SlideShare a Scribd company logo
Week 5 Assignment B View the assignment video on the week
5 page FIRST. This is one of the more difficult assignments you
will do all semester. Work your way through one step at a time,
using the examples to help you. If you need help, ASK!
The crime lab collected evidence from the scene of the crime –
specifically, hair and blood samples. Now it is time for you to
analyze the data and figure out “who done it”. You will do this
by creating a DNA fingerprint with the samples that were
collected.
As you learned in the mini-lecture, a DNA fingerprint is
collected using the following methods
· Cut the DNA into pieces using restriction enzymes
· Copy the DNA many times to get more of it to work with
· “Run” the DNA through a gel to separate the different pieces
(gel electrophoresis), which will separate the pieces of cut DNA
by size
You are going to do this for the various samples you collected
from the crime scene, and use that data to solve the crime.
Step 1.Cut the DNA into pieces using restriction enzymes. You
use the restriction enzyme HaeIII to cut the DNA into pieces.
HaeIII cuts the following way:
AAGGCCTAG gets cut into AAGG CCTAG
TTCCGGATC TTCC
GGATC
So, every time the enzyme encounters the sequence “GGCC”,
the DNA strand it cut between the G’s and C’s.
The DNA samples we are working with contain 2 short tandem
repeat (STR) segments. The first repeat is CCACGT, and the
second is CGC. Cut the DNA with the restriction enzyme,
HaeIII. The first DNA sample (victim) is cut for you. Determine
how many base pairs (bp) long each piece of DNA is once it has
been cut.
(a) Victim:
CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC
GCCGCCGCGGCCA
GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG
CGGCGGCGCCGGT
Answer:
Site 1: (16bp long) Site 2: (25bp long)
CCGAGAGG CCCCACGTCCACGTGG
CCCGCCGCCGCCGCCGCCGCCGCGG CCA
GGCTCTCC GGGGTGCAGGTGCACC
GGGCGGCGGCGGCGGCGGCGGCGCC GGT
The enzyme cut each time the target sequence appeared in our
DNA sample. We counted the length (in base pairs) of the DNA
pieces between the cuts. Cut the remaining DNA samples
yourself, and determine how many base pairs each is.
(b) Suspect #1:
CCAGGCCCCACGTCCACGTCCACGTGGCCCGCCGCCGCGG
CCTAAAGAGGCTA
GGTCCGGGGTGCAGGTGCAGGTGCACCGGGCGGCGGCGC
CGGATTTCTCCGAT
Answer: Site 1 Site #2
c) Suspect #2
CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC
GCCGCGGCCTAAA
GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG
CGGCGCCGGATTT
Answer: Site 1 Site #2
d) Evidence (hair sample)
CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC
GCCGCGGCCTAAA
GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG
CGGCGCCGGATTT
Answer: Site 1 Site #2
e) Evidence (blood sample)
CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC
GCCGCCGCGGCCA
GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG
CGGCGGCGCCGGT
Answer: Site 1 Site #2
Step 2. You use a machine to make many copies of your DNA
pieces.
(assignment continues below)
Step 3.Gel Electrophoresis. You place you cut DNA samples
into a gel electrophoresis machine. You have already
determined how big each of your DNA pieces is (above). Use
that information to draw what the gel would look from these
samples. Each sample (victim, hair, etc) will have 2 bands on
the gel – once for each of the cut pieces of DNA. Draw those on
the gel below. The first (victim) is done for you.
Tech Tip: To draw on the gel, click on one of existing purple
lines for the victim, copy, then paste. Move the line to the
appropriate space on the gel. You may not be able to get the
line exactly where you want it – but close counts in this
assignment!
(
Victim
) (
Blood
) (
Hair
) (
S #2
) (
S #1
) Gel
(
50
bp
)
(
40
bp
)
(
15
bp
) (
5
bp
) (
10
bp
) (
20
bp
) (
30
bp
)(assignment continues below)
Step 4.Analysis. Based on the DNA evidence above, answer the
following questions.
a) What conclusions can you make about the DNA collected
from the hair sample left at the scene of the crime? How do you
know?
b) What conclusions can you make about the DNA collected
from the blood sample left at the scene of the crime? How do
you know?
c) Who do you think committed the crime? What evidence is
there to support this?
Week 5 Assignment B   View the assignment video on the week 5 page.docx

More Related Content

Similar to Week 5 Assignment B View the assignment video on the week 5 page.docx

DNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIMEDNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIME
Pundlik Rathod
 
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil TamangData Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Apil Tamang
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
sherwen
 
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docxCSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
faithxdunce63732
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
c.titus.brown
 
