Nucleic acids like DNA and RNA are the genetic material found in living cells. DNA carries genetic information from one generation to the next and is made up of deoxyribose, phosphate groups, and nitrogenous bases. DNA replication is semi-conservative and produces two identical DNA molecules, each with one old and one new strand. Transcription produces mRNA from a DNA template, and translation reads mRNA to produce proteins according to the central dogma of biology.

2. • Nucleic acids.
• Nucleic acids are the macromolecules present in
all living cell.
• Freidrich Miescher was the first person isolated
the nucleic acids from the pus cells. He called it as
nuclein.
• As it has an acidic nature, hence Altmann called
it as nucleic acids.
• The two types of nucleic acids found in living
organisms are,
1. Deoxyribonucleic acid [DNA]
2. Ribonucleic acid [RNA].

3. • Deoxyribonucleic acid [DNA]
• DNA is the genetic material of all living
organisms. This carries the coded information
from one generation to another generation.
• It is a long polymer of deoxyribonucleotides.
• The length of the DNA depends on, number of
nucleotide pair present in it.
• In eukaryotic cell DNA is found nucleus. It is the
chief component of chromosomes. DNA also
found in the mitochondria and chloroplasts

4. • Chemically DNA is composed of Deoxyribose sugar,
Phosphate group and nitrogenous base .
• Deoxyribose sugar: It is a pentose sugar heaving the
molecular formula C5H10O4.
• Phosphate group: The phosphoric acid forms the
phosphate group.
• its molecular formula is H3PO4. It is responsible for
acidic nature of DNA.

5. • Nitrogenous base: Nitrogenous base are the
nitrogen containing compounds. These are mainly
divided in to two types as
1. Purines .
2. Pyrimidines.
• Purines: Purines are the double ring heterocyclic
structural compounds. The two types of purines
present in the DNA are Adenine (A) and Guanine
(G).

6. • Pyrimidine: Pyrimidines are the single ring structured
compounds. The two types of pyrimidines present in
the DNA are Cytosine (C) and Thymine (T).
• Nucleosides: compounds formed by the combination
of pentose sugar and Nitrogenous base is called
nucleosides.
• A nitrogen base attached to the C1 of pentose sugar by
N-glycosidic linkage.
• In DNA Nucleosides are formed by the combination of
deoxyribose sugar and nitrogenous base .

7. • Adenine + deoxyribose sugar = Deoxyadenosine
• Guanine + deoxyribose sugar = Deoxygaunosine.
• Cytosine + deoxyribose sugar = Deoxycytidine.
• Thymine + deoxyribose sugar =Deoxythymidine

8. • Nucleotides: The compound formed by the
combination of phosphate groups with nucleosides is
called nucleotides.
• The four types of nucleotides present in the DNA are,
1. Deoxyadenosine monophosphate.
2. Deoxygaunosine monophosphate.
3. Deoxycytidine monophosphate.
4. Deoxythymidine monophosphate.

9. • Polynucleotide strand:
Number of nucleotides
linked each other by
phospho-di-ester bond
and forms a long chain
of molecule called
polynucleotide strand.
• The phospho-di-ester
bond forms between 5th
and 3ed carbon atom
position of pentose
sugar. Therefore
polynucleotide strand
contains 5th and 3ed
end.

10. Structure of DNA or Double helix
structure of DNA
• J.D.Watson and F.H.C.Crick first
proposed the structural model
of DNA in 1953.
• They got the Nobel Prize for
their work in 1962.
• According to Watson and
Crick model of DNA, ‘The DNA
contains two polynucleotide
strands coiled together in
helical manner’. Hence the
name Watson and Crick
double helix structure of DNA
is given.

11. James Dewey Watson: April 6th, 1928
Nobel prize winner at
the age of 34 (1962)

12. Francis Harry Compton Crick: (8 June 1916
– 28 July 2004)

13. • The structure of DNA is as fallows,
• The DNA is a double stranded polynucleotide molecule.
• Sugar and phosphate forms the backbone . The bases
projected to inside.
• The two strands are coiled each other and arranged
antiparallely. I.e. if one strand has 5th to 3ed and other
has 3ed to 5th in direction.
• The two strands of DNA have the common diameter of
20 0A.
• Adenine of one strand pairs with Thymine of another
strand by two hydrogen bonds and vice versa.
• Guanine of one strand pairs with Cytosine of another
strand by three hydrogen bonds and vice versa..

