Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Torsten Seemann
This document summarizes a presentation about transitioning a public health microbiology laboratory from traditional bacterial typing methods like PFGE to whole genome sequencing (WGS) and bioinformatics. Key points include:
1) WGS allows for higher resolution analysis of bacterial isolates compared to traditional methods and can identify genomic variations, plasmids, and resistance/virulence genes.
2) Implementing WGS requires developing automated pipelines for processing large volumes of sequencing data using techniques like read mapping, de novo assembly, and k-mer analysis.
3) The goals are to modernize operations, increase research output, and develop shared online systems and data sharing between laboratories internationally.
This document summarizes a presentation on using whole genome sequencing (WGS) for rapid characterization of bacterial outbreaks. The presenter discusses transitioning public health labs from traditional typing methods to WGS-based approaches. Key points include developing automated analysis pipelines to identify bacteria, determine antimicrobial resistance and virulence genes, and construct phylogenomic trees from core genome SNPs. The goal is a cloud-based system allowing labs to securely upload and analyze sequencing data with open source tools integrated in modular pipelines.
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Torsten Seemann
Long read sequencing - the good, the bad, and the really cool. Covers Illumina SLR, Pacbio RSII and Oxford Nanopore as of June 2015. Discusses bioinformatics differences of long reads over short reads.
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015Torsten Seemann
An introduction to basic genomics bioinformatics concepts in 20 minutes for an audience of clinicians, epidemiologists and other public health officials.
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Torsten Seemann
Using Snippy to call variants in bacterial short read datasets via alignment to reference, and then using these alignments to produce core SNP alignments for phylogenomics.
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
Torsten Seemann discussed bioinformatic tools for diagnostic laboratories using whole genome sequencing (WGS). He explained that WGS generates large amounts of sequencing reads that can be assembled de novo or aligned to references to identify single nucleotide polymorphisms (SNPs) and characterize genomes. Key applications of WGS include diagnostic identification, antimicrobial resistance profiling, virulence factor detection, and high-resolution epidemiological typing through SNP analysis and phylogenetic trees. Seemann emphasized that WGS analysis requires metadata, domain expertise, and open data sharing for maximum public health benefit.
1) The document discusses comparing bacterial isolates using whole genome sequencing and bioinformatics techniques.
2) Key steps include isolating bacteria from samples, sequencing their genomes, performing de novo assembly and annotation, and clustering homologous genes to determine the pan-genome and core genome.
3) Comparing single nucleotide polymorphisms (SNPs) in the core genome allows construction of phylogenetic trees to infer relationships between isolates.
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Torsten Seemann
This document summarizes a presentation about transitioning a public health microbiology laboratory from traditional bacterial typing methods like PFGE to whole genome sequencing (WGS) and bioinformatics. Key points include:
1) WGS allows for higher resolution analysis of bacterial isolates compared to traditional methods and can identify genomic variations, plasmids, and resistance/virulence genes.
2) Implementing WGS requires developing automated pipelines for processing large volumes of sequencing data using techniques like read mapping, de novo assembly, and k-mer analysis.
3) The goals are to modernize operations, increase research output, and develop shared online systems and data sharing between laboratories internationally.
This document summarizes a presentation on using whole genome sequencing (WGS) for rapid characterization of bacterial outbreaks. The presenter discusses transitioning public health labs from traditional typing methods to WGS-based approaches. Key points include developing automated analysis pipelines to identify bacteria, determine antimicrobial resistance and virulence genes, and construct phylogenomic trees from core genome SNPs. The goal is a cloud-based system allowing labs to securely upload and analyze sequencing data with open source tools integrated in modular pipelines.
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Torsten Seemann
Long read sequencing - the good, the bad, and the really cool. Covers Illumina SLR, Pacbio RSII and Oxford Nanopore as of June 2015. Discusses bioinformatics differences of long reads over short reads.
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015Torsten Seemann
An introduction to basic genomics bioinformatics concepts in 20 minutes for an audience of clinicians, epidemiologists and other public health officials.
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Torsten Seemann
Using Snippy to call variants in bacterial short read datasets via alignment to reference, and then using these alignments to produce core SNP alignments for phylogenomics.
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
Torsten Seemann discussed bioinformatic tools for diagnostic laboratories using whole genome sequencing (WGS). He explained that WGS generates large amounts of sequencing reads that can be assembled de novo or aligned to references to identify single nucleotide polymorphisms (SNPs) and characterize genomes. Key applications of WGS include diagnostic identification, antimicrobial resistance profiling, virulence factor detection, and high-resolution epidemiological typing through SNP analysis and phylogenetic trees. Seemann emphasized that WGS analysis requires metadata, domain expertise, and open data sharing for maximum public health benefit.
1) The document discusses comparing bacterial isolates using whole genome sequencing and bioinformatics techniques.
2) Key steps include isolating bacteria from samples, sequencing their genomes, performing de novo assembly and annotation, and clustering homologous genes to determine the pan-genome and core genome.
3) Comparing single nucleotide polymorphisms (SNPs) in the core genome allows construction of phylogenetic trees to infer relationships between isolates.
Rapid automatic microbial genome annotation using Prokka
Dr Torsten Seemann presents on Prokka, a tool he developed for rapid automatic annotation of microbial genomes. Prokka uses existing gene prediction tools like Prodigal and Infernal along with database searches to identify features like protein coding genes, tRNAs, and rRNAs. Prokka aims to annotate genomes quickly in under 15 minutes while providing standardized GFF3 and Genbank output files along with provenance on the sources of annotations. Prokka has been used to annotate over 50,000 draft genomes and is an ongoing project aimed at improving accuracy, modularity, and performance.
