Gold nanoparticles are useful as biosensors due to their optical properties, ease of synthesis, stability, and ability to conjugate with biomolecules. The document describes how gold nanoparticles can be used to detect various analytes through colorimetric assays and lateral flow tests. It also discusses using quantum dots as novel biosensors and how their size-dependent optical properties allow tuning of fluorescence. Conditions are adjusted for new gold nanoparticle-based lateral flow tests to detect DNA methylation and SRY gene sequences.
Review paper on the applications and challenges of gold nanoparticles in medicine and dentistry.
Gold nanoparticles is a game-changer in delivering patient care. Its versatility can be put to use in diagnosis, imaging and treatment of various conditions. It relatively recent innovation although gold is a metal that has had a lot of meaning in human civilisation.With a lot of potential left unexplored one has to what and watch the miracles this breakthrough has in store for medical science.
in-organic nanoparticles are the recent advances in the nanotechnology for their targeted drug delivery systems.
Here in this ppt i beifly focoused on the important points regarding the iron oxide nanoparticles,gold nanao particles,silver nanoparticles,and gold nanoparticles.
Forgive my flaws :-)
The presentation is on early detection of triple negative breast cancer by monitoring levels of choline which is known to increase in TNBC patients. These increased levels can be detected with the help of nano-interfaced biosensor.
Review paper on the applications and challenges of gold nanoparticles in medicine and dentistry.
Gold nanoparticles is a game-changer in delivering patient care. Its versatility can be put to use in diagnosis, imaging and treatment of various conditions. It relatively recent innovation although gold is a metal that has had a lot of meaning in human civilisation.With a lot of potential left unexplored one has to what and watch the miracles this breakthrough has in store for medical science.
in-organic nanoparticles are the recent advances in the nanotechnology for their targeted drug delivery systems.
Here in this ppt i beifly focoused on the important points regarding the iron oxide nanoparticles,gold nanao particles,silver nanoparticles,and gold nanoparticles.
Forgive my flaws :-)
The presentation is on early detection of triple negative breast cancer by monitoring levels of choline which is known to increase in TNBC patients. These increased levels can be detected with the help of nano-interfaced biosensor.
Done by: Khnaizi Group
School Name:Mossab bin Omair secondary school for boys
•By application of gold nanoparticle will be possible to detect several biomolecules according to their overall charge and complexation between them, which can be visualized even by naked eyes.
A variety of Nano-biomaterials are synthesised, characterised and tested to find out their potentialities by global scientific communities, during the last three decades. Among those, nanostructured ceramics, cements and coatings are being considered for major use in orthopaedic, dental and other medical applications. The development of novel biocompatible ceramic materials with improved biomedical functions is at the forefront of health-related applications, all over the world. Understanding of the potential biomedical applications of ceramic nanomaterials will provide a major insight into the future developments. This study reviews and enlists the prominent potential biomedical applications of ceramic nanomaterials, like Calcium Phosphate (CaP), Tri-Calcium Phosphate (TCP), Hydroxy-Apatite(HAP), TCP+HAP, Si substituted HAP, Calcium Sulphate and Carbonate, Bioactive Glasses, Bioactive Glass Ceramics, Titania-Based Ceramics, Zirconia Ceramics, Alumina Ceramcis and Ceramic Polymer Composites.
1. Done by: Dr. Mohamad Ghazi Kassem
2. What is Nanotechnology An engineered DNA strandtiny motor pRNA Semiconducting metal junction formed by two carbon nanotubes Nanotechnology is the creation of functional materials, devices and systems, through the understanding and control of matter at dimensions in the nanometer scale length (1-100 nm), where new functionalities and properties of matter are observed and harnessed for a broad range of applications.
3. What is Nanoscale Fullerenes C60 22 cm 12,756 Km 1.27 × 107 m 0.22 m 10 millions times smaller 0.7 nm 0.7 × 10-9 m 1 billion times smaller
4. What Are Gold Nanoparticles? • Gold nanoparticles (‘nanogold’) occur as clusters of gold atoms up to 100nm in diameter. Gold nanoparticle • Nanogold has unusual visible properties because the particles are small enough to scatter visible light. - in contrast, mass gold reflects light. 5nm gold clusters
5. • Gold nanoparticles appear yellow to deep red to in solution. - colour depends on size of nanoparticles • The distance between particles also affects colour - surface plasmon resonance is the term used by nanotechnologists to describe this effect.
6. Why Gold Nanoparticles Cancer is a difficult disease to treat, contain, and identify. There are many different ways for treating cancer such as surgery, chemotherapy, radiation and many others. These methods are effective if the cancer tumor is caught soon enough. However, these treatments are not effective enough because they do not only target the affected cells, they also affect healthy cells. But • Gold Nanoparticles are non toxic • With Gold Nanoparticles we can detecting cancer cells and even destroy them without affect healthy cells.
7. Mostafa A. El-Sayed Julius Brown Chair and Regents Professor; Director, Laser Dynamics Laboratory “Gold nanoparticles are very good at scattering and absorbing light,” said Mostafa El-Sayed, director of the Laser Dyanamics Laboratory and chemistry professor at Georgia Tech. “We wanted to see if we could harness that scattering property in a living cell to make cancer detection easier. So far, the results are extremely promising.”
8. Gold Nanoparticle Tumor Detection The common strategy to detect the tumor is the functionalization of the nanoparticle with an antibody specific to the tumor antigens, and then detect the nanoparticle by some spectroscopic technique B. Tumor photograph Imaging with gold nanoparticles as contrast agent
9. Many cancer cells have a protein, known as Epidermal Growth Factor Receptor (EFGR), all over their surface, while healthy cells typically do not express the protein as strongly. By conjugating, or binding, the gold nanoparticles to an antibody for EFGR, suitably named antiEFGR, researchers were able to get the nanoparticles to attach themselves to the cancer cells. Electrostatically + + + + - - - + + + - + -+ - - + + + + Covalently S S S S S S S S
10. Gold Nanoparticles Nanoshells
Potential application of nanoparticles in medicineBangaluru
Nanoparticle applications in management and control of serious diseases such as cancers are promising. Nanoparticles target
the drugs delivery system specifically to malignant cells. They are able to penetrate the stratum corneum barrier of the skin and thus have been used
widely as a treatment tool in skin cancer imaging, vaccine delivery via the skin, antimicrobials and wound healing. Recently, nanoparticles were used in
lung diseases through their ability to accumulation the drugs in the diseased lung areas by providing a local inhalation delivery of active components.
BIOSYNTHESIS AND CHARACTERIZATION OF ZINC OXIDE NANOPARTICLE USING FICUS RELI...Arvind Singh Heer
The objective of this study is to synthesize zinc oxide nanostructures
with the most practical ways by using Ficus Religiosa leaves extract
and characterize the nanostructures. ZnO nanoparticles were
synthesized using Zinc Nitrate (Zn(NO3)2) as a precursor and Ficus
Religiosa leaves extract solvent and distilled water were used as
medium. ZnO nanoparticles were characterized by using XRD, UVVisible
spectroscopy, EDX and SEM, FTIR. Result of EDX
characterization shows that the ZnO nanoparticles has good purity with
(Zinc content of- 72.48% and; Oxygen content of- 27.52%). XRD
result spectrum displays mainly oxygen and zinc peaks, which indicate
the crystallinity in nature as exhibited. SEM micrographs shows that
synthesized ZnO have a cubical structure. The obtained ZnO
nanoparticles are homogenous and consistent in size which corresponds to the XRD result
that exhibit good crystallinity.
Nanotechnology and its Application in Cancer TreatmentHasnat Tariq
Nanotechnology
Nanomaterials
Nanostructures
Nanoparticles
Unexpected Optical Properties of Nanoparticles
Synthesis of Nanoparticles
Nanotechnology in Cancer Treatment
Role of Sulfur NPs in Cancer Treatment
Human Tumour Cell Lines Used in Research
Ehrlich ascites carcinoma (EAC)
Sulfur Nanoparticles Preparation
MTT Assay
Sulphorhodamine-B (SRB) Assay
Median lethal dose (LD 50)
Experimental design
FT-IR Characterization of Sulfur Nanoparticles
SEM Characterization of Sulfur Nanoparticles
EDS Characterization of Sulfur Nanoparticles
XRD Characterization of Sulfur Nanoparticles
Chemical Studies on Sulfur Nanoparticles In Vitro
Biochemical investigations
Conclusion
Applications of Nanoparticles in cancer treatment
Nanoshells
Nano X-Ray therapy
Drug Delivery by Nanoparticles
Mechanism of oxidative stress involved in the toxicity of ZnO nanoparticles a...Nanomedicine Journal (NMJ)
ZnO NPs (zinc oxide nanoparticles) has generated significant scientific interest as a novel antibacterial and anticancer agent. Since oxidative stress is a critical determinant of ZnO NPs-induced damage, it is necessary to characterize their underlying mode of action. Different structural and physicochemical properties of ZnO NPs such as particle surface, size, shape, crystal structure, chemical position, and presence of metals can lead to changes in biological activities including ROS (reactive oxygen species) production. However, there are some inconsistencies in the literature on the relation between the physicochemical features of ZnO NPs and their plausible oxidative stress mechanism. Herein, the possible oxidative stress mechanism of ZnO NPs was reviewed. This is worthy of further detailed evaluations in order to improve our understanding of vital NPs characteristics governing their toxicity. Therefore, this study focuses on the different reported oxidative stress paradigms induced by ZnO NPs including ROS generated by NPs, oxidative stress due to the NPs-cell interaction, and role of the particle dissolution in the oxidative damage. Also, this study tries to characterize and understand the multiple pathways involved in oxidative stress induced by ZnO NPs. Knowledge about different cellular signaling cascades stimulated by ZnO NPs lead to the better interpretation of the toxic influences induced by the cellular and acellular parameters. Regarding the potential benefits of toxic effects of ZnO NPs, in-depth evaluation of their toxicity mechanism and various effects of these nanoparticles would facilitate their implementation for biomedical applications.