14. • Because of complementary base pairing
arrangement, if one strand of polynucleotide
sequence is known, another can be deduced.
• Ex: 5th AGCTTTACATACCGGAAAATTACAGT
3ed first strand.
• 3ed TCGAAATGTATGGCCTTTTAATGTCA
5TH second strand.
• The complementary strand twisted each other at
the distance of 34 0A.
• Each twist of DNA contains 10 base pair.
• The distance between these two base pairs are
3.4 0A.

17. • Central dogma
• One way flow of genetic information from DNA to
protein is called central dogma.
• DNA→ RNA→ Protein.
• Packaging of DNA in prokaryotes:
• Prokaryotes do not have definite nucleus.
• The DNA is not scattered throughout the cell.
• It is held together with some proteins in a region is
called ‘nucleoid’.
• The DNA in nucleoid is organized in large loops held
be proteins.

18. • Packaging of DNA in Eukaryotes:
• In eukaryotes DNA is stabilized with positively
charged, basic protein called Histones.
• Histones are positively charged due to rich in basic
amino acids like Lysines and arginines.
• Histones are organized to form a unit of eight
molecules called histone octamere.

19. • Negatively charged DNA wrapped around positively
charged histone octamere to form a structure called
nucleosome.
• The nucleosomes are seen as ‘beads-on-string’
structure under electron microscope.
• Nucleosome forms the repeating unit of a structure in
nucleus called chromatin,

20. • The chromatin is packaged to form chromatin
fibers. These are further coiled and condensed
at metaphase stage to form chromosome.
• euchromatin: In the nucleus some loosely
coiled regions of chromatin (light stained) is
called euchromatin.
• Heterochromatin: In the nucleus more densely
packed regions of chromatin (stains dark) are
called Heterochromatin.
• Euchromatin is transcriptionally active than
heterochromatin.

21. • Transforming principle:
• Frederich Griffith conducted experiments to show
Transforming principle in bacteria
• He conducted an experiment on mice and
pneumonia bacteria streptococcus pneumoniae.
These bacteria are found in two strains, as
• 1 virulent (smooth strain)
• 2 non-virulent (rough strain).
• The S-strain bacteria produce capsule and is
pathogenic.
• The R-strain lacks capsule and is non pathogenic.

23. • When the R-strains are injected into the mouse,
it is a non pathogenic and does not causes
pneumonia. The mouse continued to live.
• When the S-strains are injected into the mouse,
that causes pneumonia and mouse dies.
• When heat killed S-strains are injected into the
mouse that does not causes pneumonia. The
mouse continued to live.
• When the heat killed S-strains and R-strain are
mixed and injected into the mouse, that causes
pneumonia and mouse dies.

24. • Conclusion of experiment:
• R – Strain bacteria had been transformed by the
heat killed S-Strain bacteria.
• The transformation of R-Strain to S-Strain is due
to transfer of Genetic material.
• The biochemical nature of genetic material was
not defined from his experiment.

25. • Biochemical characterization of transforming
principle:
• Oswald Avery, Colin Macleod and Maclyn
McCarty. (1933-44) worked to determine the
biochemical nature of the ‘transforming principle’
of Griffith’s experiment.
• They purified biomolecules (proteins, DNA and
RNA) from the heat killed S strain. They added
digestive enzyme of each, to see which one could
transform live R cells to S cells.

26. • Heat killed S-Strain + protease + Live R-Strain →
transforms R strain to S strain.
• Heat killed S-Strain + RNase + Live R-Strain →
transforms R strain to S strain.
• Heat killed S-Strain + DNase + Live R-Strain →
unable to transforms R strain to S strain.

