compensation. To test this hypothesis, we created a Padi2/Padi4 double knockout (DKO) mouse model and tested these mice for a range of reproductive defects. Results: Controlled breeding trials found that DKO breeding pairs, particularly males, appeared to take longer to have their first litter than wild-type FVB controls (WT), and that pups and DKO male weanlings weighed significantly less than their WT counterparts. Additionally, DKO males took significantly longer than WT males to reach puberty and had lower serum testosterone levels. Furthermore, DKO males had smaller testes than WT males with increased rates of germ cell apoptosis.
Conclusions: The Padi2/Padi4 DKO mouse model provides a new tool for investigating PAD function and outcomes from our studies provide the first in vivo evidence linking PADs with hormone signaling.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
Sperm DNA fragmentation can negatively impact fertility and pregnancy outcomes. DNA becomes vulnerable during spermatogenesis when protamine replaces histones in chromatin compaction. Tests can evaluate sperm DNA fragmentation levels, which are correlated with lower fertilization and implantation rates. Factors like oxidative stress, temperature, and infections can intrinsically or extrinsically damage sperm DNA. Repair mechanisms attempt to resolve DNA double-strand breaks, but extensive unrepaired damage may be incompatible with embryo development. Treatments aim to address underlying causes of DNA fragmentation or use testicular sperm or ICSI to bypass ejaculated sperm issues.
This document summarizes a study examining the effects of high glucose and diabetes on cellular proteasome function in retinal and kidney cells. The key findings are:
1) Retinal endothelial cells exhibited significantly higher proteasome peptidase activity compared to pericytes and other cell types. High glucose treatment increased proteasome activity in endothelial cells but decreased it in pericytes.
2) High glucose treatment increased total levels of ubiquitinated proteins in retinal pericytes and endothelial cells, but not in photoreceptor cells. It also elevated levels of the PA28-a/-b proteasome regulatory subunits in pericytes and other cell types.
3) Retinas from diabetic mice showed
This document discusses prion diseases, which are infectious neurological disorders caused by misfolded prion proteins. It summarizes that prion diseases include Kuru, Creutzfeldt-Jakob disease, and mad cow disease. Prion diseases can be infectious, inherited, or sporadic in origin. The document outlines the differences between normal and misfolded prion proteins and reviews the mechanisms by which misfolded prions are able to induce normal prions to also misfold. It examines the cellular pathways involved in prion propagation and discusses factors that can prevent prion replication.
This document summarizes research on Tuberous Sclerosis Complex (TSC), including key facts about the disease, progress that has been made in understanding the genetics and molecular mechanisms, development of treatments like Everolimus, and ongoing areas of research focus like clinical trials of new drugs and studying disease mechanisms using cellular and animal models.
Determination and comparison rate of expression markers of osteoblast derived...IJERD Editor
Nowadays high accident rates, fractures leading to permanent bone disorders and the impossibility of bone transplant have made scientists to look for new methods of repairing injured bones. Considering the application of stem cells in bone tissue engineering, there exists the necessity to investigate various culture methods and suitable fields and scaffolds. Thus, we decided to induce adipose-derived stem cells into osteoblast cells in two systems of pellet culture and monolayer and compare osteogenic markers. Methods: Stem cells have been separated via mechanical and enzymatic methods and cultured in monolayer and pellet culture models with osteogenic medium. Then, RNA was separated from differentiated cells, complementary DNA (cDNA) was synthesized and amplified. Polymerase chain reaction (PCR) product was transferred to electrophoresis gel. The intensity of the bands was measured by Image-J software and analyzed by SPSS.
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Similar to Insilico analysis of pkd genes in polycystic kidney disease patients (20)
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
What is Digital Literacy? A guest blog from Andy McLaughlin, University of Ab...
