This lab has two parts – please answer all parts. Lab 7: Biotechnology A. Gene Finder Activity Lab Materials Materials found in your lab kit: • none Additional materials needed: • access to the Internet Activity 1. Connect to the Internet. 2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome 3. You will see the following screen: 4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates). DNA sequences (When copying and pasting, please don't include the dashes!) For the men: ---------------------------------------------------------------- cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag ---------------------------------------------------------------- For the women: ---------------------------------------------------------------- cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc --------------------------------------------------------------- 5. Scroll down and Press BLAST: Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place. After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence. 6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.

1. This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information
(NCBI) at
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BL
AST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SH
OW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:

2. 4. Copy the exact nucleotide sequence given below and then
paste it into the Enter Query Sequence box on the Nucleotide-
nucleotide BLAST search page. Accuracy is extremely
important. The sequence should be one long string of letters
with no spaces. Record the sequence number you are given (you
may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't
include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgatta
cagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactga
aagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccagga
tggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagat
ggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagt
ggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacagg
ccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgc

3. tgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaa
ctggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcac
cagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgcta
cag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacg
gaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagct
gcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttc
tagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on
BLAST! A screen should appear that says to wait a period of
time (usually 30 seconds or less) for the search to be completed.
Be patient while formatting takes place.

4. After the search has ended, scroll down the screen until you
find a list introduced by the words DESCRIPTIONS – look
below it and find Sequences producing significant alignments.
Listed in order are the closest matches with the pasted DNA
sequence.
6. Find the first listing (the closest match) that has both a
blue square containing a 'G' and the term Human or Homo
sapiens in the description. Click on the blue G. Clicking on the
G will take you to a new screen that gives the gene name,
symbol, and identifier. Write down or electronically copy the
name of the gene. (Copy and paste the information in a separate
MSWord file for your records).
7. Read the information on the gene and disease and then
answer the following questions:
1. Find and record the name of the corresponding gene you
were assigned.
SRY
2. Record the gene locus [LOCATION].
Yp11.31 .

5. 3. Report the chromosome this gene is located on.
？
8. Find at the right hand side the word LINKS and click on
the link labeled OMIM (Online Mendelian Inheritance in Man).
9. Scroll down for information about the gene and disorder/
disease associated with it – you will get several links.
Because a gene may be associated with more than one disease/
disorder, different reference numbers may provide information
on other diseases/ disorders that are associated with the gene
you’re researching. You may use more than one for the next
question.
10. Prepare a summary describing the genetic disease that is a
result of the mutated gene. Provide the name of the normal
protein that is encoded by the normal gene and describe the role
of this protein. Then, describe the structural and functional
alteration that has occurred as a result of the mutation. Include

6. in the description the effects on the phenotype of an individual
with the genetic disease.
Type in here. This expands as you type.
Critical Thinking Questions and Summary
Please answer these comprehensively (i.e., at least 2 well–
thought-out sentences each).
1. Explain how DNA determines the traits of an organism.
Discuss the roles of nucleotides, genes, genotypes, proteins, and
phenotypes in your answer.
Type in here. This expands as you type.
2. How do genetic mutations affect the traits of an organism?
Explain how mutations may cause genetic diseases. Provide an
example of a genetic disease caused by a mutation.
Type in here. This expands as you type.
3. What are some possible ramifications if the DNA
information of individuals were made available to employers

7. and insurance companies?
Type in here. This expands as you type.
4. Summarize in your own words what you have learned from
the Gene Finder Activity. (At least five (5) well-thought-out
sentences.)
Type in here. This expands as you type.
[removed]
Lab 7: Biotechnology
B. DNA Fingerprints Activity
Lab Materials
Materials found in your lab kit:
• none

8. Additional materials needed:
• access to the Internet
Activity
Quick Guide to Forensic DNA
Just like fingerprints, DNA is unique to each person. Also like
fingerprints, DNA can be used to identify a person when
biological material containing DNA is left at a crime scene.
Several techniques are available to generate DNA fingerprints
from biological samples. Here we will illustrate the use of
restriction enzymes and gel electrophoresis.
Restriction enzymes are naturally occurring proteins produced
by bacteria. These enzymes function like DNA scissors; they
look for specific sequences within a piece of DNA, and where
those sequences occur, they cut the DNA through both strands.
For example, one restriction enzyme recognizes the sequence -
GGATCC-, and will cut a piece of DNA containing that
sequence between the A and the T. If this enzyme were applied
to the piece of DNA below, it would cut it into three pieces, as
shown in figure 11.1.
Notice the enzyme cut the DNA only where the sequence -
GGATCC- occurred. This cut the original piece of DNA that
was 25 nucleotide pairs long into three fragments that were 7, 8,
and 10 nucleotide pairs long. The sizes of the fragments
produced will vary depending on the source of the DNA; thus,
the fragmentation pattern can be used to identify the source of a
particular DNA sample.
To visualize the fragment pattern produced from restriction
enzyme digestion of a DNA sample, forensic scientists use a
process called gel electrophoresis (visit

