Rosalind Franklin, Maurice Wilkins, and Erwin Chargaff contributed to understanding DNA structure through X-ray diffraction and composition studies. James Watson and Francis Crick determined that DNA has a double helix structure with adenine bonding with thymine and cytosine bonding with guanine. DNA replication is the process where the DNA double helix unwinds and each strand acts as a template to produce two identical DNA molecules. Mutations can occur through insertion, deletion, or substitution of DNA bases and can affect organism traits, sometimes beneficially through increased disease resistance.

1. Ch. 5.3:
DNA &
Genetics

2. Before the 1950s, we knew that:
 Inherited characteristics are determine by
genes.
 Genes are passed from one generation to the
next.
 Genes are part of a chromosome.
 Cells divide. Before they divide, they have to
copy their structures, organelles, & their genetic
information.
1. What scientists contributed to our
understanding of DNA?

3. 1. What scientists contributed to our
understanding of DNA?

4. 1. What is DNA?
• An organism’s genetic
material, made up of
nucleotides
• deoxyribonucleic acid
• A gene is a segment of
DNA on a chromosome
that provides directions
for making proteins.
1. What scientists contributed to our
understanding of DNA?

5. 2. Rosalind Franklin
(1920-1958)
• Made significant
advances in X-ray
diffraction techniques
with DNA
• Her images showed
that DNA had a spiral
shape
1. What scientists contributed to our
understanding of DNA?

6. 2. Maurice Wilkins (1916-2004)
• Worked with Rosalind
Franklin with X-ray diffraction
studies of DNA
• Shared info. with Watson &
Crick
1. What scientists contributed to our
understanding of DNA?

7. Erwin Chargaff (1905-2002)
• Investigated composition of
DNA
• In 1950, he discovered base-
pairings of A-T & G-C
1. What scientists contributed to
our understanding of DNA?

8. 3. James Watson (1928) &
Francis Crick (1916-2004)
• Worked together to
determine DNA’s structure
• Determined DNA’s double
helix shape
• Watson, Crick, & Wilkins
were awarded the Nobel
Prize in 1962 (Franklin
passed away beforehand)
1. What scientists contributed to our
understanding of DNA?

9. 4. DNA is shaped like a double
helix, which is like a twisted
ladder.
2. What is the structure of DNA?

10. 5. A nucleotide is a molecule made of:
 Nitrogen base,
• 6. There are 4 nitrogen bases: adenine (A),
cytosine (C), thymine (T), and guanine (G)
• Nitrogen bases bond and form the rungs of the
ladder.
 Sugar-phosphate group
• Sugar-phosphate groups form the sides of the
DNA ladder.
2. What is the structure of DNA?

11. 7. Certain bases always bond together: A – T
and C – G.
2. What is the structure of DNA?
8.

12. DNA – What does my code look like?
Computer Code:
10010100111010001100101001110010111100101001
00100100101110010100010101001001010010101001
0010100101001010100101001010010101010101001
010100101010111111100
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAG
ATAAACTAGAGAGACCCTTTAAAACACACAGAGATA
GACAGAAAAACAATAGACAGATACAGATAGACATAA
AAAATTTTTTGGGAAA…millions and millions of
bases…

13. Practice DNA Base Pairs
A T T A C A
C TT A A T

14. 9. Replication is the process of copying a
DNA molecule to make another DNA molecule.
2. What is the structure of DNA?

15. DNA replication – helix unzips

16. DNA replication – helix unzips

17. DNA replication – two strands are separated

18. DNA replication – each side is now a template

19. DNA replication – two identical strands of DNA
Original DNA strands

20. DNA replication
Newly assembled DNA strands

21. 10. Mutation occurs when the sequence
of nucleotides is changed in a gene.
 Insertion – more added
 Deletion – some deleted
 Substitution – some swapped
mutation
from Latin mutare, means “to
change”
3. How do changes in the sequence of DNA
affect traits?

22. • The 46 human chromosomes contain
between 20,000 and 25,000 genes that
are copied during replication.
• Mutations can be triggered by exposure
to X-rays, ultraviolet light, radioactive
materials, and some kinds of chemicals.
3. How do changes in the sequence of DNA
affect traits?

23. The 3 types of mutations are substitution,
insertion, and deletion.
3. How do changes in the sequence of DNA
affect traits?

24. Which of the following describes the
mutation that occurs when three
base pairs are added?
a. b. c. d.
0 000
a. Insertion
b. Substitution
c. Transgression
d. Deletion
45

25. Which of the following describes an
error made during the copying of
DNA?
a. b. c. d.
0 000
a. Transcription
b. Replication
c. Translation
d. Mutation
45

26. • The effects of a mutation depend on where in
the DNA sequence the mutation happens and
the type of mutation.
• Some mutations in human DNA cause
genetic disorders.
• Some mutations can be beneficial for the
organism, even helping it survive diseases.
– If a person only has 1 sickle cell allele (not both),
they are more resistant to malaria.
– If a person is born with Type AB blood, they can
accept donations from all other blood types.
3. How do changes in the sequence of DNA
affect traits?

28. In DNA, which of the following is
true?
A. B. C. D.
0 000
A. adenine bonds with guanine
B. cytosine bonds with adenine
C. thymine bonds with adenine
D. none of the above
45