27. • Conclusion of the experiments:
• Protein of heat killed S-Strain is not the
genetic material
• RNA of heat killed S-Strain is not the genetic
material.
• DNA of heat killed S-Strain is the genetic
material.
– Because DNA digested with DNase mixed
with R-strain unable to transform R-Strain
to S-Strain.
• But all biologist are not convienced.

28. • The Genetic Material is DNA:
• ‘DNA is the genetic material’ is proved by Alfred Hershey
and Martha Chase (1952).
• They worked on the virus that infects bacteria called
bacteriophage.
• During infection the bacteriophage first attaches the
bacteria cell wall. It inserts its genetic material into the
bacterial cell.

29. • The viral genetic material became part of the bacterial
genome. It manufactures more virus particle using
host content.
• Hershey and Chase worked to discover whether it was
protein or DNA from the viruses that entered the
bacteria.
• Experiment :( blenders experiment)
• They grew some viruses on a medium having
radioactive phosphorus . Some others on medium
having radioactive sulfur.
• Viruses grown in radioactive Phosphorus have
radioactive DNA but not radioactive protein. Because
Phosphorus present in DNA not in protein.
• Viruses grown in radioactive sulfur have radioactive
protein not radioactive DNA. Because sulfur present in
protein but not in DNA.

31. • radioactive phages were allowed to infect E.coli bacteria. The
phages transfer the genetic material to the bacteria.
• The viral coats were separated from the bacteria surface by
blender.
• The virus particles were separated from the bacteria by
centrifuge machine.
• Observation:
• Bacteria infected with viruses that had radioactive DNA were
radioactive. No radioactivity in the supernatant.
• Bacteria infected with viruses that had radioactive protein
were not radioactive. But radioactivity found in the
supernatant.
• Conclusion of Experiment:
• DNA is the infecting agent that made the bacteria radioactive
hence DNA is the genetic material not the protein.

32. • Criteria for genetic material:
• It should be able to generate its replica
(replication)
• It should be chemically and structurally stable.
• It should provide slow changes (mutation) that
required for evolution.
• It should be able to express itself in the form
of ‘Mendelian Character’.
• Protein dose not fulfill the criteria hence it is
not the genetic material.
• RNA and DNA fulfill the criteria.

33. • Replication of DNA:
• “It is the process by which DNA produces the exact
copies of the original DNA."
• In eukaryotes, DNA is double stranded. The two
strands are complementary to each other because of
their base sequences.
• Semi-conservative method of DNA replication
• It is the most common method of DNA replication.
• It takes place in the nucleus where the DNA is
present.
• Replication takes place in the S-phase of cell cycle.
• Deoxyribose nucleotides needed for formation of
new DNA strands are present in nucleoplasm.

34. • At the time of replication two
strands of DNA separates.
• Each strand acts as a template
for the formation of a new
strand.
• A new strand is constructed on
each old strand by
complementary base pairing.
• Hence two exactly identical
double stranded DNA molecules
are formed.
• In each new DNA molecule, one
strand is old while the other is
newly formed. Hence, Watson
and Crick described this method
as semi-conservative
replication. .

35. Semi conservative nature of DNA Mathew
Messelson and Franklin start.

39. Semi conservative nature of DNA Mathew
Messelson and Franklin stahl.
• They grew E. coli on 15 NH4Cl culture medium.
15N is the heavy isotope of nitrogen
• Both strands of DNA have 15N (15N 15N).
• These bacteria are Shifted to 14NH4Cl culture
medium
• DNA extracted subjected to [Cesium Chloride
(CsCl)] CsCl density gradient centrifugations.
• Hybrid/ Intermediate type of DNA (15N 14N)
• After next generation equal amount of light DNA
(14N 14N) and hybrid DNA (15N 14N) are formed.