9. http://gslc.genetics.utah.edu/units/biotech/gel/ for additional
information and an interactive virtual experiment). In this
procedure, a dense, gelatin-like material is poured between two
closely spaced glass plates. Once the material has solidified,
DNA samples are loaded into slots cut in the top of the gel, and
a strong electric field is applied to it for a certain period of time
(60 minutes, for example), with the negative pole at the top and
the positive pole at the bottom.
Because DNA is negatively charged, it will migrate through the
gel toward the positive pole. The smaller the fragment of DNA,
the faster it can travel through the gel, so fragments of different
sizes will separate from each other, with the smaller, faster-
moving fragments finishing near the bottom, and larger, slower-
moving fragments staying closer to the top. This will produce a
banding pattern, like a DNA bar code, that can show the unique
differences between individuals.
The animation in figure 11.2 summarizes the procedure we have
just described:
1. DNA fragments migrate on the gel as electrical current is
applied (smaller fragments migrate faster).
2. After a certain time period, the current is shut off and the
gel is stained to view the various patterns of the DNA samples.

10. Note that in figure 11.2, lane 2 represents the banding pattern
that would be produced from the restriction enzyme activity
illustrated in figure 11.1 above (yielding fragments of 7, 8, and

11. 10 nucleotide pairs).
The Crime Scene
In this activity, you will be given DNA isolated from two
samples left at a crime scene. A victim has been found
murdered. The forensics team has gathered DNA evidence from
blood on a power strip and from material found under the
victim's fingernails. Your job is to compare the DNA from the
samples with the DNA of six known subjects and determine if
there is a match.
To process these samples you will perform the following steps:
1. First, examine the DNA sequences for the presence of the
restriction enzyme recognition sequence -GGATCC-, and
wherever it occurs, "cut" the DNA through both strands between
the A and the T.
2. Then, determine the fragment sizes that will be produced
from cutting the DNA at these sites by counting the number of
nucleotide pairs in each fragment - e.g., if the fragments are as
follows, with * indicating the cut point,
then the fragment sizes are (counting from the first A = ) 10
nucleotide pairs, and (counting from the C in the next fragment)
= 4 nucleotide pairs.

12. Note: For a long DNA sequence such as in forensic analyses,
there are several GGATTC cut points, varying per individual.
Thus, you would expect several fragments which will differ
among different individuals. So, look for all the GGATCC sites
on the stretch of DNA given and “cut them up”. (In real life,
many different enzymes are used to cut up the DNA at different
recognition sequences).
3. Next, if you have access to a printer, print the page that
includes figure 11.3 and draw the appropriate line markings into
lanes 1 and 2.
Note: A barcode-like pattern will emerge and would be different
per given individual. Match those which are identical, and form
your own conclusions (e.g., Who did it? Who was the possible
perpetrator or the “perp”?).
4. Finally, compare the fragment patterns from the two
samples to the known patterns of the suspects to determine the
source of the two biological samples. (If you can’t print the
figure, list your fragment lengths in increasing order and find
the lane whose markings match those for samples 1 and 2.)
DNA Samples
The DNA sequences from the two samples found at the crime
scene are given below. Recall the restriction enzyme
recognition site: -GGATCC-. The enzyme cuts between each
occurrence of A and T in both samples.
Sample 1: Blood from power strip

13. Sample 2: Biological material under victim's fingernails
"Cut" the strands and enter the resulting fragment sizes into the
boxes below.
Analysis and Results
1. Fragment sizes for sample 1:
Type in here. This expands as you type.
2. Fragment sizes for sample 2:
Type in here. This expands as you type.

14. Figure 11.3
DNA Fingerprinting Gel
Lane 1: Blood sample from power strip
Lane 2: Material from under victim's fingernails
Lane 3: Subject A's (Victim's) DNA
Lane 4: Subject B's DNA
Lane 5: Subject C's DNA
Lane 6: Subject D's DNA
Lane 7: Subject E's DNA
Lane 8: Subject F's DNA
3. Sample found on power strip came from:
Type in here. This expands as you type.
4. Sample found under victim's fingernails came from:
Type in here. This expands as you type.

15. Critical Thinking Questions & Summary
1. What conclusions can or cannot be drawn from the DNA
analysis you conducted in the DNA Fingerprints Activity?
Type in here. This expands as you type.
2. Both conventional fingerprints (from your fingers) and
DNA fingerprints are ways to identify individuals present at a
crime scene. Why is DNA fingerprinting a more reliable way to
positively identify those present at a crime scene than using
conventional fingerprints?
Type in here. This expands as you type.
3. In some cases, juries have failed to find suspects guilty of
a crime despite DNA fingerprint evidence showing their
presence at the crime scene. Describe two ways DNA evidence
can be compromised, leading to uncertainty.
Type in here. This expands as you type.

16. 4. Besides forensic applications, what are some other ways in
which DNA fingerprinting may be useful? Describe three other
ways DNA fingerprinting might be useful in providing positive
identification.
Type in here. This expands as you type.
5. Summarize, in your own words, what you have learned
from the DNA Fingerprints Activity.
Type in here. This expands as you type.
[removed]