Insilico analysis of pkd genes in polycystic kidney disease patients
1. In silico analysis of the impact of SNPs/SNP
haplotypes on protein structure and function in
autosomal dominant polycystic kidney disease
Dr. P. VEERAMUTHUMARI, M.Sc., M.Phil., B.Ed., PGDCA., Ph.D.,
ASSISTANT PROFESSOR OF ZOOLOGY
DEPARTMENT OF ZOOLOGY
V.V. VANNIAPERUMAL COLLEGE FOR WOMEN,
VIRUDHUNAGAR – 626 001
Mail id.: muthusdream@gmail.com; veeramuthumari@vvvcollege.org
13 July 2020
2. Introduction
Polycystic kidney disease (PKD) is a disorder in which clusters of cysts develop
within the kidneys.
Polycystic kidney disease (PKD) is the most common genetic, life threatening
disease, affecting more than 12.5 million people worldwide
The polycystic kidney diseases are the most common hereditary nephropathies
and constitute one of the leading causes of end-stage renal disease (Persu et al.,
2002) .
There are two types of PKD
Autosomal recessive polycystic kidney disease (ARPKD)
Autosomal dominant polycystic kidney disease (ADPKD)
Occurrence of ADPKD is 1: 400 to 1 :1000 in common population.
(Constantinides et al., 1997, Koptides et al., 1999, 2000)
Caused due to mutation in
(i) PKD1(85%) -16p13.3- polycystin 1
(ii) PKD2(15%)- 4q21- polycystin 2
(Pei et al., 1998, Koptides et al., 1999, 2000)
3. PKD1 gene is located on chromosome 16p13.3
PKD1 gene has 46 exon distributed over 52kb of genomic DNA
Produces polycystine 1 - 4302 amino acids
PKD1 gene
Chromosome location of PKD1 gene
PKD1 GENE LOCATION
4. Single nucleotide polymorphism and ADPKD
:
It is a single gene disorder, affecting approximately 1/500 individuals in
worldwide (Caucasian, China, Spain, Cyprus, Netherland, UK) populations (Ding et al.,
2002). ADPKD is characterized by progressive enlargement of cysts in the kidney, often
leading to end –stage renal failure disease (ESRD) in adult life.
… Torra et al., (1999) (UK) reported a mutation that involves
Substitution
Deletion of (2511 AG-C),
Inversion
G C transversion
Missense mutation
. Most of these mutations are expected to lead to the formation of shortened,
truncated proteins lacking the carboxyl terminus of PKD2 gene products. These
truncating mutations suggest that ADPKD is caused by the lack of normal protein.
Hence, the current study focused on PKD gene in polycystic kidney disease.
5. Cyst formation in nephron, kidney and at cellular level: (Hannah &caplan, 2010)
Mechanisms of cyst formation:
ADPKD is genetically dominant at the organism level and it is recessive at the cellular level.
The kidneys of an ADPKD patient who inherits one mutated copy of polycystin-1 or polycystin-2 from a
parent will develop and function normally into adulthood. Cysts will form in this patient’s kidneys and
several studies suggests that the cells which line these cysts will have lost both functional copies of a
polycystin gene (Qian et al., 1996; Brasier & Henske 1997)
Defects in the genes encoding PC1 and PC2 lead to aberrant gene transcription, cell proliferation, and
ion secretion, which in turn results in the formation of fluid-filled cysts. As cysts ballon out from
individual nephrons, their collective effects leads to the displacement of the normal renal parenchyma and the
formation of a cyst-filled kidney with reduced functional capacity.
6. Why the study is focused on PKD gene polymorphism?
PKD1 and PKD2 genes encode polycystins 1 and 2
Functions of Gene products:
Polycystins 1 and 2 are considered to be part of a common
development pathway that involves cell-cell and cell-
matrix interactions leading to the transfer of signal.
They work together to help regulate cell growth, cell division,
cell movement and interaction with other cells.
Their interaction in renal tubules promote the normal
development and function of kidney.