40. • Mechanism of DNA replication:
• The process of DNA replication takes place by
number of substance, enzymes and proteins.
They are,
• Substance: Deoxyribonucleotides.
• Enzymes: DNA Helicase.
DNA Polymarase III, II, I.
RNA Primase.
DNA ligase.
• Protein: SSB [ single strand binding protein]

43. • Mechanism of replication starts at a specific point of
DNA molecule called point of ori.
• At origin, DNA strand unwinds by breaking hydrogen
bonds. This takes place with the help of an enzyme
DNA Helicases.
• At the point separation it appears like a fork or a Y-
shape. It is called replication fork.
• Each old DNA strand acts as a template for the
synthesis of new strand.
• SSB protein attaches to un-winded strand and
prevents rejoining.
• the synthesis of new DNA strand on old strand takes
place by an enzymes DNA polymerase III. It adds new
nucleotides through complementary base pairing.

44. • DNA polymerase III always synthesis new strand in
5 to 3 direction.
• The synthesis of new strand for the parent templet
strand heaving 3 to 5 end is continuous. This
strand is called leading strand.
• The synthesis of new strand for the parent templet
strand heaving 5 to 3 end is discontinuous. It forms
by small segments of DNA called Okazoki
fragments. This strand is called lagging strand .
• During the formation of okazoki fragment RNA
primase first synthesis RNA primer

45. • DNA polymarase III continuous the synthesis
of okazoki fragment in 5 to3 direction.
• At the end RAN primer are replaced by
deoxyribonucleotides with the help of enzyme
DNA polymarase I.
• The okazoki fragments joins together with the
help of an enzyme DNA ligase.
• DNA polymarase II once again checks and
repairs the errors occurred in new strand.

46. Central dogma.
• One way flow of information from DNA to m-
RNA and from m-RNA to protein is called
central dogma.

47. Mechanism of Transcription.
• The processes of transcription takes place by
1. DNA helicase.
2. RNA polymerase II.
3. Ribonucleotides.
• Ribonucleoside monophosphate activates
into ribonucleoside tri phosphate by
phosphorylase enzyme and phosphoric acid.
Hence ATP,GTP, UTP, CTP forms.

48. • Transcription begins by uncoiling of DNA at specific site
called promoter region of cistron. It takes place by DNA
helicase.
• RNA polymerase II recognizes and binds to the promoter
sequence.
• RNA polymerase II synthesis RNA, always from 5’ to 3’
direction.
• Hence among two strands of DNA one strand 3’ to 5’ end
act as a templet.

49. G C A G T A C A T G T C5' 3'
3' C G T C A T G T A C A G 5' template
strand
coding
strand
transcription
RNAG C A G U A C A U G U C5' 3'

51. • The complementary base for templet strand pairs
to transcribe m- RNA.
• When the RNA polymerase reaches the terminator
point, synthesis of RNA stops up.
• Newly synthesized m-RNA in eukaryotic is called
hnRNA (heterogeneous RNA). It undergoes post
transcriptional process by splicing.
• The eukaryotic m-RNA contains exons and introns.
In splicing introns are removed and exons are
joined in a defined order.

52. • hnRNA undergoes additional processing called
as capping and tailing.
• In capping an unusual nucleotide methyl
guanosine triphosphate is added to the 5′-end
of hnRNA.
• In tailing, adenylate residues are added at 3′-
end as a template independent manner.
• Fully processed hnRNA, now called mRNA. It
transported out of the nucleus for translation

53. Messenger RNA (m-RNA)
• It is the RNA that carries message from DNA to
the site of protein synthesis. It represents about
5 to 10% of the total RNA of cell.
• It carries the genetic information in the form of
triplet codons,

54. • m-RNA is a single stranded poly nucleotide chain.
• The eukaryotic m-RNA contains a cap at 5th end
composed of 7 methyl gonosine. It is absent in
prokaryotic m-RNA.
• Next to the cap it has non coding region called
leader sequence.
• Next to it has an initiator codon. AUG. It initiate
the protein synthesis.

55. • Next to initiator codon, the coding sequence is
present. It codes for specific protein. It is called exon.
• Next to this terminator codon, UAA, UGA or UAG is
present. It terminates the protein synthesis.
• Next to this again non coding region is present.
• In eukaryotic m-RNA poly A tail is present at 3’ end.

56. Functions of r- RNA:
1. It helps in binding of ribosomes to m-RNA.
2. It acts as an enzyme(ribozymes), helps in
formation of peptide bond during protein
synthesis.

