Downloaded 104 times
![DNA
(Deoxyribonucleic acid)
Mr. Sagar Kishor Savale
[Department of Pharmacy (Pharmaceutics)]
2015-016
avengersagar16@gmail.com
Department of Pharmacy (Pharmaceutics) | Sagar savale
20-12-2015 1](https://image.slidesharecdn.com/dna-151221065015/85/DNA-Deoxyribonucleic-acid-1-320.jpg)
Uploaded bySagar K Savale
DNA (Deoxyribonucleic acid)
DNA carries the genetic instructions for living organisms. In 1953, Watson and Crick discovered that DNA has a double helix structure, with nucleotides on each strand connected through hydrogen bonds between complementary nucleotide base pairs (A-T, C-G). DNA replicates semi-conservatively prior to cell division, using each original strand as a template to produce two new double helices. Genes within DNA code for proteins through transcription and translation.
More Related Content
Similar to DNA (Deoxyribonucleic acid)
DNA (Deoxyribonucleic acid)
- 1. DNA (Deoxyribonucleic acid) Mr. SagarKishor Savale [Department of Pharmacy (Pharmaceutics)] 2015-016 avengersagar16@gmail.com Department of Pharmacy (Pharmaceutics) | Sagar savale 20-12-2015 1
- 2. History Of DNA •Discovery of the DNA double helix Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria in (1928) Rosalind Franklin - X-ray photo of DNA in (1952) Watson and Crick - described the DNA molecule from Franklin’s X-ray in (1953) • Watson & Crick proposed • DNA had specific pairing between the nitrogen bases: • ADENINE – THYMINE • CYTOSINE - GUANINE • DNA was made of 2 long stands of nucleotides arranged in a specific way called the “Complementary Rule” 20-12-2015 2
- 3. C T A A T CG GC A C G AT AT A T TA C TA 0.34nm 3.4 nm (a) Key features of DNA structure G 1 nm G (c) Space-filling model T 20-12-2015 3
- 4. DNA • DNA =deoxyribonucleic acid. • DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and materials the body needs to function. • DNA is capable of self-replication. • Most of the cell’s DNA is carried in the nucleus – a small amount is contained in the mitochondria. • • Importance of DNA • Molecule 20-12-2015 4
- 5.
- 6.
- 7. • 2’-deoxyribose sugar •Four bases: • Adenine, A • Guanine, G • Thymine, T • Cytosine, C • Purine bases Adenine and guanine Two carbon rings • Pyrimidine bases Thymine and cytosine A single carbon ring Base part Sugar part DNA = deoxyribonucleic acid. 20-12-2015 7
- 8.
- 9.
- 10.
- 11. DNA Structure • DNAis a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous base Sugar Polynucleotide Sugar-phosphate backbone DNA nucleotide Phosphate group Nitrogenous base (A, G, C, or T) Thymine (T) Sugar (deoxyribose) 20-12-2015 11
- 12. DNA has fourkinds of bases, A, T, C, and G Pyrimidines Thymine (T) Cytosine (C) Purines Adenine (A) Guanine (G) 20-12-2015 12
- 13.
- 14. DNA is aDouble Helix • Nucleotides • A, G, T, C • Sugar and phosphate form the backbone • Bases lie between the backbone • Held together by H-bonds between the bases • A-T – 2 H bonds • G-C – 3 H bonds 20-12-2015 14
- 15. DNA Double Helix P P P O O O 1 2 3 4 5 5 3 3 5 P P P O O O 1 23 4 5 5 3 5 3 G C T A 20-12-2015 15
- 16. H - Bonds •The bases attract each other because of hydrogen bonds. • Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. • The bonds between cytosine and guanine are shown here with dotted lines. • When making hydrogen bonds, cytosine always pairs up with guanine • Adenine always pairs up with thymine • Adenine is bonded to thymine here C C C C N N O N C C C C N N O N N N C C C C C N N O O C 20-12-2015 16
- 17. • Hydrogen bondsbetween bases hold the strands together: A and T, C and G Ribbon model Partial chemical structure Computer model Hydrogen bond 20-12-2015 17
- 18.
- 19. Chargraff’s Rule •Adenine andThymine always join together • A T • Cytosine and Guanine always join together • C G 20-12-2015 19
- 20.
- 21. • Each strandis a template for a new strand helicase DNA polymerase 20-12-2015 21
- 22. The ladder model •The structure of DNA can be understood more easily by untwisting the double helix and displaying the molecule as if it were a ladder. • The side rails of the ladder (the “backbone”) are alternating phosphate and sugar molecules. The rungs are paired nitrogen base molecules held together by a hydrogen bond. Nucleotide Base pair Backbone 20-12-2015 22
- 23. The base pairingrule • Each “rung” of the DNA ladder is formed from two nitrogen bases. • There are four bases – adenine (A), thymine (T), cytosine (C), and guanine (G). • The base adenine always bonds with thymine (A-T), and cytosine always bonds with guanine (C-G). • The binding of two nucleotides forms a base pair. In DNA, cytosine and guanine are bound together by 3 hydrogen bonds, whereas adenine and thymine are bound by 2 hydrogen bonds. Location of DNA Most of the DNA occurs in the cell nucleus; however, each mitochondrion contains 37 genes – this is referred to as mitochondrial DNA. 20-12-2015 23
- 24. The function ofDNA Genes • A chromosome consists of segments of DNA known as genes. • Genes contain the instructions for the construction of a particular protein, or RNA. • It is estimated that there are about 20,000–25,000 genes in the human genome (i.e. about 3 billion base pairs). • Genetic information is carried in the linear sequence of nucleotides in DNA • Genetic information contains instructions to synthesize proteins • DNA forms double helix with two complimentary strands holding together by hydrogen bonds between A-T (2 bonds) and G-C (3 bonds) • DNA duplication occurs using one strand of parental DNA as template to form complimentary pairs with a new DNA strand. • DNA is in nucleus in eucaryotes 20-12-2015 24
- 25. Introns and exons •Genes consist of introns and exons • Exons are sections of coding DNA – i.e. they contain instructions for making proteins. • Introns are sections of non-coding DNA (once called "junk DNA") – i.e. they do not contain instructions for making proteins but are now believed to serve other important functions. 20-12-2015 25
- 26. The Genetic Code •Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein) • The four bases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons 20-12-2015 26
- 27. Reading the code •The sequence of bases is read in groups of three called codons. • Thus the sequence: AAGCCGTTTAGAGAGATTCCT Is read as: AAG CCG TTT AGA GAG ATT CCT • Each codon represents one of the 20 different amino acids. 20-12-2015 27
- 28. DNA chromatin chromatin fibers fibers connectedto chromosome scaffold Condenced scaffold Chromosome 20-12-2015 28
- 29.
- 30. Genes as InformationTransfer • A gene is the sequence of nucleotides within a portion of DNA that codes for a peptide or a functional RNA • Sum of all genes = genome 20-12-2015 30
- 31. Replication of DNA •Semiconservative • Daughter DNA is a double helix with 1 parent strand and 1 new strand • Found that 1 strand serves as the template for new strand 20-12-2015 31
- 32.
- 33.
- 34. DNA Template Each strandof the parent DNA is used as a template to make the new daughter strand DNA replication makes 2 new complete double helices each with 1 old and 1 new strand 20-12-2015 34
- 35. Replication Origin • Sitewhere replication begins • 1 in E. coli • 1,000s in human • Strands are separated to allow replication machinery contact with the DNA • Many A-T base pairs because easier to break 2 H-bonds that 3 H-bonds • Note anti-parallel chains 20-12-2015 35
- 36. Replication Fork • Bidirectionalmovement of the DNA replication machinery 20-12-2015 36
- 37. DNA Polymerase • Anenzyme that catalyzes the addition of a nucleotide to the growing DNA chain • Nucleotide enters as a nucleotide tri-PO4 • 3’–OH of sugar attacks first phosphate of tri- PO4 bond on the 5’ C of the new nucleotide • releasing pyrophosphate (PPi) + energy • Bidirectional synthesis of the DNA double helix • Corrects mistaken base pairings • Requires an established polymer (small RNA primer) before addition of more nucleotides • Other proteins and enzymes necessary 20-12-2015 37
- 38. How is DNASynthesized • Original theory • Begin adding nucleotides at origin • Add subsequent bases following pairing rules • Expect both strands to be synthesized simultaneously • This is NOT how it is accomplished 20-12-2015 38
- 39.
- 40. • Actually howDNA is synthesized • Simple addition of nucleotides along one strand, as expected • Called the leading strand • DNA polymerase reads 3’ 5’ along the leading strand from the RNA primer • Synthesis proceeds 5’ 3’ with respect to the new daughter strand • Remember how the nucleotides are added 5’ 3’ • Actually how DNA is synthesized • Other daughter strand is also synthesized 5’3’ because that is only way that DNA can be assembled • However the template is also being read 5’3’ • Compensate for this by feeding the DNA strand through the polymerase, and primers and make many short segments that are later joined (ligated) together • Called the lagging strand 20-12-2015 40
- 41.
- 42.
- 43. Starting Synthesis • DNApolymerase can only ADD nucleotides to a growing polymer • Another enzyme, primase, synthesizes a short RNA chain called a primer • DNA/RNA hybrid for this short stretch • Base pairing rules followed (BUT A-U) • Later removed, replaced by DNA and the backbone is sealed (ligated) • Primers • Simple addition of primer along leading strand • RNA primer synthesized 5’ 3’, then polymerization with DNA • Many primers are needed along the lagging strand • 1 primer per small fragment of new DNA made along the lagging strand • Called Okazaki fragments • Removal of Primers Other enzymes needed to excise (remove) the primers Nuclease – removes the RNA primer nucleotide by nucleotide Repair polymerase – replaces RNA with DNA DNA ligase – seals the sugar-phosphate backbone by creating phosphodiester bond Requires Mg2+ and ATP 20-12-2015 43
- 44.
- 45.
- 46.
- 47.
- 48.
- 49.
- 50. A summary oftranscription and translation in a eukaryotic cell TRANSCRIPTION RNA is transcribed from a DNA template. DNA RNA polymerase RNA transcript RNA PROCESSING In eukaryotes, the RNA transcript (pre- mRNA) is spliced and modified to produce mRNA, which moves from the nucleus to the cytoplasm. Exon RNA transcript (pre-mRNA) Intron NUCLEUS FORMATION OF INITIATION COMPLEX After leaving the nucleus, mRNA attaches to the ribosome. CYTOPLASM mRNA Growing polypeptide Ribosomal subunits Aminoacyl-tRNA synthetase Amino acid tRNA AMINO ACID ACTIVATION Each amino acid attaches to its proper tRNA with the help of a specific enzyme and ATP. Activated amino acid TRANSLATION A succession of tRNAs add their amino acids to the polypeptide chain as the mRNA is moved through the ribosome one codon at a time. (When completed, the polypeptide is released from the ribosome.) AnticodonA A A U G G U U U A U G E A Ribosome 1 5 5 3 Codon 2 3 4 5 20-12-2015 50
- 51. Chromosomes • 23 chromosomepairs 46 chromosomes • 44 autosomes, 2 sex chromosomes • X and Y –chromosomes • XX female • XY Male 20-12-2015 51
- 52.
- 53. Sex Determination inHumans 20-12-2015 53
- 54. References • www.wikipedia.org • www.sciencedirect.com •www.medscape.com • www.biolife.com • www.nature.com • www.Googlescoler.com • www.pubmed.com 20-12-2015 54
- 55.