7. OBJECTIVES:
• To study the association between PKD1 and PKD2 gene
polymorphism and autosomal dominant polycystic kidney disease
(ADPKD) in patients and control group among South Indian
(Madurai) population.
• To analyse SNP database of PKD gene polymorphism.
• To Design the 3D structure of polycystin-1 proteins and locate the
SNP.
8. Sample collection :
ADPKD Patients within the age group of 10-80 years of both sexes
were selected.
Sample Size:
PKD patients : 300
Control subjects : 300
SURVEY & SAMPLE COLLECTION
Blood samples free from any infectious disease and related data were collected
by using questionnaire from the Department of Nephrology, Madurai Government
Rajaji hospital, and Madurai kidney transplantation and research Centre, Madurai,
Tamil Nadu..
CellsThe blood samples DNA PCR
Gene Sequencing
RFLP
Locating Polymorphism In
Protein Structure
9. II. Steps involved 3D structure prediction:
• Database search against protein sequences
protein structures
• Conserved domain
• Secondary structure prediction
• Three dimensional structure prediction by threading (MUSTER
server), (http://zhanglab.ccmb.med.umich.edu/MUSTER/), MODELLER,
version 8.2
I. SNP database analysis – http://www.ncbi.nlm.nih.gov/snp
14. The PKD1 (C/T) single nucleotide polymorphism also confirmed by sequencing
the PCR amplified gene products of PKD1
Ala
5’ - AAG CTG TAC GCC CTC ACT GG- 3’ – Wild type Allele
Val
5’ - AAG CTG TAC GTC CTC ACT GG- 3’ - Mutant Allele
Nucleotide sequence of PKD1 gene :(C/T polymorphism)
Wild
CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC
TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC
GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC
CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGCC
TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT
GCGCCAGTGGTCC
Mutant
CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC
TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC
GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC
CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGTC
TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT
GCGCCAGTGGTCC
15. Comparison of genotype and allelic frequency of PKD1
(Ala/Val4058) gene in control subjects and ADPKD subjects
T/T – Homozygous mutant C/T – Heterozygous mutant C/C–Homozygous normal
Number indicates number of individuals having the genotype and number of individuals
( in percentage)
GENOTYPE Allele frequency χ2
value
p value
T/T C/T C/C T C 14.16 P<0.05
9.488
Control
subjects
N=300
87
(29%)
82
(27.33%)
131
(43.67%)
0.425 0.575
ADPKD
subjects
N= 300
143
(47.67%)
99
(33%)
58
(19.33%)
0.642 0.358 13.93
16. The present study worked on the genotype and allele data of PKD1gene from
SNP database and demonstrated the occurrence of A/G and C/T is more when
compounded with other SNPs available for PKD1 gene.
Region found
Coding Synonymous codon 283
Intron SNP 661
Coding non Synonymous codon 148
UTR (5’ &3’) 35
Splice site No item
Locus region No item
Stop gained, No SNP 16
ANNOTATION
OMIM 36
SNP Protein sequence 359
SNP 3D structure 2
Pubmed 37
Cited in Pubmed 28
Nucleotide sequence 28
23. Polycystin 1 Cation channel model
- Wild
Polycystin 1 Cation channel model
- mutant
24.
25. DISCUSSION
From this study, it is found that, there is association between PKD1
(Ala/Val4058, C/T) gene polymorphism and the severity of the disease in ADPKD
subjects among South Indian (Madurai) population. This finding also enables us to
understand the pathogenesis of ADPKD.
In order to understand the molecular mechanism of ADPKD completely, one
must screen the duplicated area, the promoter region, and the introns of PKD1 and 2
genes in each population (Ding et al., 2009).
Currently there is no effective therapy for ADPKD or ARPKD.
Kidney transplantation and dialysis are the only methods that can be
performed to prolong life.