Long read sequencing - LSCC lab talk - fri 5 june 2015Torsten Seemann
Long read sequencing technologies such as Pacific Biosciences and Oxford Nanopore offer several advantages over short read technologies. They can generate reads of over 100kb which allows for untangling of repeats and completion of genomes and phasing of haplotypes. While PacBio is more established, Nanopore offers the potential for real-time, portable sequencing. Both require adaptation of bioinformatics tools and analysis approaches. The new technologies will change genomics jobs by moving more to streaming analysis and requiring skills in adapting to changing technologies.
The document discusses three main problems with de novo assembly of next generation sequencing data and proposes solutions. The three problems are 1) large memory and compute requirements for assembly, 2) complexity of the assembly process and lack of standardized protocols, and 3) limited training opportunities that are difficult for students. The proposed solutions are standardized assembly protocols called khmer-protocols that provide copy-paste workflows for mRNAseq and metagenome assembly using techniques like digital normalization to reduce memory usage and make assembly scalable. The khmer-protocols are designed to be open, versioned, and reproducible to generate initial assembly results cheaply and easily in the cloud.
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
How genomics is changing the practice of public health microbiology. The role of whole genome sequencing as the "one true assay". Another powerful tool for the epidemiologist.
This document provides an overview of next generation sequencing (NGS) for cancer genomics. It discusses how NGS allows sequencing of whole genomes or targeted regions to identify genetic changes between normal and tumor DNA. Analysis involves aligning DNA reads to reference genomes, detecting mutations, and categorizing them as silent, non-silent, oncogenic drivers, or signatures of mutational processes. RNA sequencing can also profile gene expression and detect fusion genes. The data requires specialized bioinformatics analysis to interpret genetic changes driving cancer.
ASM Microbe 2017: Reaching the Parts Other Methods Can't: Long Reads for Micr...Nick Loman
Long read sequencing technologies allow for complete microbial genome reconstruction from metagenomic samples. Single molecule long reads from PacBio and nanopore provide contigs but have high error rates. Synthetic long reads from 10X Genomics and other linked read methods generate more accurate scaffolds. While high DNA input requirements and extraction challenges remain, long reads are promising for de novo assembly, structural variation detection, and resolving complex populations without cultivation.
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...Joseph Hughes
11th OIE Seminar at the XVII INTERNATIONAL SYMPOSIUM OF THE WORLD ASSOCIATION OF VETERINARY LABORATORY DIAGNOSTICIANS (WAVLD)
Saskatoon - 17th June 2015
This document summarizes bioinformatics tools that can be used for analysis of high-throughput sequencing data for molecular diagnostics. It discusses databases for virulence factors and antimicrobial resistance as well as tools for assembly, annotation, pan-genome analysis, visualization, and commercial solutions. The presentation emphasizes that there is no single best tool and different approaches are needed for different questions. Collaboration with other researchers is recommended.
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun SequencesSurya Saha
Presented at Cornell Symbiosis symposium. Workflow for processing amplicon based 16S/ITS sequences as well as whole genome shotgun sequences are described. Slides include short description and links for each tool.
DISCLAIMER: This is a small subset of tools out there. No disrespect to methods not mentioned.
This document provides an introduction and overview of next-generation sequencing (NGS) data analysis. It discusses the bioinformatics challenges posed by large NGS datasets, including the need for powerful computing infrastructure and data storage. The document outlines common NGS data analysis workflows and applications, such as quality control, metagenomics, de novo assembly, amplicon analysis and variant detection. It also compares different NGS platforms and provides examples of software tools used in NGS data analysis.
Microbiome studies using 16S ribosomal DNA PCR: some cautionary tales.jennomics
Presentation at a workshop conducted by the UC Davis Bioinformatics Core Facility: Using the Linux Command Line for Analysis of High Throughput Sequence Data, September 15-19, 2014
This document provides information about using whole genome sequencing (WGS) for microbial typing and epidemiology. It discusses using WGS for high-resolution strain discrimination and detection of antibiotic resistance and virulence genes. The ideal scenario is a method that can recover all current sequence-based typing information from a single experimental procedure. The document outlines various bioinformatics tools and approaches for WGS analysis including assembly, mapping, annotation, comparison and specialized databases. It emphasizes choosing analysis based on research questions. Gene-by-gene approaches are favored for their ability to classify strains while accounting for recombination. The document lists collaborators and proposes topics for a scientific program on genome-based microbial epidemiology.
Phylogenomic methods for comparative evolutionary biology - University Colleg...Joe Parker
This document outlines Joe Parker's research interests in phylogenomics and high-throughput comparative genomics at Queen Mary University London. It discusses why phylogenomics is important, provides examples of past studies, and describes the lab's workflow and tools for sequencing, assembly, alignment, phylogeny inference, and phylogenetic analysis. It also presents a case study on detecting genome-wide convergence and discusses future directions including environmental metagenomics, cloud computing models, and real-time phylogenetics.
The document discusses marker-assisted breeding and the services provided by the Sequencing and Genotyping Platform. It outlines the steps in marker-assisted selection, from laying out seedlings and collecting samples to running analyses. It also lists the facilities and equipment available, including robotic platforms for liquid handling and DNA/RNA extraction, real-time PCR systems, capillary sequencers, and Illumina platforms for high-throughput genotyping. The platform provides support for marker-assisted breeding programs through services like whole genome sequencing, targeted resequencing, and protocol development for next-generation sequencing applications.
Knowing Your NGS Upstream: Alignment and VariantsGolden Helix Inc
Alignment algorithms are not just about placing reads in best-matching locations to a reference genome. They are now being expected to handle small insertions, deletions, gapped alignment of reads across intron boundaries and even span breakpoints of structural variations, fusions and copy number changes. At the same time, variant-calling algorithms can only reach their full potential by being intimately matched to the aligner's output or by doing local assemblies themselves. Knowing when these tools can be expected to perform well and when they will produce technical artifacts or be incapable of detecting features is critical when interpreting any analysis based on their output.
