- DNA, genes, chromosomes, nucleus and cells are all related to heredity and genetics. DNA contains the genetic code and is found within the chromosomes in the nucleus of cells. Genes are segments of DNA that code for traits. - Mutations in DNA can cause changes to genes that affect an organism's traits. The three main types of mutations are substitutions, insertions and deletions of DNA nucleotides. Mutations can result in genetic disorders or beneficial adaptations. - DNA's double helix structure allows it to replicate accurately. During replication, the DNA double helix unwinds and each strand acts as a template to produce two new double helices. RNA aids in protein production by transcribing DNA codes and

1. Bellwork #39 (Q2: Week 9)
How are the following terms related to each other?:
• DNA
• Gene
• Chromosome
• Nucleus
• Cell
Have W.S. 5.3 out ready to be checked.
Reminders:
 Thurs: Study Guide due
 Fri: Ch. 5 Test
 Next Mon:
 NEW Composition Book
 Pedigree Project (required for Adv./ Extra Credit for Reg.)
 Chaperones needed for Myakka Field trip on Jan. 16, 2015 (Friday)
Daily Objective
 Describe the structure
of DNA and how it was
discovered.
 Explain how DNA code
determines traits, and
how mutations affect
traits.

2. DIRECTIONS
 Go to the following website:
 http://learn.genetics.u
tah.edu/content/begi
n/dna/
 Work your way through each of
the activities starting at the top
left and going down each
column.
 Please make sure the volume is
either MUTED or very low (or use
your own headphones)
 Hint: Building DNA
▪ When you get the message “pop-up” you may
move on to the next activity.
OBJECTIVES
 Understand the basic
structure and function of
DNA
 Be able to match the base
pairs of DNA (A-T, G-C)

3. Ch. 5.3:
DNA &
Genetics

4. 1. What scientists have contributed to
our understanding of DNA?
2. What is the structure of DNA?
3. What is the role of RNA in protein
production?
4. How do changes in the sequence of
DNA affect traits?
Focus Questions

5. • DNA
• nucleotide
• replication
• RNA
• transcription
• translation
• mutation
DNA and Genetics

6. Before the 1950s, we knew that:
 Inherited characteristics are determine by
genes.
 Genes are passed from one generation to the
next.
 Genes are part of a chromosome.
 Cells divide. Before they divide, they have to
copy their structures, organelles, & their genetic
information.
1. What scientists contributed to our
understanding of DNA?

7. 1. What scientists contributed to our
understanding of DNA?

8. 1. What is DNA?
• An organism’s genetic
material, made up of
nucleotides
• deoxyribonucleic acid
• A gene is a segment of
DNA on a chromosome
that provides directions
for making proteins.
1. What scientists contributed to our
understanding of DNA?

9. Rosalind Franklin (1920-
1958)
• Made significant
advances in X-ray
diffraction techniques
with DNA
• Her images showed
that DNA had a spiral
shape
1. What scientists contributed to our
understanding of DNA?

10. Maurice Wilkins (1916-2004)
• Worked with Rosalind
Franklin with X-ray diffraction
studies of DNA
• Shared info. with Watson &
Crick
1. What scientists contributed to our
understanding of DNA?

11. Erwin Chargaff (1905-2002)
• Investigated composition of
DNA
• In 1950, he discovered base-
pairings of A-T & G-C
1. What scientists contributed to
our understanding of DNA?

12. James Watson (1928) &
Francis Crick (1916-2004)
• Worked together to
determine DNA’s structure
• Determined DNA’s double
helix shape
• Watson, Crick, & Wilkins
were awarded the Nobel
Prize in 1962 (Franklin
passed away beforehand)
1. What scientists contributed to our
understanding of DNA?

13. • DNA is shaped like a double helix,
which is like a twisted ladder.
• DNA is made up of nucleotides.
2. What is the structure of DNA?

14. • A nucleotide is a molecule made of:
I. a nitrogen base,
• There are 4 nitrogen bases:
– adenine (A)
– cytosine (C)
– thymine (T)
– guanine (G)
• Nitrogen bases bond and form the rungs of the ladder.
II. a sugar, & a phosphate group.
• Sugar-phosphate groups form the sides of the DNA ladder.
2. What is the structure of DNA?

15. Certain bases always bond together: A – T and
C – G.
2. What is the structure of DNA?

16. DNA – What does my code look like?
Computer Code:
10010100111010001100101001110010111100101001
00100100101110010100010101001001010010101001
0010100101001010100101001010010101010101001
010100101010111111100
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAG
ATAAACTAGAGAGACCCTTTAAAACACACAGAGATA
GACAGAAAAACAATAGACAGATACAGATAGACATAA
AAAATTTTTTGGGAAA…millions and millions of
bases…

17. Practice DNA Base Pairs
A T T A C A
C TT A A T

18. In DNA, which of the following is
paired with guanine?
a. b. c. d.
0 000
a. Adenine
b. Cytosine
c. Thymine
d. Uracil
45

19. In DNA, which of the following is
paired with Adenine?
a. b. c. d.
0 000
a. Adenine
b. Cytosine
c. Guanine
d. Thymine
45