57. Difference between DNA and RNA
DNA
• Has high molecular
weight.
• Double stranded poly
nucleotide chain.
• Deoxy ribose sugar is
the pentose sugar.
• Thymine is present.
• Unusual nitrogen bases
are absent
• Genetic material of
living organism.
RNA
• Has very low molecular
weight.
• single stranded poly
nucleotide chain.
• ribose sugar is the pentose
sugar.
• Uracil is present.
• Unusual nitrogen bases are
present.
• Genetic material of some
virus.

58. Note:
• RNA polymerase is also called DNA dependent RNA
polymerase.
• RNA polymerase I is found in nucleolus and helps in
synthesis of r- RNA. Hence nucleolus is called ribosome
factories of cell.
• RNA polymerase II helps in synthesis of m-RNA.
• RNA polymerase III helps in synthesis of t-RNA.
• Ribosomal RNA is the insoluble RNA.
• Pribnow box: It is a DNA sequence found in the
promoter region of genes in prokaryotes. It has the
sequence of TATAATG.
• TATA box: The TATA box (Goldberg-Hogness box) is a DNA
sequence found in the promoter region of genes in
eukaryotes. It has the sequence of TATAAAT.

59. Concept of gene.
• Gene is the basic unit of inheritance that express
specific character.
• 1857 - Gregor Johann Mendel conducted
hybridization experiments with pea plants. He
called them as factors.
• 1909 - Danish botanist Johannsen proposed that
each portion of a chromosome that controls a
phenotype is called a “gene” (Greek: “to give
birth to”).
• 1941 - George W. Beadle and Edward L. Tatum
discovered that genes control the production of
enzymes. They proposed One gene one enzyme
hypothesis.

60. • 1944 - Oswald T. Avery announced that DNA is
the substance responsible for heredity.
• 1950’s – Watson and Crick discover chemical
structure of DNA,
• The gene is made up of a specific sequence of
DNA nucleotides.
• Symer Benzer proposed modern concept of gene,
while working on Ecoli and T4 bacteriophage.
• According to him gene is ,
1. Cistron.
2. Recon.
3. Muton.
4. Replicon

61. • Cistron: It is the structural gene. It is
functional unit of DNA molecule that codes for
specific protein.
• Recon: It is the unit of DNA that undergoes
recombination.
• Muton: It is the unit of DNA that capable to
undergo mutation.
• Replicon: It is the unit of DNA that undergoes
preplication.

62. • Genetic code: The three specific nucleotide
sequence that codes for specific amino acid
present in DNA is called genetic code.
• Codon: The three specific nucleotide
sequence that codes for specific amino acid
present in m-RNA is called codon.
• Anti codon: The three specific nucleotide
sequence that codes for specific amino acid
present in anticodon arm of t-RNA is called
anticodon.
• Anticodons are complementary to codons.

63. General features of genetic code.
• The genetic code is triplet: Each codon is made
up of three specific nucleotides.
• Genetic code is universal: each codon codes for
specific amino acid in all living organism.
• Genetic codons are no over lapping: Adjacent
codon never shares there nucleotides.
• Genetic code is comma less: There is no gap
between neighboring codon.
• Genetic codon is degenerative in nature: more
than one codon codes for single amino acid.
• Ex GUA, GUG, GUC,GUU codes for valine.

65. • Initiator codon: AUG is the initiator codon that initiates
the protein synthesis. It codes for amino acid methionine.
• Terminator codon: Among 64 codon, three codon UAG,
UGA, UAA does not codes for any amino acids. These are
called terminator codon or non-sense codon.
• Genetic code is unambiguous: Each codon codes for
specific amino acid, and only one amino acid.
• Ex: The codon UUU codes for the amino acid phenyl
alanine only.
• Genetic code is unidirectional: codon reads only in 5’ to 3’
direction.
• Wobble base: In each codon third nitrogenous base is less
specific.
• Ex: GUA, GUC, GUG, GUU codes for valine.