This presentation will compare the performance of the alignment and variant calling tools used by sequencing service providers including Illumina Genome Network, Complete Genomics and The Broad Institute. Using public samples analyzed by each pipeline, we will look at the level of concordance and dive into investigating problematic variants and regions of the genome.
Thoughts on the recent announcements by Oxford Nanopore TechnologiesKeith Bradnam
This document summarizes a presentation about announcements from Oxford Nanopore Technologies at the Advances in Genome Biology & Technology meeting. Oxford Nanopore unveiled two new sequencing devices - the desktop-sized GridION and the palm-sized MinION sequencer, which resembles a USB stick. Both devices use nanopore sequencing to directly sequence DNA or RNA in real-time without the need for sample preparation. This technology could potentially sequence an entire human genome in 15 minutes. Oxford Nanopore is aiming for increased sequencing accuracy and lower costs with these portable, easy-to-use sequencers.
Next generation sequencing: research opportunities and bioinformatic challenges. A seminar I gave for the Computational Life Science (Univ. of Oslo) seminar series, March 2, 2011
The document discusses the increasing role of PCR in medical diagnostics. It begins by explaining what PCR is and how it works to amplify DNA segments. It then describes the three main uses of PCR in clinical settings: 1) to detect genetic mutations, 2) to detect microbial genes in samples, and 3) to amplify human DNA from limited samples. The rest of the document provides examples of how PCR has improved the diagnosis of genetic diseases and infections compared to previous methods. It concludes that while PCR has limitations, it has proven more sensitive than gold standard tests in many cases by overcoming barriers of other diagnostic techniques.
Genomic epidemiology uses whole genome sequencing data from pathogens combined with epidemiological investigations to track the spread of infectious diseases. The document discusses making genomic epidemiology a widespread reality in public health. It outlines key requirements including building a user-friendly analysis platform, developing portable analysis pipelines, providing training to public health personnel, and improving information sharing between organizations.
Rapid automatic microbial genome annotation using Prokka
Dr Torsten Seemann presents on Prokka, a tool he developed for rapid automatic annotation of microbial genomes. Prokka uses existing gene prediction tools like Prodigal and Infernal along with database searches to identify features like protein coding genes, tRNAs, and rRNAs. Prokka aims to annotate genomes quickly in under 15 minutes while providing standardized GFF3 and Genbank output files along with provenance on the sources of annotations. Prokka has been used to annotate over 50,000 draft genomes and is an ongoing project aimed at improving accuracy, modularity, and performance.
Long read sequencing - LSCC lab talk - fri 5 june 2015Torsten Seemann
Long read sequencing technologies such as Pacific Biosciences and Oxford Nanopore offer several advantages over short read technologies. They can generate reads of over 100kb which allows for untangling of repeats and completion of genomes and phasing of haplotypes. While PacBio is more established, Nanopore offers the potential for real-time, portable sequencing. Both require adaptation of bioinformatics tools and analysis approaches. The new technologies will change genomics jobs by moving more to streaming analysis and requiring skills in adapting to changing technologies.
The document discusses three main problems with de novo assembly of next generation sequencing data and proposes solutions. The three problems are 1) large memory and compute requirements for assembly, 2) complexity of the assembly process and lack of standardized protocols, and 3) limited training opportunities that are difficult for students. The proposed solutions are standardized assembly protocols called khmer-protocols that provide copy-paste workflows for mRNAseq and metagenome assembly using techniques like digital normalization to reduce memory usage and make assembly scalable. The khmer-protocols are designed to be open, versioned, and reproducible to generate initial assembly results cheaply and easily in the cloud.
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
How genomics is changing the practice of public health microbiology. The role of whole genome sequencing as the "one true assay". Another powerful tool for the epidemiologist.
This document provides an overview of next generation sequencing (NGS) for cancer genomics. It discusses how NGS allows sequencing of whole genomes or targeted regions to identify genetic changes between normal and tumor DNA. Analysis involves aligning DNA reads to reference genomes, detecting mutations, and categorizing them as silent, non-silent, oncogenic drivers, or signatures of mutational processes. RNA sequencing can also profile gene expression and detect fusion genes. The data requires specialized bioinformatics analysis to interpret genetic changes driving cancer.
ASM Microbe 2017: Reaching the Parts Other Methods Can't: Long Reads for Micr...Nick Loman
Long read sequencing technologies allow for complete microbial genome reconstruction from metagenomic samples. Single molecule long reads from PacBio and nanopore provide contigs but have high error rates. Synthetic long reads from 10X Genomics and other linked read methods generate more accurate scaffolds. While high DNA input requirements and extraction challenges remain, long reads are promising for de novo assembly, structural variation detection, and resolving complex populations without cultivation.
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...Joseph Hughes
11th OIE Seminar at the XVII INTERNATIONAL SYMPOSIUM OF THE WORLD ASSOCIATION OF VETERINARY LABORATORY DIAGNOSTICIANS (WAVLD)
Saskatoon - 17th June 2015
This document summarizes bioinformatics tools that can be used for analysis of high-throughput sequencing data for molecular diagnostics. It discusses databases for virulence factors and antimicrobial resistance as well as tools for assembly, annotation, pan-genome analysis, visualization, and commercial solutions. The presentation emphasizes that there is no single best tool and different approaches are needed for different questions. Collaboration with other researchers is recommended.
Tools for Metagenomics with 16S/ITS and Whole Genome Shotgun SequencesSurya Saha
Presented at Cornell Symbiosis symposium. Workflow for processing amplicon based 16S/ITS sequences as well as whole genome shotgun sequences are described. Slides include short description and links for each tool.
DISCLAIMER: This is a small subset of tools out there. No disrespect to methods not mentioned.
This document provides an introduction and overview of next-generation sequencing (NGS) data analysis. It discusses the bioinformatics challenges posed by large NGS datasets, including the need for powerful computing infrastructure and data storage. The document outlines common NGS data analysis workflows and applications, such as quality control, metagenomics, de novo assembly, amplicon analysis and variant detection. It also compares different NGS platforms and provides examples of software tools used in NGS data analysis.
Microbiome studies using 16S ribosomal DNA PCR: some cautionary tales.jennomics
Presentation at a workshop conducted by the UC Davis Bioinformatics Core Facility: Using the Linux Command Line for Analysis of High Throughput Sequence Data, September 15-19, 2014
This document provides information about using whole genome sequencing (WGS) for microbial typing and epidemiology. It discusses using WGS for high-resolution strain discrimination and detection of antibiotic resistance and virulence genes. The ideal scenario is a method that can recover all current sequence-based typing information from a single experimental procedure. The document outlines various bioinformatics tools and approaches for WGS analysis including assembly, mapping, annotation, comparison and specialized databases. It emphasizes choosing analysis based on research questions. Gene-by-gene approaches are favored for their ability to classify strains while accounting for recombination. The document lists collaborators and proposes topics for a scientific program on genome-based microbial epidemiology.
Phylogenomic methods for comparative evolutionary biology - University Colleg...Joe Parker
This document outlines Joe Parker's research interests in phylogenomics and high-throughput comparative genomics at Queen Mary University London. It discusses why phylogenomics is important, provides examples of past studies, and describes the lab's workflow and tools for sequencing, assembly, alignment, phylogeny inference, and phylogenetic analysis. It also presents a case study on detecting genome-wide convergence and discusses future directions including environmental metagenomics, cloud computing models, and real-time phylogenetics.
The document discusses marker-assisted breeding and the services provided by the Sequencing and Genotyping Platform. It outlines the steps in marker-assisted selection, from laying out seedlings and collecting samples to running analyses. It also lists the facilities and equipment available, including robotic platforms for liquid handling and DNA/RNA extraction, real-time PCR systems, capillary sequencers, and Illumina platforms for high-throughput genotyping. The platform provides support for marker-assisted breeding programs through services like whole genome sequencing, targeted resequencing, and protocol development for next-generation sequencing applications.
Knowing Your NGS Upstream: Alignment and VariantsGolden Helix Inc
Alignment algorithms are not just about placing reads in best-matching locations to a reference genome. They are now being expected to handle small insertions, deletions, gapped alignment of reads across intron boundaries and even span breakpoints of structural variations, fusions and copy number changes. At the same time, variant-calling algorithms can only reach their full potential by being intimately matched to the aligner's output or by doing local assemblies themselves. Knowing when these tools can be expected to perform well and when they will produce technical artifacts or be incapable of detecting features is critical when interpreting any analysis based on their output.
This presentation will compare the performance of the alignment and variant calling tools used by sequencing service providers including Illumina Genome Network, Complete Genomics and The Broad Institute. Using public samples analyzed by each pipeline, we will look at the level of concordance and dive into investigating problematic variants and regions of the genome.
Thoughts on the recent announcements by Oxford Nanopore TechnologiesKeith Bradnam
This document summarizes a presentation about announcements from Oxford Nanopore Technologies at the Advances in Genome Biology & Technology meeting. Oxford Nanopore unveiled two new sequencing devices - the desktop-sized GridION and the palm-sized MinION sequencer, which resembles a USB stick. Both devices use nanopore sequencing to directly sequence DNA or RNA in real-time without the need for sample preparation. This technology could potentially sequence an entire human genome in 15 minutes. Oxford Nanopore is aiming for increased sequencing accuracy and lower costs with these portable, easy-to-use sequencers.
Next generation sequencing: research opportunities and bioinformatic challenges. A seminar I gave for the Computational Life Science (Univ. of Oslo) seminar series, March 2, 2011
The document discusses the increasing role of PCR in medical diagnostics. It begins by explaining what PCR is and how it works to amplify DNA segments. It then describes the three main uses of PCR in clinical settings: 1) to detect genetic mutations, 2) to detect microbial genes in samples, and 3) to amplify human DNA from limited samples. The rest of the document provides examples of how PCR has improved the diagnosis of genetic diseases and infections compared to previous methods. It concludes that while PCR has limitations, it has proven more sensitive than gold standard tests in many cases by overcoming barriers of other diagnostic techniques.
Genomic epidemiology uses whole genome sequencing data from pathogens combined with epidemiological investigations to track the spread of infectious diseases. The document discusses making genomic epidemiology a widespread reality in public health. It outlines key requirements including building a user-friendly analysis platform, developing portable analysis pipelines, providing training to public health personnel, and improving information sharing between organizations.
How Can We Make Genomic Epidemiology a Widespread Reality? - William HsiaoWilliam Hsiao
The document discusses genomic epidemiology and the requirements to bring genomic sequencing into routine public health practice. It outlines two parts: (1) what genomic epidemiology is and why it is important; and (2) the requirements for genomic sequencing to be used routinely in public health. Whole genome sequencing is seen as a way to generate high quality pathogen genomes quickly and allow for more detailed tracking of disease spread compared to traditional methods. However, bringing genomic sequencing into public health practice requires overcoming barriers such as the need for user-friendly analysis platforms, training public health personnel in genomics, and improving information sharing between organizations.
