The document discusses various types of mutations and how they are induced. It describes three main types of mutations: chromosome mutations, genome mutations, and single-gene mutations. Single-gene mutations can be further divided into point mutations, deletions, additions, transitions, and transversions. Mutations can occur spontaneously due to errors in DNA replication or be induced by environmental mutagens like chemicals, radiation, and viruses. Mutations provide genetic variation but can also cause genetic disorders and diseases.

1. Induction of genetic varibilty
1.Mutation
2.recombination

2. INTRODUCTION
 The term mutation refers to a heritable change in
the genetic material
 Mutations provide allelic variations
 On the positive side, mutations are the foundation for
evolutionary change

E.g. Light skin in high latitude human populations
 On the negative side, mutations are the cause of many
diseases

E.g. Hemophilia

3. DNA
Maintenance
 Mutation rate are
extremely low
 1 mutation out of 109
nucleotides per
generation

4.  Mutations can be divided into three main types
 1. Chromosome mutations
 Changes in chromosome structure
 2. Genome mutations
 Changes in chromosome number
 3. Single-gene mutations
 Relatively small changes in DNA structure that occur within a
particular gene
 Types 1 and Type 2 had discussed in aberration
 Type 3 will be discussed in this set of lecture notes
16.1 CONSEQUENCES OF
MUTATIONS

5.  A point mutation is a change in a single base pair
 It involves a base substitution
Gene Mutations Change the DNA
Sequence
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACGCGAGATC 3’
3’ TTGCGCTCTAG 5’
 A transition is a change of a pyrimidine (C, T) to
another pyrimidine or a purine (A, G) to another purine
 A transversion is a change of a pyrimidine to a purine
or vice versa
 Transitions are more common than transversions

6.  Mutations may also involve the addition or deletion
of short sequences of DNA
Gene Mutations Change the DNA
Sequence
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACGCTC 3’
3’ TTGCGAG 5’
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACAGTCGCTAGATC 3’
3’ TTGTCAGCGATCTAG 5’
Deletion of four base pairs
Addition of four base pairs

7.  Mutations in the coding sequence of a structural
gene can have various effects on the polypeptide
 Silent mutations are those base substitutions that do
not alter the amino acid sequence of the polypeptide

Due to the degeneracy of the genetic code
 Missense mutations are those base substitutions in
which an amino acid change does occur

Example: Sickle-cell anemia

If the substituted amino acid does not affect protein function (as
measured by phenotype), the mutation is said to be neutral
Gene Mutations Can Alter the
Coding Sequence Within a Gene

8.  Mutations in the coding sequence of a structural
gene can have various effects on the polypeptide
Gene Mutations Can Alter the
Coding Sequence Within a Gene
 Nonsense mutations are those base substitutions that
change a normal codon to a termination codon
 Frameshift mutations involve the addition or deletion of
nucleotides in multiples of one or two

This shifts the reading frame so that a completely different amino
acid sequence occurs downstream from the mutation
 Table 16.1 describes all of the above mutations

10.  In a natural population, the wild-type is the most
common genotype (may be encoded by a
dominant or recessive allele)
 A forward mutation changes the wild-type
genotype into some new variation
 If it is beneficial, it may move evolution forward
 Otherwise, it will be probably eliminated from a
population
 A reverse mutation has the opposite effect
 It is also termed a reversion
Gene Mutations and Their Effects on
Genotype and Phenotype

11.  Mutations can also be described based on their
effects on the wild-type phenotype
 When a mutation alters an organism’s phenotypic
characteristics, it is said to be a variant
 Variants are often characterized by their differential
ability to survive
 Deleterious mutations decrease the chances of survival

The most extreme are lethal mutations

E.g. Homozygous polydactyly in cats
 Beneficial mutations enhance the survival or
reproductive success of an organism
 Some mutations are called conditional mutants
 They affect the phenotype only under a defined set of
conditions

12.  A second mutation will sometimes affect the
phenotypic expression of another
 These second-site mutations are called
suppressor mutations or simply suppressors
 Suppressor mutations are classified into two types
 Intragenic suppressors

The second mutant site is within the same gene as the first
mutation
 Intergenic suppressors

The second mutant site is in a different gene from the first
mutation

13.  Several human genetic diseases are caused by an
unusual form of mutation called trinucleotide repeat
expansion (TNRE)
 The term refers to the phenomenon that a sequence of 3
nucleotides can increase from one generation to the next
Mutations Due to Trinucleotide
Repeats

14.  Certain regions of the chromosome contain
trinucleotide sequences repeated in tandem
 In normal individuals, these sequences are transmitted
from parent to offspring without mutation
 However, in persons with TRNE disorders, the length of a
trinucleotide repeat increases above a certain critical size

It also becomes prone to frequent expansion

This phenomenon is shown here with the trinucleotide repeat
CAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 11
n = 18

15.  In some cases, the expansion is within the coding
sequence of the gene
 Typically the trinucleotide expansion is CAG (glutamine)
 Therefore, the encoded protein will contain long tracks of
glutamine

This causes the proteins to aggregate with each other

This aggregation is correlated with the progression of the disease
 In other cases, the expansions are located in
noncoding regions of genes
 These expansions are hypothesized to cause abnormal
changes in RNA structure

Thereby producing disease symptoms

16.  A chromosomal rearrangement may affect a gene
because the break occurred in the gene itself
 A gene may be left intact, but its expression may be
altered because of its new location
 This is termed a position effect
 There are two common reasons for position effects:
 1. Movement to a position next to regulatory sequences

Refer to Figure 16.2a
 2. Movement to a position in a heterochromatic region

Refer to Figure 16.2b AND 16.3
Changes in Chromosome Structure
Can Affect Gene Expression

17. Figure 16.2
Regulatory sequences
are often
bidirectional

18.  Geneticists classify the animal cells into two types
 Germ-line cells

Cells that give rise to gametes such as eggs and sperm
 Somatic cells

All other cells
 Germ-line mutations are those that occur directly in a
sperm or egg cell, or in one of their precursor cells

Refer to Figure 16.4a
 Somatic mutations are those that occur directly in a
body cell, or in one of its precursor cells

Refer to Figure 16.4b AND 16.5
Mutations Can Occur in
Germ-Line or Somatic Cells

19. Figure 16.4
Therefore, the
mutation can be
passed on to future
generations
The size of the patch
will depend on the
timing of the mutation
The earlier the mutation,
the larger the patch
An individual who has
somatic regions that are
genotypically different
from each other is called
a genetic mosaic
Therefore, the mutation cannot be
passed on to future generations

20.  Mutations can occur spontaneously or be induced
 Spontaneous mutations
 Result from abnormalities in cellular/biological processes

Errors in DNA replication, for example
 Induced mutations
 Caused by environmental agents
 Agents that are known to alter DNA structure are termed
mutagens

These can be chemical or physical agents
 Refer to Table 16.4
16.2 OCCURRENCE AND CAUSES
OF MUTATION

22.  Are mutations spontaneous occurrences or
causally related to environmental conditions?
 This is a question that biologists have asked
themselves for a long time 
 Jean Baptiste Lamarck

Proposed that physiological events (e.g. use and disuse)
determine whether traits are passed along to offspring
 Charles Darwin

Proposed that genetic variation occurs by chance
 Natural selection results in better-adapted organisms
Spontaneous Mutations Are Random
Events

23.  These two opposing theories of the 19th century
were tested in bacteria in the 1940s and 1950s
 Salvadore Luria and Max Delbruck studied the
resistance of E. coli to bacteriophage T1
 tonr
(T one resistance)
 They wondered if tonr
is due to spontaneous mutations
or to a physiological adaptation that occurs at a low
rate?

The physiological adaptation theory predicts that the number of
tonr
bacteria is essentially constant in different bacterial
populations

The spontaneous mutation theory predicts that the number of
tonr
bacteria will fluctuate in different bacterial populations
 Their test therefore became known as the fluctuation test

24.  Joshua and Ester Lederberg were also interested in
the relation between mutations and the environment
 At that time (1950s), there were two new theories
 Directed mutation theory

Selected conditions could promote the formation of specific
mutations allowing the organism to survive
 This was consistent with Lamarck’s viewpoint
 Random mutation theory

Environmental factors simply select for the survival of those
individuals that happen to possess beneficial mutations
 This was consistent with Darwin’s viewpoint
Random Mutations Can Give an
Organism a Survival Advantage

25. Figure 16.7 Replica plating
 A few tonr
colonies were
observed at the same
location on both plates!!!
 This indicates that mutations
conferring tonr
occurred
randomly on the primary
(nonselective plate)
 The presence of T1 in the
secondary plates simply
selected for previously
occurring tonr
mutants
 This supports the random
mutation theory
 The Lederbergs developed
a technique to distinguish
between these two theories

26.  Spontaneous mutations can arise by three types
of chemical changes
 1. Depurination
 2. Deamination
 3. Tautomeric shift
Causes of
Spontaneous Mutations
The most common

27.  Depurination involves the removal of a purine
(guanine or adenine) from the DNA
 The covalent bond between deoxyribose and a purine
base is somewhat unstable

It occasionally undergoes a spontaneous reaction with water
that releases the base from the sugar
 This is termed an apurinic site
 Fortunately, apurinic sites can be repaired

However, if the repair system fails, a mutation may result
during subsequent rounds of DNA replication
Causes of Spontaneous Mutations

28. Spontaneous depurinationFigure 16.8
Three out of four (A, T and G)
are the incorrect nucleotide
There’s a 75% chance
of a mutation

29.  Deamination involves the removal of an amino
group from the cytosine base
 The other bases are not readily deaminated
Figure 16.9
 DNA repair enzymes can recognize uracil as an
inappropriate base in DNA and remove it
 However, if the repair system fails, a C-G to A-T mutation will result
during subsequent rounds of DNA replication

30.  Deamination of 5-methyl cytosine can also occur
 Thymine is a normal constituent of DNA
 This poses a problem for repair enzymes
 They cannot determine which of the two bases on the two DNA
strands is the incorrect base
 For this reason, methylated cytosine bases tend to create
hot spots for mutation
Figure 16.9

31.  A tautomeric shift involves a temporary change in
base structure (Figure 16.10a)
 The common, stable form of thymine and guanine is the
keto form

At a low rate, T and G can interconvert to an enol form
 The common, stable form of adenine and cytosine is the
amino form

At a low rate, A and C can interconvert to an imino form
 These rare forms promote AC and GT base pairs
 Refer to Figure 16.10b
 For a tautomeric shift to cause a mutation it must
occur immediately prior to DNA replication
 Refer to Figure 16.10c

32. Figure 16.10
RareCommon

33. Figure 16.10

34. 16-42
Figure 16.10
Temporary
tautomeric shift
Shifted back to
its normal fom

35.  An enormous array of agents can act as mutagens
to permanently alter the structure of DNA
 The public is concerned about mutagens for two
main reasons:
 1. Somatic mutagens are often involved in the
development of human cancers
 2. Germ-line mutations may have harmful effects in
future generations
 Mutagenic agents are usually classified as
chemical or physical mutagens
 Refer to Table 16.5
Types of Mutagens

36. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
16-53

37.  Chemical mutagens come into three main types
 1. Base modifiers
 2. Intercalating agents
 3. Base analogues
Mutagens Alter DNA Structure in
Different Ways

38.  Base modifiers covalently modify the structure of
a nucleotide
 For example, nitrous acid, replaces amino groups with
keto groups (–NH2 to =O)
 This can change cytosine to uracil and adenine to
hypoxanthine
 Refer to Figure 16.1

39. Mispairing of modified basesFigure 16.13
These mispairings
create mutations in the
newly replicated strand

40.  Intercalating agents contain flat planar structures
that intercalate themselves into the double helix
 This distorts the helical structure
 When DNA containing these mutagens is replicated, the
daughter strands may contain single-nucleotide additions
and/or deletions
 Examples:

Acridine dyes

Proflavin

Ethidium bromide

41.  Base analogues become incorporated into
daughter strands during DNA replication
 For example, 5-bromouracil is a thymine analogue

It can be incorporated into DNA instead of thymine
Figure 16.14
Normal pairing
This tautomeric shift
occurs at a relatively
high rate
Mispairing

42. Figure 16.14
In this way, 5-bromouracil can promote a change
of an AT base pair into a GC base pair

43.  Physical mutagens come into two main types
 1. Ionizing radiation
 2. Nonionizing radiation
 Ionizing radiation
 Includes X rays and gamma rays
 Has short wavelength and high energy
 Can penetrate deeply into biological molecules
 Creates chemically reactive molecules termed free
radicals
 Can cause

Base deletions

Single nicks in DNA strands

Cross-linking

Chromosomal breaks

44.  Nonionizing radiation
 Includes UV light
 Has less energy
 Cannot penetrate deeply
into biological molecules
 Causes the formation of
cross-linked thymine
dimers
 Thymine dimers may
cause mutations when that
DNA strand is replicated
Figure 16.15

45.  Gene recombination originate as a result of
 Crossing over
 Orientation of chromosome during cell division
 Random fusion of male and female gametes
during fertilization
 Read detail from book Pinciples of botany
pg#472
Gene recombination

46.  The rate of cancer increases with age
 Diseases caused by new point mutations usually
come from the father
 Testicular tissues undergoes many more rounds of DNA
replication than ovarian tissue prior to meiosis
 Cancers develop when one mutation promotes
DNA replication and cell division
 This promotes additional mutations
 Some of the new mutations further promote DNA replication and
cell division (or mutate genes that down-regulated replication
and cell division)
 This process continues to produce a malignant tumor
DNA Replication itself is mutagenic