66. Transfer RNA (t-RNA)
• The RNA that carries and
transports activated amino acid to
the site of protein synthesis is
called t-RNA.
• It represents about 10 to 15% of
the total RNA in the cell.
• The polynucleotide chain is folded
on itself to have the shape of a
cloverleaf.
• Cloverleaf model of t-RNA was
proposed by American biochemist
Robert Holley in 1965. He shared
the Nobel Prize in Physiology in
1968
1922 - 1993

67. Structure of t- RNA.
• t- RNA is a single stranded
polynucleotide chain. It folds in some
region and resembles as trifoliate leaf
of clover plant.
• It contains 4 arms as,
1. Amino acid binding site or
acceptor arm.
2. T Ѱ C arm and loop.
3. DHU arm and loop.
4. Anticodon arm and loop.
5. Rarely small 5th arm is present is
called variable arm.
• The 5’end has methylated guanosine.
• The 3’ end has three free nitrogen
bases CCA.

68. • Each arm has paired base pairs
stem and unpaired base pairs
loop.
• Amino acid acceptor arm has 7
base pairs and 3 unpaired bases
CCA at 3’end. Therefore amino
acid always binds to adenine
present in the 3’end.
• T Ѱ C arm and loop contains
unusual sequence of nucleotides
as thymine (T), pseudo uridine (
Ѱ ) and cytosine (C). It helps to
bind ribosome at the time of
protein synthesis.

69. • DHU arm and loop contains
dihydrouridine. It helps to
recognizing specific amino acid
activating enzymes amino acyl
synthetase.
• The anti codon loop contains 7
unpaired nitrogen bases. Among
them 3 nucleotides acts as
anticodon which are
complementary to codon of m-
RNA.
• Functions: It carries specific
amino acid towards the site of
protein synthesis.

72. Ribosomal RNA (r-RNA):
• r- RNA is the structural and functional unit of
ribosomes.
• It represents nearly 80% of the total RNA in the
cell.

73. • Translation:
• decoding the coded information carried by m- RNA into protein
is called translation. OR
• Synthesis of poly peptide chain on m-RNA strand with the help
of t-RNA and ribosomes is called translation.
• Translation takes place in cytoplasm.
• The required components for translation are,
1. m-RNA.
2. t-RNA.
3. Ribosomes.
4. Amino acids.
5. Amino acyl synthetase.
6. Peptidyle synthetase.
7. ATP.
8. GTP.
9. Mg +2

74. • The process of translation takes place by 5
steps.
1. Activation of amino acids.
2. Attachment of activated amino acids to the t-
RNA.
3. Initiation of poly peptide chain.
4. Elongation of polypeptide chain.
5. Termination of polypeptide chain.

75. Activation of amino acids.
• The specific amino acid present in cytoplasm
gets activated by specific amino acyl
synthetase enzyme and ATP. It forms amino
acyl adenylate enzyme complex.
• Amino acid + ATP + Amino acyl synthetase.
Mg +2
Amino acyl adenylate enzyme complex + PPi

76. Attachment of activated amino acids
to the t- RNA.
• The DHU loop of specific
t-RNA recognizes the
activated amino acid
according to its
anticodon.
• The activated amino acid
binds to the 3ed end of
t-RNA. It results in the
formation of amino acyl
t- RNA.

78. Initiation of poly peptide chain

79. Initiation of poly peptide chain
• The ribosome binds to the m-RNA at 5’ end.
• The ribosome recognizes the initiator codon AUG
on m-RNA.
• The t- RNA having anticodon UAC carries formyl
methionine acid to the site of initiator codon.
• It initiates the poly peptide chain.

80. Elongation of polypeptide chain.
• It is the linear growth of poly peptide chain on m-
RNA.

81. • The charged t-RNA that carries specific amino
acid enters the ribosome. It attaches to m-RNA
next to initiator codon with the help of
anticodon.
• The peptide bond forms between these two
amino acids by peptidyle synthetase.
• As the peptide bond forms the t-RNA becomes
uncharged. It leaves the ribosome.
• The ribosome moves codon by codon in the
direction of 5’ to 3’ end.
• As the ribosome moves over m-RNA, the coded
information decodes into polypeptide chain.