Viral metagenomics is the study of viral genetic material sourced directly from the environment rather than from a host or natural reservoir. The goal is to ascertain the viral diversity in the environment that is often missed in studies targeting specific potential reservoirs.
Interpreting genomic variation and phylogenetic trees to understand disease t...Jennifer Gardy
The document discusses using genomic sequencing data and phylogenetic trees to understand disease transmission. It provides an example of using whole genome sequencing to determine that multiple tuberculosis isolates showing identical molecular typing patterns were the result of laboratory contamination rather than transmission. The importance of high quality sequencing data and appropriate bioinformatics analysis is emphasized. Methods for manually inferring transmission by examining mutation patterns in isolates in the context of epidemiological data are described. Mathematical approaches that use phylogenetic trees to probabilistically infer transmission are also discussed.
Developing tools & Methodologies for the NExt Generation of Genomics & Bio In...Intel IT Center
This document discusses computational challenges in analyzing next generation DNA sequencing data and implications for diagnostics and therapeutics. It notes that sequencing one genome now takes just a few days but analysis is the bottleneck. The author's organization, Genomeon, has developed a high performance computing system called SHADOWFAX to analyze over 7,700 genomes. Genomeon is focusing on analyzing repetitive DNA sequences called microsatellites that were previously understudied. They have identified patterns of informative microsatellites that differentiate cancer types like breast cancer from healthy genomes with high sensitivity and specificity. These findings could enable new cancer risk assessment, companion diagnostics, clinical trial stratification, drug targets, and non-cancer applications.
Lab-on-a-Chip for cancer diagnostics and monitoringstanislas547
This document discusses lab-on-a-chip technology for cancer diagnostics and monitoring. It describes how lab-on-a-chip allows miniaturization of diagnostic tools to fit on a small chip. Examples are given of chips that can detect cancer markers from small samples of blood or other bodily fluids. The document outlines how lab-on-a-chip could provide frequent, non-invasive monitoring of cancer markers to guide treatment and detect recurrence. However, challenges remain in developing control units and integrating all necessary functions like fluid handling and molecular analysis onto a single chip.
Molecular genetics is the study of DNA structure, replication, and influence on organisms. Techniques of molecular genetics include gene therapy, amplification, polymerase chain reaction (PCR), cell culture, DNA cloning in bacteria, gel electrophoresis, and isolation of DNA. Gene therapy is an experimental technique that uses genes to treat or prevent disease. PCR amplifies a segment of DNA, allowing scientists to study small samples. Cell culture provides model systems to study cell physiology. DNA cloning makes copies of DNA fragments in bacteria. Gel electrophoresis separates DNA fragments by size. Isolation of DNA extracts free DNA molecules for further analysis. These techniques have applications in medicine, research, forensics, and molecular biology.
The Center of Excellence in Cancer Research (CECR) was established in June 2013 at Tanta University Educational Hospital in Egypt. It is directed by Dr. Mohamed L. Salem and focuses on correlating immunologic and clinical data from genomic, transcriptomic, and proteomic profiling of circulating and primary tumor cells. The CECR has facilities for flow cytometry, cell sorting, microarrays, and Luminex technology. Its research team studies cancer immunology and diagnosis.
Whole genome sequencing is a process that determines the complete DNA sequence of an organism. It involves reading the order of nucleotide bases in DNA to get a comprehensive view of the genetic makeup. The key steps are sample collection, DNA extraction, library preparation, sequencing, and data analysis. Technologies like Sanger, next-generation, and third-generation sequencing are used. Whole genome sequencing has applications in medical research, precision medicine, agriculture, forensics, and evolutionary studies. However, it faces challenges related to cost, data analysis, and ethical concerns.
Overcoming the challenges of molecular diagnostics in government health insti...Yakubu Sunday Bot
overcoming the challenges of molecular diagnostics in government owned health institution in nigeria.Several challenges abound in the Nigerian health sector ranging from financial,political and lack of commitment.Its obvious and no wonder the state of health care deliveryy, vis a vis its quality of care to its citizenry.
2nd Epigenetics Discovery congress - Latest agendaTony Couch
Advancements in Epigenetics have certainly given us huge breakthroughs in drug discovery, development and effective diagnosis of diseases. Scientists are working towards making new developments and address challenges in epigenetics for cancer, neurodegenerative diseases and other ailments. The Epigenetics Discovery Congress will provide a platform to such scientists to present their work, learn what their peers are doing, share experiences and overcome challenges that the industry is facing.....
2nd Epigenetics Discovery Congress - Latest agendaTony Couch
The 2nd Annual Epigenetics Discovery Congress will take place September 8-9, 2016 in London. The conference will explore the potential of epigenetics in novel and existing therapeutics. It will focus on emerging trends in drug discovery, including evolving targets, inhibitors, biomarkers and clinical success across diseases. Over two days, speakers will discuss topics such as epigenetic regulation, environmental impacts, translational challenges, clinical biomarkers, cancer, neurodevelopment, and new inhibitor scaffolds. The goal is to provide a platform for researchers and industry to network, showcase discoveries, and discuss advances in the application of epigenetics to drug development.
whole genome analysis
history
needs
steps involved
human genome data
NGS
pyrosequencing
illumina
SOLiD
Ion torrent
PacBio
applications
problems
benefits
Comparative proteogenomics using mass spectrometry data from multiple genomes can address problems that a single genome approach cannot. It helps identify rare post-translational modifications, resolve "one-hit wonders" by looking for correlated peptides in orthologous proteins across species, and identify programmed frameshifts and sequencing errors. The approach is demonstrated through an analysis of mass spectrometry data from three Shewanella bacteria genomes, improving gene predictions and annotations compared to existing tools.
Clinical Validation of Copy Number Variant Detection by Next-Generation Seque...Golden Helix
Despite the great advances achieved in clinical genetics thanks to the incorporation of NGS (Next Generation Sequencing), a significant percentage of patients with diseases of genetic origin still do not have a conclusive molecular diagnosis. The incorporation of state-of-the-art bioinformatic methods has allowed the implementation of CNVs (Copy Number Variants) detection in NGS analysis, improving its diagnostic efficiency. In this study, the clinical utility of the detection of CNVs by NGS has been proven.
During 2018, 275 patients were studied using the NGS technique without obtaining an accurate genetic diagnosis. Bioinformatic tools that compare the normalized sequencing depth between patients and controls were used to determine CNVs. The results obtained were compared with patients own laboratory database and controls to rule out polymorphisms and false positives. All causal CNVs were confirmed by MLPA.
Pathogenic CNVs causing the disease were detected in 11 of the 275 patients (4%). Specifically, CNVs were detected for pathologies with autosomal dominant inheritance patterns (TSC2, MSH2, and FBN1), as well as for genes with autosomal recessive inheritance patterns, including two homozygous deletions (KCNV2 and RDX) and one heterozygous deletion with an SNV (Single Nucleotide Variant) in the PKHD1 gene. One of the most notable cases corresponds to a patient suspected of hypomagnesemia in which two deletions were identified in compound heterozygous mutation in the TRPM6 gene.
Beating Bugs with Big Data: Harnessing HPC to Realize the Potential of Genomi...Tom Connor
Introducing the HPC challenges associated with developing a set of clinical microbial genomics services in the NHS in Wales. Demonstrating the potential of these technologies, and the impact it is already having for the patients of the Welsh NHS.
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...nist-spin
"Next Generation Sequencing for Identification and Subtyping of Foodborne Pathogens" presentation at the Standards for Pathogen Identification via NGS (SPIN) workshop hosted by National Institute for Standards and Technology October 2014 by Rebecca Lindsey, PhD from Enteric Diseases Laboratory Branch of the CDC.
NGS in Clinical Research: Meet the NGS Experts Series Part 1QIAGEN
Next generation sequencing has revolutionized clinical testing but has also created novel challenges. This presentation will give an overview of state of the art clinical NGS and discuss validation, clinical implementation as well as the migration from gene panels to exome sequencing for inherited disorders with clinical and genetic heterogeneity. In addition, important shortcomings such as difficulties with regions of high sequence homology will be discussed.
Personalized Medicine Through Tumor SequencingGolden Helix
One of the main recent advances in cancer therapy is the identification of medications that target specific gene mutations. In 2001 Gleevec was approved to treat patients with the BCR-ABL fusion in chronic myelogenous leukemia (CML), but since then many more drugs have been developed. Currently, there are numerous ongoing trials to identify tumor drivers that can be attacked by a drug. In order to identify the mutations driving a tumor, the tumor needs to be sequenced. There are a range of different approaches for sequencing tumors ranging from the sequencing of a few genes in the tumor up to paired whole-exome sequencing in both the tumor and adjacent normal tissue. Each type of sequencing has benefits and drawbacks and a balance needs to be made between cost and usability of the results. We have developed a clinical workflow for a 50 gene panel that identifies mutations in hotspots in known cancer genes. This workflow uses BaseSpace, VarSeq and N-Of-One to provide insight for our physicians and patients.
Similar to Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA - mon 24 aug 2015 (20)
How to write bioinformatics software no one will useTorsten Seemann
This document provides guidance on how to write bioinformatics software that others will find useful. It recommends choosing a descriptive name, keeping documentation and installation simple, following standards for command line interfaces and file formats, publishing the software on repositories, and supporting users through updates, documentation, and issue tracking. The document concludes by discussing the presenter's work on various bioinformatics tools, including improvements planned.
Snippy is a command line tool for rapidly calling bacterial variants and performing core genome alignments from sequencing data. It runs quickly using multiple CPU cores and produces standard output files like VCF, BAM, and TXT. Snippy can also combine results from multiple runs into a phylogenetic tree of aligned sequences.
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...Torsten Seemann
This document discusses de novo genome assembly, which is the process of reconstructing long genomic sequences from many short sequencing reads without the aid of a reference genome. It is challenging due to factors like short read lengths, repetitive sequences that complicate the assembly graph, and sequencing errors. The goals of assembly are to produce contiguous sequences with high completeness and correctness by resolving overlaps between reads into consensus sequences. Metrics like N50, core gene content, and read remapping are used to assess assembly quality.
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...Torsten Seemann
This talk introduces a Linux Professional audience to bacterial genomics and modern sequencing technology. The title is slightly misleading and is a bit of clickbait. The diagrams are good.
De novo genome assembly - IMB Winter School - 7 July 2015Torsten Seemann
This document discusses de novo genome assembly, which is the process of reconstructing the original DNA sequence from short fragment reads alone. Due to limitations in sequencing technology, the DNA must be broken into short reads which must then be reassembled like a jigsaw puzzle. Challenges include sequencing errors, repeats, and heterozygosity. Various algorithms and techniques are used to assemble the reads, including overlap layout consensus and de Bruijn graphs. Long read technologies help resolve repeats and scaffold contigs. Software recommendations for de novo assembly include SPAdes, Velvet, and CLC Genomics Workbench.
Why and how to clean Illumina genome sequencing reads. Includes illustrative examples, and a case where a project was saved by using Nesoni clip: to discover the cause of non-mapping reads.
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Torsten Seemann
Invited talk at the Australian Society for Microbiology Annual Conference 2014 on "FriPan" our tool for visualizing bacterial pan genomes across 10-100s of isolates.
A presentation to a lay audience at Melbourne Knowledge Week on how bacteria are a part of our life and what we are doing with genomics to manage them.
Assembling NGS Data - IMB Winter School - 3 July 2012Torsten Seemann
This document discusses assembling next-generation sequencing (NGS) data using de novo assembly. De novo assembly involves reconstructing original DNA sequences from short fragment read sequences without a reference genome. It involves finding overlaps between reads and tracing paths in a graph representation while dealing with sequencing errors and repeats. The document outlines the assembly process including finding overlaps, building graphs, simplifying graphs, traversing graphs, and assessing assemblies. It provides examples of tools used for genome, metagenome, transcriptome, and metatranscriptome assembly including Velvet, Abyss, and Trinity.
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...Torsten Seemann
I describe the three levels of parallelism that can be exploited in bioinformatics software (1) clusters of multiple computers; (2) multiple cores on each computer; and (3) vector machine code instructions.
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...Sérgio Sacani
Context. With a mass exceeding several 104 M⊙ and a rich and dense population of massive stars, supermassive young star clusters
represent the most massive star-forming environment that is dominated by the feedback from massive stars and gravitational interactions
among stars.
Aims. In this paper we present the Extended Westerlund 1 and 2 Open Clusters Survey (EWOCS) project, which aims to investigate
the influence of the starburst environment on the formation of stars and planets, and on the evolution of both low and high mass stars.
The primary targets of this project are Westerlund 1 and 2, the closest supermassive star clusters to the Sun.
Methods. The project is based primarily on recent observations conducted with the Chandra and JWST observatories. Specifically,
the Chandra survey of Westerlund 1 consists of 36 new ACIS-I observations, nearly co-pointed, for a total exposure time of 1 Msec.
Additionally, we included 8 archival Chandra/ACIS-S observations. This paper presents the resulting catalog of X-ray sources within
and around Westerlund 1. Sources were detected by combining various existing methods, and photon extraction and source validation
were carried out using the ACIS-Extract software.
Results. The EWOCS X-ray catalog comprises 5963 validated sources out of the 9420 initially provided to ACIS-Extract, reaching a
photon flux threshold of approximately 2 × 10−8 photons cm−2
s
−1
. The X-ray sources exhibit a highly concentrated spatial distribution,
with 1075 sources located within the central 1 arcmin. We have successfully detected X-ray emissions from 126 out of the 166 known
massive stars of the cluster, and we have collected over 71 000 photons from the magnetar CXO J164710.20-455217.
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
The binding of cosmological structures by massless topological defectsSérgio Sacani
Assuming spherical symmetry and weak field, it is shown that if one solves the Poisson equation or the Einstein field
equations sourced by a topological defect, i.e. a singularity of a very specific form, the result is a localized gravitational
field capable of driving flat rotation (i.e. Keplerian circular orbits at a constant speed for all radii) of test masses on a thin
spherical shell without any underlying mass. Moreover, a large-scale structure which exploits this solution by assembling
concentrically a number of such topological defects can establish a flat stellar or galactic rotation curve, and can also deflect
light in the same manner as an equipotential (isothermal) sphere. Thus, the need for dark matter or modified gravity theory is
mitigated, at least in part.
Unlocking the mysteries of reproduction: Exploring fecundity and gonadosomati...AbdullaAlAsif1
The pygmy halfbeak Dermogenys colletei, is known for its viviparous nature, this presents an intriguing case of relatively low fecundity, raising questions about potential compensatory reproductive strategies employed by this species. Our study delves into the examination of fecundity and the Gonadosomatic Index (GSI) in the Pygmy Halfbeak, D. colletei (Meisner, 2001), an intriguing viviparous fish indigenous to Sarawak, Borneo. We hypothesize that the Pygmy halfbeak, D. colletei, may exhibit unique reproductive adaptations to offset its low fecundity, thus enhancing its survival and fitness. To address this, we conducted a comprehensive study utilizing 28 mature female specimens of D. colletei, carefully measuring fecundity and GSI to shed light on the reproductive adaptations of this species. Our findings reveal that D. colletei indeed exhibits low fecundity, with a mean of 16.76 ± 2.01, and a mean GSI of 12.83 ± 1.27, providing crucial insights into the reproductive mechanisms at play in this species. These results underscore the existence of unique reproductive strategies in D. colletei, enabling its adaptation and persistence in Borneo's diverse aquatic ecosystems, and call for further ecological research to elucidate these mechanisms. This study lends to a better understanding of viviparous fish in Borneo and contributes to the broader field of aquatic ecology, enhancing our knowledge of species adaptations to unique ecological challenges.
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/
When I was asked to give a companion lecture in support of ‘The Philosophy of Science’ (https://shorturl.at/4pUXz) I decided not to walk through the detail of the many methodologies in order of use. Instead, I chose to employ a long standing, and ongoing, scientific development as an exemplar. And so, I chose the ever evolving story of Thermodynamics as a scientific investigation at its best.
Conducted over a period of >200 years, Thermodynamics R&D, and application, benefitted from the highest levels of professionalism, collaboration, and technical thoroughness. New layers of application, methodology, and practice were made possible by the progressive advance of technology. In turn, this has seen measurement and modelling accuracy continually improved at a micro and macro level.
Perhaps most importantly, Thermodynamics rapidly became a primary tool in the advance of applied science/engineering/technology, spanning micro-tech, to aerospace and cosmology. I can think of no better a story to illustrate the breadth of scientific methodologies and applications at their best.