Genotype Imputation via Matrix Completion
Genotype Imputation via Matrix CompletionGenotype Imputation via Matrix Completion
Genotype Imputation via Matrix Completion
echi99
 
Dna profiling lecture bls 209
Dna profiling lecture bls 209Dna profiling lecture bls 209
Dna profiling lecture bls 209
Bruno Mmassy
 

Similar to Week 5 Assignment B View the assignment video on the week 5 page.docx (20)

Biotech labs - restriction digest and transformation
Biotech labs - restriction digest and transformationBiotech labs - restriction digest and transformation
Biotech labs - restriction digest and transformation
 
DNA cell cycle by flow cytometry
DNA cell cycle by flow cytometryDNA cell cycle by flow cytometry
DNA cell cycle by flow cytometry
 
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRXDeep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
 
DNA Profiling_HMD_2020.pptx
DNA Profiling_HMD_2020.pptxDNA Profiling_HMD_2020.pptx
DNA Profiling_HMD_2020.pptx
 
Dna sequencing
Dna sequencingDna sequencing
Dna sequencing
 
Dna forensic
Dna forensicDna forensic
Dna forensic
 
DNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIMEDNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIME
 
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil TamangData Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
 
Restriction mapping of bacterial dna
Restriction mapping of bacterial dnaRestriction mapping of bacterial dna
Restriction mapping of bacterial dna
 
BioAlg02.ppt
BioAlg02.pptBioAlg02.ppt
BioAlg02.ppt
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
SNP
SNPSNP
SNP
 
Cyto 2015 Forensic Flow Cytometry Tutorial
Cyto 2015 Forensic Flow Cytometry TutorialCyto 2015 Forensic Flow Cytometry Tutorial
Cyto 2015 Forensic Flow Cytometry Tutorial
 
Development of a low cost pc-based single-channel eeg monitoring system
Development of a low cost pc-based single-channel eeg monitoring systemDevelopment of a low cost pc-based single-channel eeg monitoring system
Development of a low cost pc-based single-channel eeg monitoring system
 
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docxCSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Microarray full detail
Microarray full detailMicroarray full detail
Microarray full detail
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
 
Genotype Imputation via Matrix Completion
Genotype Imputation via Matrix CompletionGenotype Imputation via Matrix Completion
Genotype Imputation via Matrix Completion
 
Dna profiling lecture bls 209
Dna profiling lecture bls 209Dna profiling lecture bls 209
Dna profiling lecture bls 209
 

More from melbruce90096

_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx
melbruce90096
 
[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx
melbruce90096
 
[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx
melbruce90096
 
Your paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docxYour paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docx
melbruce90096
 
Your Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docxYour Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docx
melbruce90096
 
Your Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docxYour Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docx
melbruce90096
 
Your draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docxYour draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docx
melbruce90096
 
Your company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docxYour company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docx
melbruce90096
 
your assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docxyour assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docx
melbruce90096
 
Your assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docxYour assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docx
melbruce90096
 

More from melbruce90096 (20)

`Do assignments as detailed outNO WIKI for referncesPlease m.docx
`Do assignments as detailed outNO WIKI for referncesPlease m.docx`Do assignments as detailed outNO WIKI for referncesPlease m.docx
`Do assignments as detailed outNO WIKI for referncesPlease m.docx
 
_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx
 
[removed]eltomate  Son rojos y se sirven (they are serv.docx
[removed]eltomate  Son rojos y se sirven (they are serv.docx[removed]eltomate  Son rojos y se sirven (they are serv.docx
[removed]eltomate  Son rojos y se sirven (they are serv.docx
 
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
 
[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx
 
Your paper should be a literary essay in which you present a combina.docx
Your paper should be a literary essay in which you present a combina.docxYour paper should be a literary essay in which you present a combina.docx
Your paper should be a literary essay in which you present a combina.docx
 
[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx
 
Your paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docxYour paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docx
 
Your Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docxYour Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docx
 
Your Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docxYour Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docx
 
Your director is not aware of the involvement of the Department of H.docx
Your director is not aware of the involvement of the Department of H.docxYour director is not aware of the involvement of the Department of H.docx
Your director is not aware of the involvement of the Department of H.docx
 
YOull need to know The purpose of this research is to focus atte.docx
YOull need to know The purpose of this research is to focus atte.docxYOull need to know The purpose of this research is to focus atte.docx
YOull need to know The purpose of this research is to focus atte.docx
 
Your draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docxYour draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docx
 
Your company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docxYour company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docx
 
Your boss has asked you to write a Project Management Plan. Your pla.docx
Your boss has asked you to write a Project Management Plan. Your pla.docxYour boss has asked you to write a Project Management Plan. Your pla.docx
Your boss has asked you to write a Project Management Plan. Your pla.docx
 