86. Termination of polypeptide chain
• The termination of poly peptide chain takes place
due to the presence of terminator codon UAA,
UGA or UAG.
• when terminator codon comes, it does not codes
for any amino acid. It leads to termination of
polypeptide chain.
• The poly peptide chain synthesized releases out
from ribosome. It undergoes folding to form
specific protein.
• The ribosome leaves the m-RNA.

90. Lac operon concept.
OR
Gene expression in prokaryotes.
OR
Inducesable operon concept.
Lac-operon concept was
first proposed by French
biologists Jacob and
Monad.
Experimentally they
demonstrated the
regulation of gene in
E.coli. 17 June 1920 (age 92) 9 February 1910 -
31 May , 1976.

91. • An operon is a group of genes that are
transcribed at the same time.
• The sequential arrangement of regulatory
gene, promoter gene, operator gene and
structural genes in prokaryotes is called
operon concept.

92. • The lac operon consists of three structural
genes. Each involved in processing the sugar
lactose
• One of them is the gene for enzyme β-
galactosidase. This enzyme hydrolyses lactose
into glucose and galactose.

93. Cultural situation for E.coli
1. When glucose is present and lactose is
absent the E. coli does not produce β-
galactosidase.
2. When glucose is absent and lactose is
present the E. coli produce β-galactosidase.

94. • E. coli can use either glucose, which is a
monosaccharide, or lactose, which is a disaccharide
• The lactose needs to be hydrolysed (digested) first
into glucose and galactose.
• Promoter gene: It is the site for attachment of RNA
polymerase II. It promotes the structural genes to
transcribe through operator gene.
• Operator gene: it operates and controls the
expression of structural genes.

95. • Regulator gene: It regulates the operator gene
incorporation with repressor chemical.
• Structural genes: Three structural genes are
present next to operator gene. They are,
– Lac Z : codes for enzyme β –galactosidase.
– Lac Y: codes for lactose permease
– Lac A: codes for enzyme thiogalactoside
transacetylase.

96. In absence of lactose. ( switched off
condition)

97. • The E.coli bacteria that cultured in absence of
lactose media, it would not produces the
enzyme β –galactosidase. That necessary for
lactose metabolism.

98. • In this condition structural genes are in
switched off.
• In absence of lactose, the repressor protein
synthesized by regulator gene binds to
operator gene.

99. • This blocks the RNA polymerase II to transcribe
structural gene.
• Hence enzymes are not produced.

100. In presence of lactose. ( switched on
condition

101. • The E.coli bacteria that are cultured in
presence of lactose media, it produces the
enzyme β –galactosidase. It is necessary for
lactose metabolism.

102. • In this condition structural genes are in switched
on.
• In presence of lactose, the repressor protein
synthesized by regulator gene binds to lactose
molecule. It forms repressor inducer complex.

103. • The inactive repressor complex does not binds
to operator gene.
• The RNA polymerase II transcribes structural
genes to produce enzymes.

105. • U.S. govt. started Human genome project in 1990
co-ordinated by the Department of Energy and the
National Institutes of Health.
• GENOME – The whole hereditary information of an
organism that is encoded in the DNA is called genome.
• . Human Genome Project (HGP) was called a mega
project because,
1. Human genome have approximately 3 x 109 bp. The
cost of sequencing required 3 US $ per bp. Then total
estimated cost of the project is 9 billion US dollars.
2. The obtained sequences were to be stored in typed
form in books. If each page of the book contained
1000 letters. each book contained 1000 pages. Then
3300 such books need to store information from a
single human cell.

106. • Aims or goal of the project:
1. To identify the approximate 20,000-25,000
genes in the human DNA.
2. To determine the sequences of the 3 billion
bases that make up human DNA.
3. To store this information in data bases.
4. To Improve tools for data analysis.
5. To address the ethical, legal, and social issues
that arise from genome research

107. • Methodologies :
• The methods involved two major approaches.
1. Identifying all the genes that expressed as RNA
(Expressed Sequence Tags - ESTs).
2. