DNA carries the genetic instructions for living organisms. In 1953, Watson and Crick discovered that DNA has a double helix structure, with nucleotides on each strand connected through hydrogen bonds between complementary nucleotide base pairs (A-T, C-G). DNA replicates semi-conservatively prior to cell division, using each original strand as a template to produce two new double helices. Genes within DNA code for proteins through transcription and translation.
DNA
history
structure
X-Ray diffraction image of DNA
base pairing principle
base pairs
bonding patterns of DNA
base stacking different conformations of DNA
different forms of DNA
function of DNA
replication
encoding information
mutation/recombination
gene expression
Application of DNA
This presentation explains the fundamentals of Genetic Code, Protein synthesis mechanism and Antibiotics that inhibits at various stages of Translation.
History of DNA. introduction of DNA with short history and findings. different types of DNA with structures variations. A -DNA, B- DNA, C- DNA E- DNA D- DNA And Z DNA Detail information of these DNA with their comparison tables, different types of unusual DNA and sequences. Functions of DNA with their explanations . Nucleic acid chemical basis : Denaturation and annealing of DNA with factors for that. New DNA.
DNA
history
structure
X-Ray diffraction image of DNA
base pairing principle
base pairs
bonding patterns of DNA
base stacking different conformations of DNA
different forms of DNA
function of DNA
replication
encoding information
mutation/recombination
gene expression
Application of DNA
This presentation explains the fundamentals of Genetic Code, Protein synthesis mechanism and Antibiotics that inhibits at various stages of Translation.
History of DNA. introduction of DNA with short history and findings. different types of DNA with structures variations. A -DNA, B- DNA, C- DNA E- DNA D- DNA And Z DNA Detail information of these DNA with their comparison tables, different types of unusual DNA and sequences. Functions of DNA with their explanations . Nucleic acid chemical basis : Denaturation and annealing of DNA with factors for that. New DNA.
RNA splicing, in molecular biology, is a form of RNA processing in which a newly made precursor messenger RNA transcript is transformed into a mature messenger RNA. During splicing, introns are removed and exons are joined together.
RNA- A polymer of ribonucleotides, is a single stranded structure. There are three major types of RNA- m RNA,t RNA and r RNA. Besides that there are small nuclear,micro RNAs, small interfering and heterogeneous RNAs. Each of them has a specific structure and performs a specific function.
RNA splicing, in molecular biology, is a form of RNA processing in which a newly made precursor messenger RNA transcript is transformed into a mature messenger RNA. During splicing, introns are removed and exons are joined together.
RNA- A polymer of ribonucleotides, is a single stranded structure. There are three major types of RNA- m RNA,t RNA and r RNA. Besides that there are small nuclear,micro RNAs, small interfering and heterogeneous RNAs. Each of them has a specific structure and performs a specific function.
Nucleic Acids
DNA
Eukaryotic Chromosomes
The Histones
Deoxynucleic acid ( DNA )
Importance of Nucleotides
Base pairing
Denaturation and Renaturation
Determination GC content
Prokaryotic DNA synthesis
Prokaryotic DNA Replication
Transcription
Coding Strand and Template Strand
Steps of RNA synthesize
22.1 Types of Nucleic Acids
22.2 Nucleotide Building Blocks
22.3. Nucleotide Formation
22.4 Primary Nucleic Acid Structure
22.5 The DNA Double Helix
22.6 Replication of DNA Molecules
22.7 Overview of Protein Synthesis
22.8 Ribonucleic Acids
22.9 Transcription: RNA Synthesis
22.10 The Genetic Code
22.11 Anticodons and tRNA Molecules
22.12 Translation: Protein Synthesis
22.13 Mutations
22.14 Nucleic Acids and Viruses
22.15 Recombinant DNA and Genetic Engineering
22.16 The Polymerase Chain Reaction
The skin is divided into two parts: the superficial part, the
epidermis; and the deep part, the dermis (Fig. 1.4). The
epidermis is a stratified epithelium whose cells become flat
tened as they mature and rise to the surface. On the palms of
the hands and the soles of the feet, the epidermis is extremely
thick, to withstand the wear and tear that occurs in these
regions. In other areas of the body, for example, on the ante
rior surface of the arm and forearm, it is thin. The dermis is
composed of dense connective tissue containing many blood
vessels, lymphatic vessels, and nerves. It shows considerable
variation in thickness in different parts of the body, tending
to be thinner on the anterior than on the posterior surface.