ESR spectroscopy in liquid food and beverages.pptxPRIYANKA PATEL
With increasing population, people need to rely on packaged food stuffs. Packaging of food materials requires the preservation of food. There are various methods for the treatment of food to preserve them and irradiation treatment of food is one of them. It is the most common and the most harmless method for the food preservation as it does not alter the necessary micronutrients of food materials. Although irradiated food doesn’t cause any harm to the human health but still the quality assessment of food is required to provide consumers with necessary information about the food. ESR spectroscopy is the most sophisticated way to investigate the quality of the food and the free radicals induced during the processing of the food. ESR spin trapping technique is useful for the detection of highly unstable radicals in the food. The antioxidant capability of liquid food and beverages in mainly performed by spin trapping technique.
Or: Beyond linear.
Abstract: Equivariant neural networks are neural networks that incorporate symmetries. The nonlinear activation functions in these networks result in interesting nonlinear equivariant maps between simple representations, and motivate the key player of this talk: piecewise linear representation theory.
Disclaimer: No one is perfect, so please mind that there might be mistakes and typos.
dtubbenhauer@gmail.com
Corrected slides: dtubbenhauer.com/talks.html
The technology uses reclaimed CO₂ as the dyeing medium in a closed loop process. When pressurized, CO₂ becomes supercritical (SC-CO₂). In this state CO₂ has a very high solvent power, allowing the dye to dissolve easily.
ESPP presentation to EU Waste Water Network, 4th June 2024 “EU policies driving nutrient removal and recycling
and the revised UWWTD (Urban Waste Water Treatment Directive)”
Phenomics assisted breeding in crop improvementIshaGoswami9
As the population is increasing and will reach about 9 billion upto 2050. Also due to climate change, it is difficult to meet the food requirement of such a large population. Facing the challenges presented by resource shortages, climate
change, and increasing global population, crop yield and quality need to be improved in a sustainable way over the coming decades. Genetic improvement by breeding is the best way to increase crop productivity. With the rapid progression of functional
genomics, an increasing number of crop genomes have been sequenced and dozens of genes influencing key agronomic traits have been identified. However, current genome sequence information has not been adequately exploited for understanding
the complex characteristics of multiple gene, owing to a lack of crop phenotypic data. Efficient, automatic, and accurate technologies and platforms that can capture phenotypic data that can
be linked to genomics information for crop improvement at all growth stages have become as important as genotyping. Thus,
high-throughput phenotyping has become the major bottleneck restricting crop breeding. Plant phenomics has been defined as the high-throughput, accurate acquisition and analysis of multi-dimensional phenotypes
during crop growing stages at the organism level, including the cell, tissue, organ, individual plant, plot, and field levels. With the rapid development of novel sensors, imaging technology,
and analysis methods, numerous infrastructure platforms have been developed for phenotyping.
Sharlene Leurig - Enabling Onsite Water Use with Net Zero Water
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA - mon 24 aug 2015
1. Approaches to analysing
1000s of bacterial isolates
A/Prof Torsten Seemann
Victorian Life Sciences Computation Initiative (VLSCI)
Microbiological Diagnostic Unit Public Health Laboratory (MDU PHL)
Doherty Centre for Applied Microbial Genomics (DCAMG)
The University of Melbourne
ICEID 2015 - Atlanta, USA - Mon 24 Aug 2015
5. Microbiological Diagnostic Unit
∷ Oldest public health lab in Australia
: established 1897 in Melbourne
: large historical isolate collection back to 1950s
∷ National reference laboratory
: Salmonella, Listeria, EHEC
∷ WHO regional reference lab
: vaccine preventable invasive bacterial pathogens
6. The shift to WGS
∷ New director
: Prof Ben Howden - clinician, microbiologist, pathologist
∷ New building
: Doherty Institute for Immunity and Infection
∷ Mandate
: modernise service delivery
: nationally lead the conversion to WGS
: enhance research output and collaboration
10. Does it deliver?
Yes!Bioinformatics Epidemiology
Technology
Microbiology
This means
scientists
not just software
Domain
expertise
Always changing...
19. Compare to already assembled genomes
AGTCTGATTAGCTTAGCTTGTAGCGCTATATTAT
AGTCTGATTAGCTTAGAT
ATTAGCTTAGATTGTAG
CTTAGATTGTAGC-C
TGATTAGCTTAGATTGTAGC-CTATAT
TAGCTTAGATTGTAGC-CTATATT
TAGATTGTAGC-CTATATTA
TAGATTGTAGC-CTATATTAT
SNP Deletion
Reference
Reads
20. Best practice
■ Use both approaches
□ reference-based + de novo
■ Best of both worlds
□ and worst of both worlds - interpretation is non-trivial
■ Still need
□ good epidemiology, metadata and domain knowledge!
23. New assays
∷ Species identification
: build a “signature” from k-mer/oligos in the reads
: compare to database of known signatures
: strain level accuracy
∷ Features
: very fast screening, < 1 minute per isolate
: identify contamination, mixed samples
: discover wrongly labelled samples!
25. Reference based analysis
∷ Implies you have a “close” reference
: need to be careful with draft genomes
∷ Very sensitive
: single mutation precision
∷ May not be complete
: ignores novel DNA in your isolate
29. Core
∷ Common DNA
∷ Vertical evolution
∷ Genotyping
∷ Phylogenetics
∷ Novel DNA
∷ Lateral transfer
∷ Plasmids
∷ Mobile elements
∷ Partly unexploited
Pan
32. Bioinformatics challenges
∷ Metagenomics
: avoiding the isolation bottleneck
∷ Incremental update of data analyses
: both core and pan genome
: phylogenetic trees
∷ Data distribution
: finding and getting appropriate comparator isolates
33. Open science
∷ Crowd-sourcing provably works
: EHEC outbreak 2011
: Ebola
: MERS
∷ But only if people share
: sequencing data
: metadata
: software source code for analysis