DEFECT ANALYSIS OF QUANTUM-DOT CELLULAR AUTOMATA COMBINATIONAL CIRCUIT USING ...IAEME Publication
CMOS technology has achieved the device dimension in the nanometer range. Beyond this CMOS technology is the QCA (Quantum-dot Cellular Automata). Due to nanoscale defects may occur in this technology so in the consequences of it the faults will occur. This paper presents the defect analysis of QCA basic devices like Majority Voter (MV), inverter. The defect analysis and its effects on the output of combinational circuit using Hardware Description Language for QCA (HDLQ) is presented in this paper.
Gold nano particles have been used by artists for its amazing property of interacting with the visible light. However, nowadays the optical properties of nano particles of gold are now being put to use for many different reasons. After much research, it has been found that the nano particles of gold have the ability to intermingle with the free electrons emerging from a light ray which is electrical in nature
Done by: Khnaizi Group
School Name:Mossab bin Omair secondary school for boys
•By application of gold nanoparticle will be possible to detect several biomolecules according to their overall charge and complexation between them, which can be visualized even by naked eyes.
A variety of Nano-biomaterials are synthesised, characterised and tested to find out their potentialities by global scientific communities, during the last three decades. Among those, nanostructured ceramics, cements and coatings are being considered for major use in orthopaedic, dental and other medical applications. The development of novel biocompatible ceramic materials with improved biomedical functions is at the forefront of health-related applications, all over the world. Understanding of the potential biomedical applications of ceramic nanomaterials will provide a major insight into the future developments. This study reviews and enlists the prominent potential biomedical applications of ceramic nanomaterials, like Calcium Phosphate (CaP), Tri-Calcium Phosphate (TCP), Hydroxy-Apatite(HAP), TCP+HAP, Si substituted HAP, Calcium Sulphate and Carbonate, Bioactive Glasses, Bioactive Glass Ceramics, Titania-Based Ceramics, Zirconia Ceramics, Alumina Ceramcis and Ceramic Polymer Composites.
1. Done by: Dr. Mohamad Ghazi Kassem
2. What is Nanotechnology An engineered DNA strandtiny motor pRNA Semiconducting metal junction formed by two carbon nanotubes Nanotechnology is the creation of functional materials, devices and systems, through the understanding and control of matter at dimensions in the nanometer scale length (1-100 nm), where new functionalities and properties of matter are observed and harnessed for a broad range of applications.
3. What is Nanoscale Fullerenes C60 22 cm 12,756 Km 1.27 × 107 m 0.22 m 10 millions times smaller 0.7 nm 0.7 × 10-9 m 1 billion times smaller
4. What Are Gold Nanoparticles? • Gold nanoparticles (‘nanogold’) occur as clusters of gold atoms up to 100nm in diameter. Gold nanoparticle • Nanogold has unusual visible properties because the particles are small enough to scatter visible light. - in contrast, mass gold reflects light. 5nm gold clusters
5. • Gold nanoparticles appear yellow to deep red to in solution. - colour depends on size of nanoparticles • The distance between particles also affects colour - surface plasmon resonance is the term used by nanotechnologists to describe this effect.
6. Why Gold Nanoparticles Cancer is a difficult disease to treat, contain, and identify. There are many different ways for treating cancer such as surgery, chemotherapy, radiation and many others. These methods are effective if the cancer tumor is caught soon enough. However, these treatments are not effective enough because they do not only target the affected cells, they also affect healthy cells. But • Gold Nanoparticles are non toxic • With Gold Nanoparticles we can detecting cancer cells and even destroy them without affect healthy cells.
7. Mostafa A. El-Sayed Julius Brown Chair and Regents Professor; Director, Laser Dynamics Laboratory “Gold nanoparticles are very good at scattering and absorbing light,” said Mostafa El-Sayed, director of the Laser Dyanamics Laboratory and chemistry professor at Georgia Tech. “We wanted to see if we could harness that scattering property in a living cell to make cancer detection easier. So far, the results are extremely promising.”
8. Gold Nanoparticle Tumor Detection The common strategy to detect the tumor is the functionalization of the nanoparticle with an antibody specific to the tumor antigens, and then detect the nanoparticle by some spectroscopic technique B. Tumor photograph Imaging with gold nanoparticles as contrast agent
9. Many cancer cells have a protein, known as Epidermal Growth Factor Receptor (EFGR), all over their surface, while healthy cells typically do not express the protein as strongly. By conjugating, or binding, the gold nanoparticles to an antibody for EFGR, suitably named antiEFGR, researchers were able to get the nanoparticles to attach themselves to the cancer cells. Electrostatically + + + + - - - + + + - + -+ - - + + + + Covalently S S S S S S S S
10. Gold Nanoparticles Nanoshells
Potential application of nanoparticles in medicineBangaluru
Nanoparticle applications in management and control of serious diseases such as cancers are promising. Nanoparticles target
the drugs delivery system specifically to malignant cells. They are able to penetrate the stratum corneum barrier of the skin and thus have been used
widely as a treatment tool in skin cancer imaging, vaccine delivery via the skin, antimicrobials and wound healing. Recently, nanoparticles were used in
lung diseases through their ability to accumulation the drugs in the diseased lung areas by providing a local inhalation delivery of active components.
BIOSYNTHESIS AND CHARACTERIZATION OF ZINC OXIDE NANOPARTICLE USING FICUS RELI...Arvind Singh Heer
The objective of this study is to synthesize zinc oxide nanostructures
with the most practical ways by using Ficus Religiosa leaves extract
and characterize the nanostructures. ZnO nanoparticles were
synthesized using Zinc Nitrate (Zn(NO3)2) as a precursor and Ficus
Religiosa leaves extract solvent and distilled water were used as
medium. ZnO nanoparticles were characterized by using XRD, UVVisible
spectroscopy, EDX and SEM, FTIR. Result of EDX
characterization shows that the ZnO nanoparticles has good purity with
(Zinc content of- 72.48% and; Oxygen content of- 27.52%). XRD
result spectrum displays mainly oxygen and zinc peaks, which indicate
the crystallinity in nature as exhibited. SEM micrographs shows that
synthesized ZnO have a cubical structure. The obtained ZnO
nanoparticles are homogenous and consistent in size which corresponds to the XRD result
that exhibit good crystallinity.
Nanotechnology and its Application in Cancer TreatmentHasnat Tariq
Nanotechnology
Nanomaterials
Nanostructures
Nanoparticles
Unexpected Optical Properties of Nanoparticles
Synthesis of Nanoparticles
Nanotechnology in Cancer Treatment
Role of Sulfur NPs in Cancer Treatment
Human Tumour Cell Lines Used in Research
Ehrlich ascites carcinoma (EAC)
Sulfur Nanoparticles Preparation
MTT Assay
Sulphorhodamine-B (SRB) Assay
Median lethal dose (LD 50)
Experimental design
FT-IR Characterization of Sulfur Nanoparticles
SEM Characterization of Sulfur Nanoparticles
EDS Characterization of Sulfur Nanoparticles
XRD Characterization of Sulfur Nanoparticles
Chemical Studies on Sulfur Nanoparticles In Vitro
Biochemical investigations
Conclusion
Applications of Nanoparticles in cancer treatment
Nanoshells
Nano X-Ray therapy
Drug Delivery by Nanoparticles
Mechanism of oxidative stress involved in the toxicity of ZnO nanoparticles a...Nanomedicine Journal (NMJ)
ZnO NPs (zinc oxide nanoparticles) has generated significant scientific interest as a novel antibacterial and anticancer agent. Since oxidative stress is a critical determinant of ZnO NPs-induced damage, it is necessary to characterize their underlying mode of action. Different structural and physicochemical properties of ZnO NPs such as particle surface, size, shape, crystal structure, chemical position, and presence of metals can lead to changes in biological activities including ROS (reactive oxygen species) production. However, there are some inconsistencies in the literature on the relation between the physicochemical features of ZnO NPs and their plausible oxidative stress mechanism. Herein, the possible oxidative stress mechanism of ZnO NPs was reviewed. This is worthy of further detailed evaluations in order to improve our understanding of vital NPs characteristics governing their toxicity. Therefore, this study focuses on the different reported oxidative stress paradigms induced by ZnO NPs including ROS generated by NPs, oxidative stress due to the NPs-cell interaction, and role of the particle dissolution in the oxidative damage. Also, this study tries to characterize and understand the multiple pathways involved in oxidative stress induced by ZnO NPs. Knowledge about different cellular signaling cascades stimulated by ZnO NPs lead to the better interpretation of the toxic influences induced by the cellular and acellular parameters. Regarding the potential benefits of toxic effects of ZnO NPs, in-depth evaluation of their toxicity mechanism and various effects of these nanoparticles would facilitate their implementation for biomedical applications.
DEFECT ANALYSIS OF QUANTUM-DOT CELLULAR AUTOMATA COMBINATIONAL CIRCUIT USING ...IAEME Publication
CMOS technology has achieved the device dimension in the nanometer range. Beyond this CMOS technology is the QCA (Quantum-dot Cellular Automata). Due to nanoscale defects may occur in this technology so in the consequences of it the faults will occur. This paper presents the defect analysis of QCA basic devices like Majority Voter (MV), inverter. The defect analysis and its effects on the output of combinational circuit using Hardware Description Language for QCA (HDLQ) is presented in this paper.
Gold nano particles have been used by artists for its amazing property of interacting with the visible light. However, nowadays the optical properties of nano particles of gold are now being put to use for many different reasons. After much research, it has been found that the nano particles of gold have the ability to intermingle with the free electrons emerging from a light ray which is electrical in nature
Nanotechnology in Semiconductor Nanostructure.
Presentation on "Quantum Dot", was performed under the Subject "QUANTUM PHENOMENA IN NANOSTRUCTURES" at AIUB. The simulation is done from a website nanoHUB which stands for online simulation for nanotechnology- https://nanohub.org/
The arc reactor is some kind of fusion reactor that has the ability to generate an electromagnetic field, provide clean energy, and blow things up. In the comics, Tony Stark uses it for various purposes, primarily to recharge his armor and other electronic devices.
Fusion reactors that could provide a limitless source of energy could be a reality in less than a decade.
This is according to scientists at the Massachusetts Institute of Technology who claim to have come up with a commercially viable fusion reactor design.
Named ARC, the planned reactor will be a tokamak - or donut-shaped – system and would generate the same amount of energy as much larger designs - much like the reactor used by Tony Stark in the hit movie Iron man
Quantum dots (QD) are semiconductors made via several possible routes. John Ashmead discusses how they are made, their properties and their applications in research.
Gold nanoparticles: strange properties and applicationsExpedeon
View our gold nanoparticle range: http://www.innovabiosciences.com/gold-conjugation-kits.html
Gold nanoparticles exhibit extraordinary properties quite unlike those of the bulk metal. These properties can be exploited in a variety of assay applications, including lateral flow tests, microscopy, flow cytometry and FRET assays. There are also a number of therapeutic applications, especially in the field of cancer. This free and exciting webinar focuses on the following points:
1. Introduction to Gold
2. Unique properties of nanoparticles
3. Why does "40nm gold" never look the same from different suppliers?
4. Methods of attaching proteins and analytes to gold
5. Uses of nanoparticles in diagnostics
6. Uses of nanoparticles in therapeutics
Quantum Dot Light Emitting Diode
Introduction
Quantum dots (QD) or semiconductor Nano crystals could provide an alternative for commercial applications such as display technology. This display technology would be similar to organic light-emitting diode (OLED) displays, in that light would be supplied on demand, which would enable more efficient displays.
Quantum dots could support large, flexible displays. At present, they are used only to filter light from LEDs to backlight LCDs, rather than as actual displays. Properties and performance are determined by the size and/or composition of the QD. QDs are both photo-active (photo luminescent) and electro-active (electroluminescent) allowing them to be readily incorporated into new emissive display architectures.
Definition
QD-LED or QLED is considered as a next generation display technology after OLED-Displays.
“QLED means Quantum dot light emitting diodes and are a form of light emitting technology and consist of nano-scale crystals that can provide an alternative for applications such as display technology”. The light emitting centers are cadmium selenide (CdSe) nanocrystals, or quantum dots.
Charactristics
❀ QLEDs are a reliable, energy efficient, tunable color solution for display and lighting applications that reduce manufacturing costs, while employing ultra-thin, transparent or flexible materials.
❀ Quantum-dot-based LEDs are characterized by pure and saturated emission colors with narrow bandwidth.
❀ Their emission wavelength is easily tuned by changing the size of the quantum dots. Moreover, QD-LED offer high color purity and durability combined with the efficiency, flexibility, and low processing cost of organic light-emitting devices. QD-LED structure can be tuned over the entire visible wavelength range from 460 nm (blue) to 650 nm
❀ Due to spectrally narrow, tunable emission, and ease of processing, colloidal QDs are attractive materials for LED technologies.
Effect of Electron - Phonon Interaction on electron Spin Polarization in a q...optljjournal
This paper presents a theoretical model for the effect of electron
-
phonon interaction, temperature and
magnetic field on degree of electron spin polarization in GaAs/InAs quantum dot LED. To describe the
dynamics, quantum Langevin equation for photon numbe
r and carrier number is used. Simulation results
show that degree of electron spin polarization in quantum dot decreases with increase of electron phonon
interaction parameter at constant temperature and constant magnetic field which agrees with experiment
al results in literatures
Presented by Dr. Miller at the 40th Annual Symposium "Diagnostic and Clinical Challenges of 20th Century Microbes", held on Nov 18, 2010 in Philadelphia.
Immunoassays have been used in hospitals, laboratory medicine, and research.
Improve the health and well-being of humans and animals.
Lead to improved therapeutic choices.
Used in the study of biological systems by tracking different proteins, hormones, and antibodies.
In industry, are used to detect contaminants in food and water, and in quality control.
This project is about further developing probe array techniques for life science applications, notably in the context of cancer research. The consortium shows the balance between experts in sensing technology as well as oncology.
DNA sequence analysis of a uniform target gene like the mitochondrial cytochrome oxidase subunit I (COI) to enable species identification has been referred to as “DNA Barcoding”, by analogy with the Universal Product Code (UPC) system barcodes used to identify manufactured goods.
DNA barcoding has the potential to be a practical method for identification of the estimated 10 million species of eukaryotic life on earth.
Accelerate your Kubernetes clusters with Varnish CachingThijs Feryn
A presentation about the usage and availability of Varnish on Kubernetes. This talk explores the capabilities of Varnish caching and shows how to use the Varnish Helm chart to deploy it to Kubernetes.
This presentation was delivered at K8SUG Singapore. See https://feryn.eu/presentations/accelerate-your-kubernetes-clusters-with-varnish-caching-k8sug-singapore-28-2024 for more details.
Essentials of Automations: Optimizing FME Workflows with ParametersSafe Software
Are you looking to streamline your workflows and boost your projects’ efficiency? Do you find yourself searching for ways to add flexibility and control over your FME workflows? If so, you’re in the right place.
Join us for an insightful dive into the world of FME parameters, a critical element in optimizing workflow efficiency. This webinar marks the beginning of our three-part “Essentials of Automation” series. This first webinar is designed to equip you with the knowledge and skills to utilize parameters effectively: enhancing the flexibility, maintainability, and user control of your FME projects.
Here’s what you’ll gain:
- Essentials of FME Parameters: Understand the pivotal role of parameters, including Reader/Writer, Transformer, User, and FME Flow categories. Discover how they are the key to unlocking automation and optimization within your workflows.
- Practical Applications in FME Form: Delve into key user parameter types including choice, connections, and file URLs. Allow users to control how a workflow runs, making your workflows more reusable. Learn to import values and deliver the best user experience for your workflows while enhancing accuracy.
- Optimization Strategies in FME Flow: Explore the creation and strategic deployment of parameters in FME Flow, including the use of deployment and geometry parameters, to maximize workflow efficiency.
- Pro Tips for Success: Gain insights on parameterizing connections and leveraging new features like Conditional Visibility for clarity and simplicity.
We’ll wrap up with a glimpse into future webinars, followed by a Q&A session to address your specific questions surrounding this topic.
Don’t miss this opportunity to elevate your FME expertise and drive your projects to new heights of efficiency.
JMeter webinar - integration with InfluxDB and GrafanaRTTS
Watch this recorded webinar about real-time monitoring of application performance. See how to integrate Apache JMeter, the open-source leader in performance testing, with InfluxDB, the open-source time-series database, and Grafana, the open-source analytics and visualization application.
In this webinar, we will review the benefits of leveraging InfluxDB and Grafana when executing load tests and demonstrate how these tools are used to visualize performance metrics.
Length: 30 minutes
Session Overview
-------------------------------------------
During this webinar, we will cover the following topics while demonstrating the integrations of JMeter, InfluxDB and Grafana:
- What out-of-the-box solutions are available for real-time monitoring JMeter tests?
- What are the benefits of integrating InfluxDB and Grafana into the load testing stack?
- Which features are provided by Grafana?
- Demonstration of InfluxDB and Grafana using a practice web application
To view the webinar recording, go to:
https://www.rttsweb.com/jmeter-integration-webinar
UiPath Test Automation using UiPath Test Suite series, part 3DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 3. In this session, we will cover desktop automation along with UI automation.
Topics covered:
UI automation Introduction,
UI automation Sample
Desktop automation flow
Pradeep Chinnala, Senior Consultant Automation Developer @WonderBotz and UiPath MVP
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
PHP Frameworks: I want to break free (IPC Berlin 2024)Ralf Eggert
In this presentation, we examine the challenges and limitations of relying too heavily on PHP frameworks in web development. We discuss the history of PHP and its frameworks to understand how this dependence has evolved. The focus will be on providing concrete tips and strategies to reduce reliance on these frameworks, based on real-world examples and practical considerations. The goal is to equip developers with the skills and knowledge to create more flexible and future-proof web applications. We'll explore the importance of maintaining autonomy in a rapidly changing tech landscape and how to make informed decisions in PHP development.
This talk is aimed at encouraging a more independent approach to using PHP frameworks, moving towards a more flexible and future-proof approach to PHP development.
UiPath Test Automation using UiPath Test Suite series, part 4DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 4. In this session, we will cover Test Manager overview along with SAP heatmap.
The UiPath Test Manager overview with SAP heatmap webinar offers a concise yet comprehensive exploration of the role of a Test Manager within SAP environments, coupled with the utilization of heatmaps for effective testing strategies.
Participants will gain insights into the responsibilities, challenges, and best practices associated with test management in SAP projects. Additionally, the webinar delves into the significance of heatmaps as a visual aid for identifying testing priorities, areas of risk, and resource allocation within SAP landscapes. Through this session, attendees can expect to enhance their understanding of test management principles while learning practical approaches to optimize testing processes in SAP environments using heatmap visualization techniques
What will you get from this session?
1. Insights into SAP testing best practices
2. Heatmap utilization for testing
3. Optimization of testing processes
4. Demo
Topics covered:
Execution from the test manager
Orchestrator execution result
Defect reporting
SAP heatmap example with demo
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Connector Corner: Automate dynamic content and events by pushing a buttonDianaGray10
Here is something new! In our next Connector Corner webinar, we will demonstrate how you can use a single workflow to:
Create a campaign using Mailchimp with merge tags/fields
Send an interactive Slack channel message (using buttons)
Have the message received by managers and peers along with a test email for review
But there’s more:
In a second workflow supporting the same use case, you’ll see:
Your campaign sent to target colleagues for approval
If the “Approve” button is clicked, a Jira/Zendesk ticket is created for the marketing design team
But—if the “Reject” button is pushed, colleagues will be alerted via Slack message
Join us to learn more about this new, human-in-the-loop capability, brought to you by Integration Service connectors.