It is thinner in women than in men. The dermis of the skin
is connected to the underlying deep fascia or bones by the
superficial fascia, otherwise known as subcutaneous tissue.
The skin over joints always folds in the same place, the
SKIN CREASES (Fig. 1.5). At these sites, the skin is thinner
than elsewhere and is firmly tethered to underlying struc
tures by strong bands of fibrous tissue.
The appendages of the skin are the nails, hair follicles,
sebaceous glands, and sweat glands.
The nails are keratinized plates on the dorsal surfaces of
the tips of the fingers and toes. The proximal edge of the
plate is the root of the nail (see Fig. 1.5). With the exception
of the distal edge of the plate, the nail is surrounded and
overlapped by folds of skin known as nail folds. The sur
face of skin covered by the nail is the nail bed (see Fig. 1.5).
Hairs grow out of follicles, which are invaginations
of the epidermis into the dermis (see Fig. 1.4). The folli
cles lie obliquely to the skin surface, and their expanded
extremities, called hair bulbs, penetrate to the deeper part
of the dermis. Each hair bulb is concave at its end, and
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Adv. biopharm. APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMSAkankshaAshtankar
MIP 201T & MPH 202T
ADVANCED BIOPHARMACEUTICS & PHARMACOKINETICS : UNIT 5
APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMS By - AKANKSHA ASHTANKAR
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists Saeid Safari
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
Flu Vaccine Alert in Bangalore Karnatakaaddon Scans
As flu season approaches, health officials in Bangalore, Karnataka, are urging residents to get their flu vaccinations. The seasonal flu, while common, can lead to severe health complications, particularly for vulnerable populations such as young children, the elderly, and those with underlying health conditions.
Dr. Vidisha Kumari, a leading epidemiologist in Bangalore, emphasizes the importance of getting vaccinated. "The flu vaccine is our best defense against the influenza virus. It not only protects individuals but also helps prevent the spread of the virus in our communities," he says.
This year, the flu season is expected to coincide with a potential increase in other respiratory illnesses. The Karnataka Health Department has launched an awareness campaign highlighting the significance of flu vaccinations. They have set up multiple vaccination centers across Bangalore, making it convenient for residents to receive their shots.
To encourage widespread vaccination, the government is also collaborating with local schools, workplaces, and community centers to facilitate vaccination drives. Special attention is being given to ensuring that the vaccine is accessible to all, including marginalized communities who may have limited access to healthcare.
Residents are reminded that the flu vaccine is safe and effective. Common side effects are mild and may include soreness at the injection site, mild fever, or muscle aches. These side effects are generally short-lived and far less severe than the flu itself.
Healthcare providers are also stressing the importance of continuing COVID-19 precautions. Wearing masks, practicing good hand hygiene, and maintaining social distancing are still crucial, especially in crowded places.
Protect yourself and your loved ones by getting vaccinated. Together, we can help keep Bangalore healthy and safe this flu season. For more information on vaccination centers and schedules, residents can visit the Karnataka Health Department’s official website or follow their social media pages.
Stay informed, stay safe, and get your flu shot today!
CDSCO and Phamacovigilance {Regulatory body in India}NEHA GUPTA
The Central Drugs Standard Control Organization (CDSCO) is India's national regulatory body for pharmaceuticals and medical devices. Operating under the Directorate General of Health Services, Ministry of Health & Family Welfare, Government of India, the CDSCO is responsible for approving new drugs, conducting clinical trials, setting standards for drugs, controlling the quality of imported drugs, and coordinating the activities of State Drug Control Organizations by providing expert advice.
Pharmacovigilance, on the other hand, is the science and activities related to the detection, assessment, understanding, and prevention of adverse effects or any other drug-related problems. The primary aim of pharmacovigilance is to ensure the safety and efficacy of medicines, thereby protecting public health.
In India, pharmacovigilance activities are monitored by the Pharmacovigilance Programme of India (PvPI), which works closely with CDSCO to collect, analyze, and act upon data regarding adverse drug reactions (ADRs). Together, they play a critical role in ensuring that the benefits of drugs outweigh their risks, maintaining high standards of patient safety, and promoting the rational use of medicines.
Lung Cancer: Artificial Intelligence, Synergetics, Complex System Analysis, S...Oleg Kshivets
RESULTS: Overall life span (LS) was 2252.1±1742.5 days and cumulative 5-year survival (5YS) reached 73.2%, 10 years – 64.8%, 20 years – 42.5%. 513 LCP lived more than 5 years (LS=3124.6±1525.6 days), 148 LCP – more than 10 years (LS=5054.4±1504.1 days).199 LCP died because of LC (LS=562.7±374.5 days). 5YS of LCP after bi/lobectomies was significantly superior in comparison with LCP after pneumonectomies (78.1% vs.63.7%, P=0.00001 by log-rank test). AT significantly improved 5YS (66.3% vs. 34.8%) (P=0.00000 by log-rank test) only for LCP with N1-2. Cox modeling displayed that 5YS of LCP significantly depended on: phase transition (PT) early-invasive LC in terms of synergetics, PT N0—N12, cell ratio factors (ratio between cancer cells- CC and blood cells subpopulations), G1-3, histology, glucose, AT, blood cell circuit, prothrombin index, heparin tolerance, recalcification time (P=0.000-0.038). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and PT early-invasive LC (rank=1), PT N0—N12 (rank=2), thrombocytes/CC (3), erythrocytes/CC (4), eosinophils/CC (5), healthy cells/CC (6), lymphocytes/CC (7), segmented neutrophils/CC (8), stick neutrophils/CC (9), monocytes/CC (10); leucocytes/CC (11). Correct prediction of 5YS was 100% by neural networks computing (area under ROC curve=1.0; error=0.0).
CONCLUSIONS: 5YS of LCP after radical procedures significantly depended on: 1) PT early-invasive cancer; 2) PT N0--N12; 3) cell ratio factors; 4) blood cell circuit; 5) biochemical factors; 6) hemostasis system; 7) AT; 8) LC characteristics; 9) LC cell dynamics; 10) surgery type: lobectomy/pneumonectomy; 11) anthropometric data. Optimal diagnosis and treatment strategies for LC are: 1) screening and early detection of LC; 2) availability of experienced thoracic surgeons because of complexity of radical procedures; 3) aggressive en block surgery and adequate lymph node dissection for completeness; 4) precise prediction; 5) adjuvant chemoimmunoradiotherapy for LCP with unfavorable prognosis.
Thyroid Gland- Gross Anatomy by Dr. Rabia Inam Gandapore.pptx
DNA (Deoxyribonucleic acid)
1. DNA
(Deoxyribonucleic acid)
Mr. Sagar Kishor Savale
[Department of Pharmacy (Pharmaceutics)]
2015-016
avengersagar16@gmail.com
Department of Pharmacy (Pharmaceutics) | Sagar savale
20-12-2015 1
2. History Of DNA
• Discovery of the DNA double helix
Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless
bacteria into deadly bacteria in (1928)
Rosalind Franklin - X-ray photo of DNA in (1952)
Watson and Crick - described the DNA molecule from Franklin’s X-ray in (1953)
• Watson & Crick proposed
• DNA had specific pairing between the nitrogen bases:
• ADENINE – THYMINE
• CYTOSINE - GUANINE
• DNA was made of 2 long stands of nucleotides arranged in a specific way called the “Complementary Rule”
20-12-2015 2
4. DNA
• DNA = deoxyribonucleic acid.
• DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and
materials the body needs to function.
• DNA is capable of self-replication.
• Most of the cell’s DNA is carried in the nucleus – a small amount is contained in the mitochondria.
•
• Importance of DNA
• Molecule
20-12-2015 4
7. • 2’-deoxyribose sugar
• Four bases:
• Adenine, A
• Guanine, G
• Thymine, T
• Cytosine, C
• Purine bases
Adenine and guanine
Two carbon rings
• Pyrimidine bases
Thymine and cytosine
A single carbon ring
Base part
Sugar part
DNA = deoxyribonucleic acid.
20-12-2015 7
11. DNA Structure
• DNA is a nucleic acid, made of long chains of nucleotides
Nucleotide
Phosphate
group
Nitrogenous
base
Sugar
Polynucleotide Sugar-phosphate backbone
DNA nucleotide
Phosphate
group
Nitrogenous base
(A, G, C, or T)
Thymine (T)
Sugar
(deoxyribose)
20-12-2015 11
12. DNA has four kinds of bases, A, T, C, and G
Pyrimidines
Thymine (T) Cytosine (C)
Purines
Adenine (A) Guanine (G)
20-12-2015 12
14. DNA is a Double Helix
• Nucleotides
• A, G, T, C
• Sugar and phosphate form the
backbone
• Bases lie between the backbone
• Held together by
H-bonds between the bases
• A-T – 2 H bonds
• G-C – 3 H bonds
20-12-2015 14
16. H - Bonds
• The bases attract each other because of hydrogen bonds.
• Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA.
• The bonds between cytosine and guanine are shown here with dotted lines.
• When making hydrogen bonds, cytosine always pairs up with guanine
• Adenine always pairs up with thymine
• Adenine is bonded to thymine here
C
C
C
C
N
N
O
N
C
C
C
C
N
N
O
N
N
N
C
C
C
C
C
N
N
O
O
C
20-12-2015 16
17. • Hydrogen bonds between bases hold the strands together: A
and T, C and G
Ribbon model Partial chemical structure Computer model
Hydrogen bond
20-12-2015 17
21. • Each strand is a template for a new strand
helicase
DNA polymerase
20-12-2015 21
22. The ladder model
• The structure of DNA can be understood more easily by untwisting the double helix and
displaying the molecule as if it were a ladder.
• The side rails of the ladder (the “backbone”) are alternating phosphate and sugar
molecules. The rungs are paired nitrogen base molecules held together by a hydrogen bond.
Nucleotide
Base pair
Backbone
20-12-2015 22
23. The base pairing rule
• Each “rung” of the DNA ladder is formed from two nitrogen bases.
• There are four bases – adenine (A), thymine (T), cytosine (C), and guanine (G).
• The base adenine always bonds with thymine (A-T), and cytosine always bonds with guanine (C-G).
• The binding of two nucleotides forms a base pair. In DNA, cytosine and guanine are bound together by 3 hydrogen bonds,
whereas adenine and thymine are bound by 2 hydrogen bonds.
Location of DNA
Most of the DNA occurs in the cell nucleus;
however, each mitochondrion contains
37 genes – this is referred to as
mitochondrial DNA.
20-12-2015 23
24. The function of DNA Genes
• A chromosome consists of segments of DNA known as genes.
• Genes contain the instructions for the construction of a particular protein, or RNA.
• It is estimated that there are about 20,000–25,000 genes in the human genome (i.e. about 3
billion base pairs).
• Genetic information is carried in the linear sequence of nucleotides in DNA
• Genetic information contains instructions to synthesize proteins
• DNA forms double helix with two complimentary strands holding together by hydrogen bonds
between A-T (2 bonds) and G-C (3 bonds)
• DNA duplication occurs using one strand of parental DNA as template to form complimentary
pairs with a new DNA strand.
• DNA is in nucleus in eucaryotes
20-12-2015 24
25. Introns and exons
• Genes consist of introns and exons
• Exons are sections of coding DNA – i.e. they contain instructions for making
proteins.
• Introns are sections of non-coding DNA (once called "junk DNA") – i.e. they
do not contain instructions for making proteins but are now believed to serve
other important functions.
20-12-2015 25
26. The Genetic Code
• Describes how nucleotide
sequence is converted to protein
sequence
• Unit of three nucleotides = a
codon
• A codon codes for a specific
amino acid (structural
component of protein)
• The four bases can form 64
different codons
• 20 amino acids are found from
the nature
• Regulatory codons
20-12-2015 26
27. Reading the code
• The sequence of bases is read in groups of three called codons.
• Thus the sequence:
AAGCCGTTTAGAGAGATTCCT
Is read as:
AAG CCG TTT AGA GAG ATT CCT
• Each codon represents one of the 20 different amino acids.