Your boss has chosen you to give a presentation to a number of forei.docx
Your boss has chosen you to give a presentation to a number of forei.docxYour boss has chosen you to give a presentation to a number of forei.docx
Your boss has chosen you to give a presentation to a number of forei.docx
 
your assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docxyour assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docx
 
Your assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docxYour assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docx
 
your article must be a research article You can tell it is a researc.docx
your article must be a research article You can tell it is a researc.docxyour article must be a research article You can tell it is a researc.docx
your article must be a research article You can tell it is a researc.docx
 
Your administrator has come to you for information for a present.docx
Your administrator has come to you for information for a present.docxYour administrator has come to you for information for a present.docx
Your administrator has come to you for information for a present.docx
 

Recently uploaded

Recently uploaded (20)

Morse OER Some Benefits and Challenges.pptx
Morse OER Some Benefits and Challenges.pptxMorse OER Some Benefits and Challenges.pptx
Morse OER Some Benefits and Challenges.pptx
 
Open Educational Resources Primer PowerPoint
Open Educational Resources Primer PowerPointOpen Educational Resources Primer PowerPoint
Open Educational Resources Primer PowerPoint
 
Basic Civil Engg Notes_Chapter-6_Environment Pollution & Engineering
Basic Civil Engg Notes_Chapter-6_Environment Pollution & EngineeringBasic Civil Engg Notes_Chapter-6_Environment Pollution & Engineering
Basic Civil Engg Notes_Chapter-6_Environment Pollution & Engineering
 
The Benefits and Challenges of Open Educational Resources
The Benefits and Challenges of Open Educational ResourcesThe Benefits and Challenges of Open Educational Resources
The Benefits and Challenges of Open Educational Resources
 
Danh sách HSG Bộ môn cấp trường - Cấp THPT.pdf
Danh sách HSG Bộ môn cấp trường - Cấp THPT.pdfDanh sách HSG Bộ môn cấp trường - Cấp THPT.pdf
Danh sách HSG Bộ môn cấp trường - Cấp THPT.pdf
 
size separation d pharm 1st year pharmaceutics
size separation d pharm 1st year pharmaceuticssize separation d pharm 1st year pharmaceutics
size separation d pharm 1st year pharmaceutics
 
Benefits and Challenges of Using Open Educational Resources
Benefits and Challenges of Using Open Educational ResourcesBenefits and Challenges of Using Open Educational Resources
Benefits and Challenges of Using Open Educational Resources
 
Salient features of Environment protection Act 1986.pptx
Salient features of Environment protection Act 1986.pptxSalient features of Environment protection Act 1986.pptx
Salient features of Environment protection Act 1986.pptx
 
How to Manage Notification Preferences in the Odoo 17
How to Manage Notification Preferences in the Odoo 17How to Manage Notification Preferences in the Odoo 17
How to Manage Notification Preferences in the Odoo 17
 
2024_Student Session 2_ Set Plan Preparation.pptx
2024_Student Session 2_ Set Plan Preparation.pptx2024_Student Session 2_ Set Plan Preparation.pptx
2024_Student Session 2_ Set Plan Preparation.pptx
 
Mattingly "AI & Prompt Design: Limitations and Solutions with LLMs"
Mattingly "AI & Prompt Design: Limitations and Solutions with LLMs"Mattingly "AI & Prompt Design: Limitations and Solutions with LLMs"
Mattingly "AI & Prompt Design: Limitations and Solutions with LLMs"
 
Sectors of the Indian Economy - Class 10 Study Notes pdf
Sectors of the Indian Economy - Class 10 Study Notes pdfSectors of the Indian Economy - Class 10 Study Notes pdf
Sectors of the Indian Economy - Class 10 Study Notes pdf
 
Telling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdf
Telling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdfTelling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdf
Telling Your Story_ Simple Steps to Build Your Nonprofit's Brand Webinar.pdf
 
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
 
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General QuizPragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
 
UNIT – IV_PCI Complaints: Complaints and evaluation of complaints, Handling o...
UNIT – IV_PCI Complaints: Complaints and evaluation of complaints, Handling o...UNIT – IV_PCI Complaints: Complaints and evaluation of complaints, Handling o...
UNIT – IV_PCI Complaints: Complaints and evaluation of complaints, Handling o...
 
Keeping Your Information Safe with Centralized Security Services
Keeping Your Information Safe with Centralized Security ServicesKeeping Your Information Safe with Centralized Security Services
Keeping Your Information Safe with Centralized Security Services
 
Basic_QTL_Marker-assisted_Selection_Sourabh.ppt
Basic_QTL_Marker-assisted_Selection_Sourabh.pptBasic_QTL_Marker-assisted_Selection_Sourabh.ppt
Basic_QTL_Marker-assisted_Selection_Sourabh.ppt
 
NCERT Solutions Power Sharing Class 10 Notes pdf
NCERT Solutions Power Sharing Class 10 Notes pdfNCERT Solutions Power Sharing Class 10 Notes pdf
NCERT Solutions Power Sharing Class 10 Notes pdf
 
Sha'Carri Richardson Presentation 202345
Sha'Carri Richardson Presentation 202345Sha'Carri Richardson Presentation 202345
Sha'Carri Richardson Presentation 202345
 

Week 5 Assignment B View the assignment video on the week 5 page.docx

  • 1. Week 5 Assignment B View the assignment video on the week 5 page FIRST. This is one of the more difficult assignments you will do all semester. Work your way through one step at a time, using the examples to help you. If you need help, ASK! The crime lab collected evidence from the scene of the crime – specifically, hair and blood samples. Now it is time for you to analyze the data and figure out “who done it”. You will do this by creating a DNA fingerprint with the samples that were collected. As you learned in the mini-lecture, a DNA fingerprint is collected using the following methods · Cut the DNA into pieces using restriction enzymes · Copy the DNA many times to get more of it to work with · “Run” the DNA through a gel to separate the different pieces (gel electrophoresis), which will separate the pieces of cut DNA by size You are going to do this for the various samples you collected from the crime scene, and use that data to solve the crime. Step 1.Cut the DNA into pieces using restriction enzymes. You use the restriction enzyme HaeIII to cut the DNA into pieces. HaeIII cuts the following way: AAGGCCTAG gets cut into AAGG CCTAG TTCCGGATC TTCC GGATC So, every time the enzyme encounters the sequence “GGCC”, the DNA strand it cut between the G’s and C’s.
  • 2. The DNA samples we are working with contain 2 short tandem repeat (STR) segments. The first repeat is CCACGT, and the second is CGC. Cut the DNA with the restriction enzyme, HaeIII. The first DNA sample (victim) is cut for you. Determine how many base pairs (bp) long each piece of DNA is once it has been cut. (a) Victim: CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC GCCGCCGCGGCCA GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG CGGCGGCGCCGGT Answer: Site 1: (16bp long) Site 2: (25bp long) CCGAGAGG CCCCACGTCCACGTGG CCCGCCGCCGCCGCCGCCGCCGCGG CCA GGCTCTCC GGGGTGCAGGTGCACC GGGCGGCGGCGGCGGCGGCGGCGCC GGT The enzyme cut each time the target sequence appeared in our DNA sample. We counted the length (in base pairs) of the DNA pieces between the cuts. Cut the remaining DNA samples yourself, and determine how many base pairs each is. (b) Suspect #1: CCAGGCCCCACGTCCACGTCCACGTGGCCCGCCGCCGCGG CCTAAAGAGGCTA GGTCCGGGGTGCAGGTGCAGGTGCACCGGGCGGCGGCGC CGGATTTCTCCGAT Answer: Site 1 Site #2 c) Suspect #2
  • 3. CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC GCCGCGGCCTAAA GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG CGGCGCCGGATTT Answer: Site 1 Site #2 d) Evidence (hair sample) CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC GCCGCGGCCTAAA GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG CGGCGCCGGATTT Answer: Site 1 Site #2 e) Evidence (blood sample) CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC GCCGCCGCGGCCA GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG CGGCGGCGCCGGT Answer: Site 1 Site #2 Step 2. You use a machine to make many copies of your DNA pieces. (assignment continues below) Step 3.Gel Electrophoresis. You place you cut DNA samples into a gel electrophoresis machine. You have already determined how big each of your DNA pieces is (above). Use
  • 4. that information to draw what the gel would look from these samples. Each sample (victim, hair, etc) will have 2 bands on the gel – once for each of the cut pieces of DNA. Draw those on the gel below. The first (victim) is done for you. Tech Tip: To draw on the gel, click on one of existing purple lines for the victim, copy, then paste. Move the line to the appropriate space on the gel. You may not be able to get the line exactly where you want it – but close counts in this assignment! ( Victim ) ( Blood ) ( Hair ) ( S #2 ) ( S #1 ) Gel ( 50 bp ) ( 40 bp )
  • 5. ( 15 bp ) ( 5 bp ) ( 10 bp ) ( 20 bp ) ( 30 bp )(assignment continues below) Step 4.Analysis. Based on the DNA evidence above, answer the following questions. a) What conclusions can you make about the DNA collected from the hair sample left at the scene of the crime? How do you know? b) What conclusions can you make about the DNA collected from the blood sample left at the scene of the crime? How do you know? c) Who do you think committed the crime? What evidence is there to support this?