Week 5 Assignment B View the assignment video on the week 5 page FIRST. This is one of the more difficult assignments you will do all semester. Work your way through one step at a time, using the examples to help you. If you need help, ASK! The crime lab collected evidence from the scene of the crime – specifically, hair and blood samples. Now it is time for you to analyze the data and figure out “who done it”. You will do this by creating a DNA fingerprint with the samples that were collected. As you learned in the mini-lecture, a DNA fingerprint is collected using the following methods · Cut the DNA into pieces using restriction enzymes · Copy the DNA many times to get more of it to work with · “Run” the DNA through a gel to separate the different pieces (gel electrophoresis), which will separate the pieces of cut DNA by size You are going to do this for the various samples you collected from the crime scene, and use that data to solve the crime. Step 1.Cut the DNA into pieces using restriction enzymes. You use the restriction enzyme HaeIII to cut the DNA into pieces. HaeIII cuts the following way: AAGGCCTAG gets cut into AAGG CCTAG TTCCGGATC TTCC GGATC So, every time the enzyme encounters the sequence “GGCC”, the DNA strand it cut between the G’s and C’s. The DNA samples we are working with contain 2 short tandem repeat (STR) segments. The first repeat is CCACGT, and the second is CGC. Cut the DNA with the restriction enzyme, HaeIII. The first DNA sample (victim) is cut for you. Determine how many base pairs (bp) long each piece of DNA is once it has been cut. (a) Victim: CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCGGCCA GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGCCGGT Answer: Site 1: (16bp long) Site 2: (25bp long) CCGAGAGG CCCCACGTCCACGTGG CCCGCCGCCGCCGCCGCCGCCGCGG CCA GGCTCTCC GGGGTGCAGGTGCACC GGGCGGCGGCGGCGGCGGCGGCGCC GGT The enzyme cut each time the target sequence appeared in our DNA sample. We counted the length (in base pairs) of the DNA pieces between the cuts. Cut the remaining DNA samples yourself, and determine how many base pairs each is. (b) Suspect #1: CCAGGCCCCACGTCCACGTCCACGTGGCCCGCCGCCGCGGCCTAAAGAGGCTA GGTCCGGGGTGCAGGTGCAGGTGCACCGGGCGGCGGCGCCGGATTTCTCCGAT Answer: Site 1 Site #2 c) Suspect #2 CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCCGCCGCGGCCTAAA GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGGCGGCGCCGGATTT Answer: Site 1 Site #2 d) Evidence (hair sample) CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCCGCCGCGGCCTAAA GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGGCGGCGCCGGATTT Answer: Site 1 Site #2 e) Evidence (blood sample) CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCGGCCA GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGCCGGT Answer: Site 1 Site #2 Step 2. You use a machine to make many copies of your DNA pieces. (assignment continues below) Step 3.Gel Electrophoresis. You place you cut DNA sample.