Current therpeutic approaches involve the use of caspase inhibitors, Cyclin-
dependent kinases (CKD) inhibitors, Triptolide, and mammalian target of rapamycin
(mTOR) inhibitors. (Tao, et al., 2005, Bukanov, et.al., 2006, Torres, et.al., 2007,
Leuenroth, et al., 2007).
26. The structural study of the protein by biocomputing method is
confirmed the absence of structural significance of a protein and such
protein might be affects an important domain in the protein structure
(Gomez et al., (2009)
Bioinformatics is also found to be become a powerful tool
in genetic mapping, association studies, diversity analysis and positional
cloning (Rafalski, 2010, Galeano et al., 2012).
The emergence of bioinformatics is provided a platform to
explore diseases at the molecular level using computational techniques.
Insilico methods are mainly harnessed to reduce the time, coat and risk
associated with Drug discovey (Shoba et al., 2010).
Hence the present study focused on structure prediction of protein
sequence of polycystin 1.
28. This study also help to employ the existing natural products as a
prime solution for the treatment of ADPKD- Silent killer.
Future Focus:
The study will be focused on interaction of polycystin-1(PC-1) and
polcystin-2 (PC-2) between them and other proteins; and docking as
future perspectives. It leads to DNA based drug designing for the
polycystic kidney disease and for other hereditary diseases.
29. CONCLUSION
Genetic testing offers the chance of performing prenatal or pre-implantation testing
in families with severe cases of the disease.
Hence the current study suggests that genetic testing is very important in
controlling the severity and progression of the disease and could delay the end stage
renal disease (ESRD) with effective drugs.
30. REFERENCES
Pei Y, He N, Wang K, Kasenda M, Paterson AD, Chan G, Liang Y, Roscoe J,
Brissenden J, Hefferton D, Parfrey P, Somlo S, ST. George – Hyslop P: A
spectrum of mutation in polycystic kidney disease – 2(PKD2) gene from eight
Canadian kidrede. J AM Soc Nephrol 9:1853 – 1860, 1998.
Sambrook J. and Russel D.W. Molecular cloning, a laboratory manual, 3rdDe
Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid
abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and
health diseases,2;1-6: 2003.
Grzegorzewska AE and Mlot M. Serum Osteoprotegrin level is lower in peritoneal
dialysis patients than in hemodialysis ones.Annales Academiaec S Medcae
Bialostocensis 49,2004.
De Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid
abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and
health diseases,2;1-6: 2003.
Constantinides R, Xenophontos, S, Neophytou P, Nomura S, Pierides A,
Constantinou, C:New amino acid polymorphism, Ala/Val4058, in exon 45 of the
polycystic kidney disease 1 gene: evolution of alleles. Hum Genet 99: 644-647,
1997.
31. Koptides M,Hadjimichad C,Koupepidou P,Pierides A and Constinous Deltasc
(1999) “Germinal and Somatic mutation in the PKD2 gene of renal cyst in
autosomal dominant polycystic kidney diseases” Hum.mol. Gents
Tazon Vega, Mireia Vilardell: Study of candidate genes affecting the
progression of renal disease in autosomal dominant polycystic kidney disease type
1.Nephrol Dial Transplant 2007, 22:1567-1577.
Thomas J, Manunath AP, Rai L, Kudva R. Autosomal recessive polycystic
kidney disease diagnosed in fetus. Indian J Urol 2007; 23:328-9.
Torra R, Viribay M, Tellaria D, Badenas C, Watson M, Harris P, Darnell A, San
Millan JL: Seven novel mutations of the PKD2 gene families with autosomal
dominant polycyctic kidney disease. Kidney international 56:28 – 33, 1999.
Guo C-H and Wang C-L. Effects of zinc supplementation on plasma copper/zinc
ratios, oxidative stress, and immunological status in hemodialysis patients. Int J
Med Sci 10(1):79-89,2013.
Kim Y, and Lee BK. (2011) Iron deficiency increases blood manganese level in
the Korean general population according to KNHANES 2008. Neurotoxicology