And...
Speakers:
Akshay Agnihotri, Product Manager
Charlie Greenberg, Host
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...Ramesh Iyer
In today's fast-changing business world, Companies that adapt and embrace new ideas often need help to keep up with the competition. However, fostering a culture of innovation takes much work. It takes vision, leadership and willingness to take risks in the right proportion. Sachin Dev Duggal, co-founder of Builder.ai, has perfected the art of this balance, creating a company culture where creativity and growth are nurtured at each stage.
The Art of the Pitch: WordPress Relationships and SalesLaura Byrne
Clients don’t know what they don’t know. What web solutions are right for them? How does WordPress come into the picture? How do you make sure you understand scope and timeline? What do you do if sometime changes?
All these questions and more will be explored as we talk about matching clients’ needs with what your agency offers without pulling teeth or pulling your hair out. Practical tips, and strategies for successful relationship building that leads to closing the deal.
De-mystifying Zero to One: Design Informed Techniques for Greenfield Innovati...
Nanogold & Quantum Dot as Novel Biosensors
1. Gold Nanoparticle as Biosensor
Nanogold &Quantum Dot
as
Novel Biosensors
www.nanopartz.com/Gold_Nanorods.htm
Amornpun Sereemaspun, MD. PhD.
E-mail : amornpun.s@gmail.com
Nanobiomedicine Laboratory
• Nano gold (Colloidal Gold)
Department of Anatomy – Nanometer-sized particles of gold in a fluid
Faculty of Medicine – Size 1-100 nm.
Chulalongkorn University
– Intense red or yellowish color
Why Gold Nanoparticles ? Gold Nanoparticles Synthesis
• Easy to synthesis reduction stabilization
• Protocol have been approved (J. Turkevich et al. 1951) Au3+
+
Au0 Au0
• Stable in room temperature
• Red color ;easy to monitor or detect
• Biocompatibility
• Can conjugate with nucleic acid or protein
From; http://www.nature.com/nprot/journal/v3/n2/fig_tab/nprot.2008.1_F2.html
Gold Nanoparticles and Optical Properties of Nanogold
Biomolecules
webexhibits.org www.azonano.com
• Nanogold size is similar to many cellular objects
• Gold surface can be coated by various biomolecules • The optical properties of gold nanoparticles can be
tuned carefully by controlling their size and shape
2. Basic optical properties of Optical Properties of AuNPs
nanoparticles
8
NanoGold As Products NanoGold As Products
Lateral flow strip test
From http://microgravity.hq.nasa.gov/general_info/homeplanet_lite.html
Leptospirosis
• A worldwide common
zoonosis in mammalian
• Spirochete-born disease
• Empirical diagnosis-based
• Staining – Gram unstainable
– Silver stain OK
• Culture – special media,
Take times
3. CFU
Leptospirosis 106 Urine Pregnancy Test
5 ×105
Nanogold Comparision with comercial kit
105
Dot-Blot ELISA
5 ×104
104
AuNP
control 10 102 104 105 106 CFU
Rojanathanes R. et al. 2008 Taiwan OB-GYN
2008,
Fluorescence-based detection of Nanogold and DNA Detection
protein kinase
Kiley et al.(Nanomedicine. 2008)
Mirkin et al. (Science 1997 ) reported DNA sandwich hybridization
assay using DNA-nanogold conjugate.
Kim, Y.-P., et al., Biosens. Bioelectron. (2007), 16
Lateral Flow Strip Test
Microchromatographic-based
Conjugate probe test line probe Control line probe
http://www.rapid-diagnostics.org/index.htm
Control line
Control line
Test line
Test line
Sample pad
Sample pad Conjugate probe
Conjugate probe
4. Lateral flow nucleic acid test strips Lateral flow nucleic acid test strips
Xun et al. (Anal. Chem. 2009) Ioannis et al. (Anal. Chem. 2007)
applied nucleic acid biosensor reported the first dry-reagent
based on the oligonucleotide dipstick assay for SNP
functionalized Au-NPs and genotyping by primer extension
lateral flow for the detection of
human genomic DNA directly
with a detection limit of 2.5
µg/mL (1.25 fM)
20
(Zhao et al., PNAS,2004)
(Wang et al., Bioconjugate Chem, 2007)
What Are Quantum Dots?
• Crystalline fluorophores
• CdSe semiconductor core/ ZnS Shell
• Unique Spectral properties
– Broad absorption
– Narrow emission
– Wavelength depends on size
3 nm
(Rosi et al., Science, 2006)
5. QDs vs. Other Fluorescence QDs vs. Other Fluorescence
• Photostability (quantum dots do not photobleach) • Broader excitation spectrum and
narrower emission spectrum
• No spectral overlap between dots
of different size
Quantum dots conjugate - red
Alexa 488 conjugate - green
Wu et al. Nature; 2003
Jaiswal & Simon 2004
Conjugating quantum dots to biomolecules Quantum dots
Avidin
• Avidin or protein-G with positively
charged tail conjugated to negatively
charged DHLA coat of quantum dots
protein G
Summary Future Outlook
• Gold Nanoparticle are key components of numerous • Development of QD lasers at communication wavelengths
• Gain and stimulated emission from QDs in polymers
assays for biologically analytes, including proteins,
– Polymeric optoelectronic devices?
nucleic acids, small molecules and metal ions. • Probe fundamental physics
• Colorimetric assays provide a sensitive test • Quantum computing schemes (exciton states as qubits)
– Basis for solid-state quantum computing?
• Gold nanoparticle improve the performance of • Biological applications
many conventional assays. • Material engineering
– How to make QDs cheaply and easily with good control?
• Let’s not forget the electronic applications too!
• Lots to do!
C. Seydel. Quantum dots get wet. Science, 300, p. 80-81, Apr 2003.
6. Methylation probe
T C
MT
G
UTG
Thank you Methylation probe
Probe Sequence
AuNP-Probe Met 5’-thiol-TTTTTTTTTTACCTTACCCGCTCCATCGCG -3’
Test line (T) Met’ 5’-TCACTAACCGCTCCTCAAACAAATACG-TEG-biotin-3’
Control (C) Met Com 5’-biotin- TTTTTTTTTTCGCGATGGAGCG GGTAAGGT-3’
AuNPs-Probe: Methylation-probe 15 µL
Test line(T): 1/10 Streptavidin-Biotin-Probe (Methylation)
Control line(C): 1/10 Streptavidin-Biotin-Probe (Control)
Hybridization buffer: 6XSSC, 0.5% SDS, 50% Formamide
Condition adjustment of new unmethylation biotin-probe Condition adjustment of new methylation biotin-probe
0.1 µM Synthetic target T C 0.1 µM Synthetic target
(Met or Unmet) 10 µl MT (Met or Unmet) 10 µl MT T C
Hybridization
buffer 1 G MTG
UTG UTG
Add 90 µl Add 90 µl G
Hybridization buffer Hybridization MT Hybridization buffer MT
UTG
buffer 2
G
UTG G
MTG=methylation target, UTG=unmethylation target MTG=methylation target, UTG=unmethylation target
Apply mixture to Apply mixture to
sample pad Probe µl MTG=methSequence sample pad Probe µl Sequence
AuNP-Probe Unmet 15 ylation
5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3 AuNP-Probe Met 15 5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3
Test line (T) 1/10 Unmet 1 5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3 Test line (T) 1/10 Met 1 5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3
Control (C) 1/10 Unmet 1 5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3 Control (C) 1/10 Met 1 5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3
Hybridization buffer 1 6×SSC, 1%BSA, 0.01% SDS, 0.2% Tween-20, Hybridization buffer 2 6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide
Hybridization buffer 2 6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide
Result: Buffer 2 can reduce non specific hybridization
Condition adjustment of strip test with genomic DNA Condition adjustment of SRY strip test
DNA 5 µl
(treat bisulfite) T C 1 µg DNA(Male) T C
B
MT
Denature G Met Denature ZP3 SRY
at 100oC, 5 min N MTUTG at 100oC, 5 min
G
B MT
Chill in ice, 15 min UTG Unmet Chill in ice, 10 min
N G Apply DNA to
Apply DNA to
B=Bisulfite treatment DNA, N=No treatment DNA
sample pad sample pad Probe µl Sequence
AuNP-Probe SRY 10 5 -thiol-T TTT TTT TTT GAT GAT TAC AGT CCA GCT GTG CAA G-3
Probe µl Sequence 5 -thiol-TTT TTT TTT TAG CCA TCC TGA GAC GTC CGT ACA-3
ZP3 10
AuNP-Probe Unmet 15 5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3
Test line (T) SRY 1 5 -GAA TAT TCC CGC TCT CCG GAG AAG TTT TTT TTT T-biotin-3
Apply buffer to Met 15 5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3
Apply buffer to 1/10 ZP3 1 5 -GCC CGT ACT GGT GGA GTG TCA TTT TTT TTT T-biotin-3
Test line (T) Unmet 1 5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3
sample pad 1/10 Met 1 5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3
sample pad Control (C) SRY 1 5 -biotin-TT TTT TTT TTC TTG CAC AGC TGG ACT GTA ATC ATC-3
5 -biotin-TTT TTT TTT TTG TAC GGA CGT CTC AGG ATG GCT-3
1/10 ZP3 1
Control (C) Unmet 1 5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3
5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3 Hybridization 6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS
1/10 Met 1 buffer
Hybridization 6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS
buffer
Result: SRY test line appear red band