20-12-2015 27
30. Genes as Information Transfer
• A gene is the sequence of nucleotides within a portion of DNA that codes for a
peptide or a functional RNA
• Sum of all genes = genome
20-12-2015 30
31. Replication of DNA
• Semiconservative
• Daughter DNA is a double helix with 1 parent strand and 1 new strand
• Found that 1 strand serves as the template for new strand
20-12-2015 31
34. DNA Template
Each strand of the parent DNA is used as a template to make the new daughter strand DNA replication makes 2
new complete double helices each with 1 old and 1 new strand
20-12-2015 34
35. Replication Origin
• Site where replication begins
• 1 in E. coli
• 1,000s in human
• Strands are separated to allow replication
machinery contact with the DNA
• Many A-T base pairs because easier to break 2
H-bonds that 3 H-bonds
• Note anti-parallel chains
20-12-2015 35
37. DNA Polymerase
• An enzyme that catalyzes the addition of a
nucleotide to the growing DNA chain
• Nucleotide enters as a nucleotide tri-PO4
• 3’–OH of sugar attacks first phosphate of tri-
PO4 bond on the 5’ C of the new nucleotide
• releasing pyrophosphate (PPi) + energy
• Bidirectional synthesis of the DNA double
helix
• Corrects mistaken base pairings
• Requires an established polymer (small RNA
primer) before addition of more nucleotides
• Other proteins and enzymes necessary
20-12-2015 37
38. How is DNA Synthesized
• Original theory
• Begin adding nucleotides at origin
• Add subsequent bases following pairing rules
• Expect both strands to be synthesized simultaneously
• This is NOT how it is accomplished
20-12-2015 38
40. • Actually how DNA is synthesized
• Simple addition of nucleotides along one strand, as expected
• Called the leading strand
• DNA polymerase reads 3’ 5’ along the leading strand from the RNA primer
• Synthesis proceeds 5’ 3’ with respect to the new daughter strand
• Remember how the nucleotides are added 5’ 3’
• Actually how DNA is synthesized
• Other daughter strand is also synthesized 5’3’ because that is only way that DNA can be
assembled
• However the template is also being read 5’3’
• Compensate for this by feeding the DNA strand through the polymerase, and primers and make many short
segments that are later joined (ligated) together
• Called the lagging strand
20-12-2015 40
43. Starting Synthesis
• DNA polymerase can only ADD nucleotides
to a growing polymer
• Another enzyme, primase, synthesizes a short
RNA chain called a primer
• DNA/RNA hybrid for this short stretch
• Base pairing rules followed (BUT A-U)
• Later removed, replaced by DNA and the
backbone is sealed (ligated)
• Primers
• Simple addition of primer along
leading strand
• RNA primer synthesized 5’ 3’,
then polymerization with DNA
• Many primers are needed along the
lagging strand
• 1 primer per small fragment of new
DNA made along the lagging strand
• Called Okazaki fragments
• Removal of Primers
Other enzymes needed to excise (remove) the primers
Nuclease – removes the RNA primer nucleotide by
nucleotide
Repair polymerase – replaces RNA with DNA
DNA ligase – seals the sugar-phosphate backbone by
creating phosphodiester bond
Requires Mg2+ and ATP
20-12-2015 43
50. A summary of transcription and translation in a eukaryotic cell
TRANSCRIPTION
RNA is transcribed
from a DNA template.
DNA
RNA
polymerase
RNA
transcript
RNA PROCESSING
In eukaryotes, the
RNA transcript (pre-
mRNA) is spliced and
modified to produce
mRNA, which moves
from the nucleus to the
cytoplasm.
Exon
RNA transcript
(pre-mRNA)
Intron
NUCLEUS
FORMATION OF
INITIATION COMPLEX
After leaving the
nucleus, mRNA attaches
to the ribosome.
CYTOPLASM
mRNA Growing
polypeptide
Ribosomal
subunits
Aminoacyl-tRNA
synthetase
Amino
acid
tRNA
AMINO ACID ACTIVATION
Each amino acid
attaches to its proper tRNA
with the help of a specific
enzyme and ATP.
Activated
amino acid
TRANSLATION
A succession of tRNAs
add their amino acids to
the polypeptide chain
as the mRNA is moved
through the ribosome
one codon at a time.
(When completed, the
polypeptide is released
from the ribosome.)
AnticodonA A A
U G G U U U A U G
E A
Ribosome
1
5
5
3
Codon
2
3 4
5
20-12-2015 50
51. Chromosomes
• 23 chromosome pairs 46 chromosomes
• 44 autosomes, 2 sex chromosomes
• X and Y –chromosomes
• XX female
• XY Male
20-12-2015 51