The document discusses olfactory receptors and compares the olfactory receptor gene OR4D11 between humans and chimpanzees. It finds that OR4D11 is a pseudogene in humans but intact in chimpanzees. It also summarizes the results of BLAST searches comparing the human and chimpanzee OR4D11 sequences and structures, finding them to be 96% similar. Phylogenetic analysis shows OR4D11 is conserved in other species like mice, dogs, and rats.
this ppt shares what synapses are and how information of one neuron is transmitted to other through the synapses. it also includes the properties and plasticity of synaptic transmission
olfactory system and functioning, pathway of olfaction, neural tract involved in olfaction , endocrine pathway of olfaction, cells and neurons involved in olfaction
this ppt shares what synapses are and how information of one neuron is transmitted to other through the synapses. it also includes the properties and plasticity of synaptic transmission
olfactory system and functioning, pathway of olfaction, neural tract involved in olfaction , endocrine pathway of olfaction, cells and neurons involved in olfaction
Chemoreceptors
Chemoreceptors or organs of chemical sense consist of olfactory organs and organs of taste. Both these organs are stimulated only by chemical substances or odours in air (nostrils) and in solution (tongue).
The medium for dissolving substances for taste is water for aquatic animals and mucus for land animals.
The olfactory organs can respond to a low concentration of the dissolved substance, whereas organs of taste need a higher concentration of the dissolved substance for a response.
Olfactory Organs in Vertebrates:
Odours bind to and activate olfactory receptors located on the dendrites of sensory neurons in the nose. Olfactory organs (olfactory-receptors) are a pair of invaginations of the ectodermal cells of the skin forming olfactory sacs on the anterior end of head.
Their external openings are called nostrils or nares.
In most fishes the olfactory organs consist of a pair of pits lined with folds or ridges of sensory epithelium.
The cyclostomes have a single median olfactory organ. This is a blind pit in the lampreys, but in hagfishes it opens into the pharynx.
Dipnoans resemble higher vertebrates in possessing paired nasal passages that open by means of choanae into pharynx. The nasal passages, therefore, have both internal and external openings. The olfactory epithelium within canals appears in the form of folds.
Sensory systems consist of peripheral receptor cells and integrating neurons in the brain.
Impulses are transmitted from receptors by sensory fibres to the central nervous system where they are interpreted as sensations or messages, which are sent to effector organs through efferent or motor nerve fibres, for responding in an appropriate manner.
A vertebrate has receptors or sense organs for touch, smell, taste, sight, and hearing, which are stimulated by the environment. These sense organs are termed external receptors or exteroceptors.
There are other sense organs found in the body, which detect temperature, pain, hunger, thirst, fatigue, and muscle position. They are spoken of as internal receptors or interoceptors.
Besides these two, third is proprioceptors, which are stretch receptors found in the muscles, joints, tendons, connective tissue and skeletons. All receptors are closely associated with the nervous system and respond to external or internal stimuli.
List of Common Senses:
1. Touch.- It includes contact, pressure, heat and cold, etc.
2. Taste. -Receive stimulus by chemicals in solution.
3. Smell.- Receive volatile chemicals and gases in air.
4. Hearing.- Receive sound vibrations.
5. Sight. -Receive light waves.
Smell and taste by Pandian M. Dept of Physiology, DYPMCKOP,MHPandian M
Describe the basic features of the neural elements in the olfactory epithelium and olfactory bulb.
Describe signal transduction in odorant receptors.
Outline the pathway by which impulses generated in the olfactory epithelium reach the olfactory cortex.
Describe the location and cellular composition of taste buds.
Name the five major taste receptors and signal transduction mechanisms in these receptors.
Outline the pathways by which impulses generated in taste receptors reach the insular cortex.
Direct Download Link ❤❤https://healthkura.com/antibacterial-agents/❤❤
Dear viewers Check Out my other piece of works at ❤❤❤ https://healthkura.com ❤❤❤
Antibacterial Agents/ antibiotics (Ocular Pharmacology)
PRESENTATION LAYOUT
Introduction to antimicrobial drugs
Classification of antimicrobial drugs
Antibacterial drugs:
- Classification
- Indications
- Side effects
Antibacterial Resistance
Antimicrobial drugs are chemotherapeutic drugs
Two categories: – Antibiotics : Antimicrobial drugs produced by microorganisms
– Synthetic drugs : Antimicrobial drugs synthesized in the lab
..............................................
For Further Reading
oTextbook of microbiology by Ananthanarayan & Paniker
o Essentials of Medical Pharmacology KD Tripathi
o Basic & Clinical Pharmacology by Bertram G. Katzung
o Ophthalmic Drugs by Graham Hopkins and Richard Pearson
o Internet
Chemoreceptors
Chemoreceptors or organs of chemical sense consist of olfactory organs and organs of taste. Both these organs are stimulated only by chemical substances or odours in air (nostrils) and in solution (tongue).
The medium for dissolving substances for taste is water for aquatic animals and mucus for land animals.
The olfactory organs can respond to a low concentration of the dissolved substance, whereas organs of taste need a higher concentration of the dissolved substance for a response.
Olfactory Organs in Vertebrates:
Odours bind to and activate olfactory receptors located on the dendrites of sensory neurons in the nose. Olfactory organs (olfactory-receptors) are a pair of invaginations of the ectodermal cells of the skin forming olfactory sacs on the anterior end of head.
Their external openings are called nostrils or nares.
In most fishes the olfactory organs consist of a pair of pits lined with folds or ridges of sensory epithelium.
The cyclostomes have a single median olfactory organ. This is a blind pit in the lampreys, but in hagfishes it opens into the pharynx.
Dipnoans resemble higher vertebrates in possessing paired nasal passages that open by means of choanae into pharynx. The nasal passages, therefore, have both internal and external openings. The olfactory epithelium within canals appears in the form of folds.
Sensory systems consist of peripheral receptor cells and integrating neurons in the brain.
Impulses are transmitted from receptors by sensory fibres to the central nervous system where they are interpreted as sensations or messages, which are sent to effector organs through efferent or motor nerve fibres, for responding in an appropriate manner.
A vertebrate has receptors or sense organs for touch, smell, taste, sight, and hearing, which are stimulated by the environment. These sense organs are termed external receptors or exteroceptors.
There are other sense organs found in the body, which detect temperature, pain, hunger, thirst, fatigue, and muscle position. They are spoken of as internal receptors or interoceptors.
Besides these two, third is proprioceptors, which are stretch receptors found in the muscles, joints, tendons, connective tissue and skeletons. All receptors are closely associated with the nervous system and respond to external or internal stimuli.
List of Common Senses:
1. Touch.- It includes contact, pressure, heat and cold, etc.
2. Taste. -Receive stimulus by chemicals in solution.
3. Smell.- Receive volatile chemicals and gases in air.
4. Hearing.- Receive sound vibrations.
5. Sight. -Receive light waves.
Smell and taste by Pandian M. Dept of Physiology, DYPMCKOP,MHPandian M
Describe the basic features of the neural elements in the olfactory epithelium and olfactory bulb.
Describe signal transduction in odorant receptors.
Outline the pathway by which impulses generated in the olfactory epithelium reach the olfactory cortex.
Describe the location and cellular composition of taste buds.
Name the five major taste receptors and signal transduction mechanisms in these receptors.
Outline the pathways by which impulses generated in taste receptors reach the insular cortex.
Direct Download Link ❤❤https://healthkura.com/antibacterial-agents/❤❤
Dear viewers Check Out my other piece of works at ❤❤❤ https://healthkura.com ❤❤❤
Antibacterial Agents/ antibiotics (Ocular Pharmacology)
PRESENTATION LAYOUT
Introduction to antimicrobial drugs
Classification of antimicrobial drugs
Antibacterial drugs:
- Classification
- Indications
- Side effects
Antibacterial Resistance
Antimicrobial drugs are chemotherapeutic drugs
Two categories: – Antibiotics : Antimicrobial drugs produced by microorganisms
– Synthetic drugs : Antimicrobial drugs synthesized in the lab
..............................................
For Further Reading
oTextbook of microbiology by Ananthanarayan & Paniker
o Essentials of Medical Pharmacology KD Tripathi
o Basic & Clinical Pharmacology by Bertram G. Katzung
o Ophthalmic Drugs by Graham Hopkins and Richard Pearson
o Internet
Comparative genomics in eukaryotes, organellesKAUSHAL SAHU
WHAT IS COMPARATIVE GENOMICS?
HISTORY
SOME RELATED TERMS
MINIMAL EUKARYOTIC GENOMES
COMPARISON OF THE MAJOR SEQUENCED GENOMES
EUKARYOTIC GENOMES
SACCHAROMYCES CEREVISIAE GENOME
INSECT GENOME
DROSOPHILA MELANOGASTER (FRUIT FLY) GENOME
COMPARATIVE ANALYSIS OF THE HUMAN AND MOUSE GENOME
COMPARATIVE GENOMICS OF ORGANELLES
COMPARATIVE GENOMICS TOOLS
CONCLUSION
REFERENCES
Domains of unknown function are essential in yeastLaura Berry
Presented in the Synthetic Biology & Gene Editing strand of the 4Bio Summit. For more information, visit:
www.global-engage.com
~25% of yeast essential domains of unknown function (yeDUFs) are broadly conserved across all kingdoms of life (including Bacteria), while a small number are found in large numbers of proteins in mammals. In this presentation, Norman Goodacre from the FDA discusses 68 yeDUFs and their roles in alternative carbohydrate metabolism, mitochondrial transport, nuclear pore complex, mRNA processing, initiation of translation, protein complex assembly, and membrane-binding.
This talk was given as a guest lecture in the undergraduate "Comparative Animal Physiology" course at the University of Texas at Austin. The talk has three parts: 1) a very brief personal introduciton about me and my thesis research, 2) an overview of some brain regions and genes that regulate social behaviors in birds, frogs, fish, reptiles, and mammals, 3) a discussion of a study looking at neuromolecular differences between closely related with with different mating systems.
Different Therapeutic Aspects of Peroxisomes Proliferator-Activated ReceptorsAI Publications
Peroxisome proliferator-activated receptors (PPARs) was discovered in 1990 belong to the super family of steroid hormone receptors. Three subtypes of PPAR which have been identified so far- PPARα, PPARβ/δ, and PPARγ. Human peroxisome proliferator-activated receptors (hPPARs) were initially recognized as therapeutic targets for the development of drugs to treat metabolic disorders, such as diabetes and dyslipidemia but now they have been used in energy burning, dyslipidemia, diabetes, inflammation, Hepatic steatosis, liver cancer, diabetic neuropathy, atherosclerosis also. These are included in management of NIDDM, macrophage differentiation, adipose differentiation , anti-cancer, inhibition of TH2 cytokine production and rheumatoid arthritis. PPARβ/δ can use to treat Huntington’s disease, fertility, dyslipidemia. The functions of a third PPAR isoform and its potential as a therapeutic target are currently under investigation.
Adv. biopharm. APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMSAkankshaAshtankar
MIP 201T & MPH 202T
ADVANCED BIOPHARMACEUTICS & PHARMACOKINETICS : UNIT 5
APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMS By - AKANKSHA ASHTANKAR
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
micro teaching on communication m.sc nursing.pdfAnurag Sharma
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Explore natural remedies for syphilis treatment in Singapore. Discover alternative therapies, herbal remedies, and lifestyle changes that may complement conventional treatments. Learn about holistic approaches to managing syphilis symptoms and supporting overall health.
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
CDSCO and Phamacovigilance {Regulatory body in India}NEHA GUPTA
The Central Drugs Standard Control Organization (CDSCO) is India's national regulatory body for pharmaceuticals and medical devices. Operating under the Directorate General of Health Services, Ministry of Health & Family Welfare, Government of India, the CDSCO is responsible for approving new drugs, conducting clinical trials, setting standards for drugs, controlling the quality of imported drugs, and coordinating the activities of State Drug Control Organizations by providing expert advice.
Pharmacovigilance, on the other hand, is the science and activities related to the detection, assessment, understanding, and prevention of adverse effects or any other drug-related problems. The primary aim of pharmacovigilance is to ensure the safety and efficacy of medicines, thereby protecting public health.
In India, pharmacovigilance activities are monitored by the Pharmacovigilance Programme of India (PvPI), which works closely with CDSCO to collect, analyze, and act upon data regarding adverse drug reactions (ADRs). Together, they play a critical role in ensuring that the benefits of drugs outweigh their risks, maintaining high standards of patient safety, and promoting the rational use of medicines.
Title: Sense of Taste
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the structure and function of taste buds.
Describe the relationship between the taste threshold and taste index of common substances.
Explain the chemical basis and signal transduction of taste perception for each type of primary taste sensation.
Recognize different abnormalities of taste perception and their causes.
Key Topics:
Significance of Taste Sensation:
Differentiation between pleasant and harmful food
Influence on behavior
Selection of food based on metabolic needs
Receptors of Taste:
Taste buds on the tongue
Influence of sense of smell, texture of food, and pain stimulation (e.g., by pepper)
Primary and Secondary Taste Sensations:
Primary taste sensations: Sweet, Sour, Salty, Bitter, Umami
Chemical basis and signal transduction mechanisms for each taste
Taste Threshold and Index:
Taste threshold values for Sweet (sucrose), Salty (NaCl), Sour (HCl), and Bitter (Quinine)
Taste index relationship: Inversely proportional to taste threshold
Taste Blindness:
Inability to taste certain substances, particularly thiourea compounds
Example: Phenylthiocarbamide
Structure and Function of Taste Buds:
Composition: Epithelial cells, Sustentacular/Supporting cells, Taste cells, Basal cells
Features: Taste pores, Taste hairs/microvilli, and Taste nerve fibers
Location of Taste Buds:
Found in papillae of the tongue (Fungiform, Circumvallate, Foliate)
Also present on the palate, tonsillar pillars, epiglottis, and proximal esophagus
Mechanism of Taste Stimulation:
Interaction of taste substances with receptors on microvilli
Signal transduction pathways for Umami, Sweet, Bitter, Sour, and Salty tastes
Taste Sensitivity and Adaptation:
Decrease in sensitivity with age
Rapid adaptation of taste sensation
Role of Saliva in Taste:
Dissolution of tastants to reach receptors
Washing away the stimulus
Taste Preferences and Aversions:
Mechanisms behind taste preference and aversion
Influence of receptors and neural pathways
Impact of Sensory Nerve Damage:
Degeneration of taste buds if the sensory nerve fiber is cut
Abnormalities of Taste Detection:
Conditions: Ageusia, Hypogeusia, Dysgeusia (parageusia)
Causes: Nerve damage, neurological disorders, infections, poor oral hygiene, adverse drug effects, deficiencies, aging, tobacco use, altered neurotransmitter levels
Neurotransmitters and Taste Threshold:
Effects of serotonin (5-HT) and norepinephrine (NE) on taste sensitivity
Supertasters:
25% of the population with heightened sensitivity to taste, especially bitterness
Increased number of fungiform papillae
The Gram stain is a fundamental technique in microbiology used to classify bacteria based on their cell wall structure. It provides a quick and simple method to distinguish between Gram-positive and Gram-negative bacteria, which have different susceptibilities to antibiotics
3. Receptors-
INTRODUCTION
Receptor is a molecule found on the surface of
a cell, which receives specific chemical signals from
neighboring cells.
A molecule which binds to a receptor is called
a ligand or other small molecule, such as
a neurotransmitter, a hormone, a pharmaceutical
drug, or a toxin.
Each kind of receptor can bind only certain ligand
shapes.
4. Olfactory receptors
• Olfactory receptors are responsible for the detection
of odor molecules.
• Olfactory receptors are type of G protein-coupled
receptors (GPCRs).
• In humans, but not in mice or dogs, the majority of
OR genes have become pseudogenes, suggesting that
OR genes in humans evolved than in other
mammals.
• To explore this further ,we compare OR gene of
humans with the genome of closest evolutionary
relative chimpanzee.
5.
6. Classification
Based on protein sequence similarity, mammalian OR genes
are divided into two classes, 17 families and ∼250
subfamilies .
When human or gene formed analysis was done by
searching the human genome database, we identified 339
intact OR genes and 297 OR pseudogenes.
Location
Olfactory epithelium is present at at the top of the nasal
cavity.
Each olfactory neuron in the epithelium has at least 10
hair-like cilia that protrude into a thin bath of mucus at the
cell surface.
Somewhere on these cilia, scientists were convinced,
there must be receptor proteins that recognize and bind
odorant molecules, thereby stimulating the cell to send
signals to the brain.
Discovery
In 2004 Linda B. Buck and Richard Axelwon the
7. OR4D11
Olfactory receptor, family 4,subfamily D, member 11
[ Homosapiens ][ Pseudogene]
Official Symbol-OR4D11 or OR4D11P
Official Full Name-Olfactory receptor, family 4, subfamily
D, member
Gene type-Protein coding
Organism-Homo sapiens
Lineage-Eukaryota, Metazoa,Chordata,
Craniata,Vertebrata,Euteleostomi,Mammalia,Eutheria,Euar
chontoglires,Primates,Haplorrhini,Catarrhini,Hominidae,H
omo.
Olfactory receptor 4D11 is a protein that in humans is
encoded by the 4D11 gene.
OR share a 7-transmembrane domain structure with many
neurotransmitter & hormone receptors & are responsible
for the recognisation & G-protein mediated transduction
8. LOCATION
Chromosome: 11;Location: 11q12.1
General Gene
information
Markers:OR4D11__6029 (e-PCR)
Homologs of the OR4D11 gene: The OR4D11 gene
is conserved in chimpanzee, dog, mouse, and rat.
Pathways
KEGG pathway: Olfactory transduction
9. Protein attributes
Sequence length
311 AA.
Sequence status
Complete.
Protein existence
Biological process
Cellular component
Evidence at transcript
level.
Olfaction
Sensory transduction
Gene information
Function
Odorant receptor
Subcellular location
Cell membrane; Multipass membrane protein
Sequence similarities
Belongs to the
G-protein coupled
receptor 1 family.
Cell membrane
Biological process
Coding sequence
diversity
Polymorphism
Domain
Transmembrane helix
Molecular function
G-protein coupled
receptor
Transducer
PTM
Technical term
Cellular component
Response to stimulus
Sensory perception
of smell
Integral to plasma
membrane
Disulfide bond
Glycoprotein
Complete proteome
Molecular function
Olfactory receptor
activity
10. Comparison of Chimpanzee &
Human Genome
•Scientists have found that humans are 96 percent
similar to the great ape species.
•Because chimpanzees are our closest relatives, it is
easy to understand human biology and evolution.
•The researchers have identified sequences of
genetic code that differ between human and chimp.
•These sequences may hold good for determining
what creates human-specific traits such as speech.
11. The no. of genetic differences between
humans and chimps is 10 times smaller
than that between mice and rats.
Scientists discovered that some classes of
genes are changing quickly in both humans
& chimpanzees, as compared with other
mammals.
These classes include genes involved in the
perception of sound & transmission of
nerve signals.
12. Despite the similarities in human & chimp
genomes, the scientists identified some 40
million differences among 3 billion
nucleotides in each genome however only a
couple thousand were significant.
Human & chimp sequences differ by only
1.2 % in terms of single-nucleotide
changes to the genetic code.
But 2.7 % of the genetic difference
between humans and chimps genetic
segments code are copied many times in
the genome.
13. Mutations
Humans & chimps originate from a common
ancestor & scientists believe they diverged
some 6 million years ago.
A few important mutations are responsible for
the differences between the 2 species,
according to Wen-Hsiung Li, a molecular
evolutionist.
Scientists agree that many questions remain
unanswered but the chimp genome provides
important clues to understanding what makes
us human.
16. PRIMER DESIGNING
Using SDSC Workbench
Optimal Primer Pair/Probe
or4d11 RIGHT PRIMER opt
PRIMER3, 20 bp
>or4d11_RIGHT_PRIMER_opt
CAAACGCCATCACAGAGAGA
or4d11 LEFT PRIMER opt
PRIMER3, 20 bp
>or4d11_LEFT_PRIMER_opt
GACCTGTGAGTCTCGCCTTC
SEQUENCE SIZE: 936INCLUDED REGION SIZE: 936
PRODUCT SIZE: 215, PAIR ANY COMPL: 6.00, PAIR 3' COMPL: 2.00
or4d11 LEFT PRIMER 3
PRIMER3, 20 bp
>or4d11_LEFT_PRIMER_3GACCTGTGAGTCTCGCCTTC
or4d11 RIGHT PRIMER 3
PRIMER3, 20 bp
>or4d11_RIGHT_PRIMER_3TAGCAGTCAAACGCCATCAC
PRODUCT SIZE: 222, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 1.00