20. In DNA, which of the following is
paired with Cytosine?
a. b. c. d.
0 000
a. Adenine
b. Cytosine
c. Guanine
d. Thymine
45

21. Replication is the process of copying a DNA
molecule to make another DNA molecule.
2. What is the structure of DNA?

22. What is the product of replication?
a. b. c. d.
0 000
a. DNA
b. RNA
c. mRNA
d. Proteins
45

23. DNA replication – helix unzips

24. DNA replication – helix unzips

25. DNA replication – two strands are separated

26. DNA replication – each side is now a template

27. DNA replication – two identical strands of DNA
Original DNA strands

28. DNA replication
Newly assembled DNA strands

29. • The DNA of each cell carries the
complete set of genes that provide
instructions for making all the proteins a
cell requires.
• Proteins are made with the help of
ribonucleic acid (RNA)
• RNA carries the code for making proteins
from the nucleus to the cytoplasm.
3. What is the role of RNA in protein
production?

30. • RNA:
• is made of
nucleotides.
• is single-stranded.
• has the nitrogen
base uracil (U)
instead of thymine
(T)
• A-U & G-C
3. What is the role of RNA in protein
production?
• DNA:
• is made of
nucleotides.
• is double-stranded.
• has the nitrogen
base thymine (T)

31. How are DNA and RNA the same?
a. b. c. d.
0 000
a. They are both double stranded
b. They both are made up of nucleotides
c. They both have the nitrogen base uracil
(U)
d. They both have the nitrogen base
thymine (T)
45

33. Transcription—the process of making
RNA from DNA—is the first step in making
a protein.
3. What is the role of RNA in protein
production?

34. What is created through
transcription?
a. b. c. d.
0 000
a. DNA
b. Mutations
c. mRNA
d. Protein
45

35. Translation: the process of making a protein
from RNA.
3. What is the role of RNA in protein
production?

36. Which of the following describes the
process of making a protein from
RNA?
a. b. c. d.
0 000
a. Translation
b. Transcription
c. Replication
d. Mutation
45

37. Mutation occurs when the sequence of
nucleotides is changed in a gene.
mutation
from Latin mutare, means “to
change”
4. How do changes in the sequence of DNA
affect traits?

38. • The 46 human chromosomes contain
between 20,000 and 25,000 genes that
are copied during replication.
• Mutations can be triggered by exposure
to X-rays, ultraviolet light, radioactive
materials, and some kinds of chemicals.
4. How do changes in the sequence of DNA
affect traits?

39. The 3 types of mutations are substitution,
insertion, and deletion.
4. How do changes in the sequence of DNA
affect traits?

40. Which of the following describes the
mutation that occurs when three
base pairs are added?
a. b. c. d.
0 000
a. Insertion
b. Substitution
c. Transgression
d. Deletion
45

41. Which of the following describes an
error made during the copying of
DNA?
a. b. c. d.
0 000
a. Transcription
b. Replication
c. Translation
d. Mutation
45

42. • The effects of a mutation depend on where in
the DNA sequence the mutation happens and
the type of mutation.
• Some mutations in human DNA cause genetic
disorders.
• Some mutations can be beneficial for the
organism, even helping it survive diseases.
– If a person only has 1 sickle cell allele (not both),
they are more resistant to malaria.
– Some believe that blue eye color is the result of a
mutation.
4. How do changes in the sequence of DNA
affect traits?

44. In DNA, which of the following is
true?
A. B. C. D.
0 000
A. adenine bonds with guanine
B. cytosine bonds with adenine
C. thymine bonds with adenine
D. none of the above
45

45. • DNA is a complex molecule that
contains the code for an organism’s
genetic material.

46. • RNA carries the codes for making
proteins.

47. • An organism’s nucleotide sequence
can change through the deletion,
insertion, or substitution of nitrogen
bases.

48. Any condition present at birth is genetic.
a. Agree
b. Disagree
00
a. b.
45

49. A change in the sequence of an
organism’s DNA always changes the
organism’s traits.
a. Agree
b. Disagree
00
a. b.
45

50. Key Concept Summary
Interactive Concept Map
Chapter Review
Standardized Test Practice

51. Inherited genes are
the basis of an
organism’s traits.

52. • Mendel performed cross-pollination experiments to
track which traits were produced by specific parental
crosses.
• Mendel found that two factors—one from a sperm
cell and one from an egg cell—control each trait.
• Dominant traits block the expression of recessive
traits. Recessive traits are expressed only when two
recessive factors are present.
Lesson 1: Mendel and His Peas

53. Lesson 2: Understanding Inheritance
• Phenotype describes how a
trait appears.
• Genotype describes alleles
that control a trait.
• Punnett squares and
pedigrees are tools to model
patterns of inheritance.
• Many patterns of inheritance,
such as codominance and
polygenic inheritance, are
more complex than Mendel
described.

54. • DNA contains an organism’s genetic
information.
• RNA carries the codes for making
proteins from the nucleus to the
cytoplasm. RNA also forms part of
ribosomes.
• A change in the sequence of DNA,
called a mutation, can change the
traits of an organism.
Lesson 3: DNA and Genetics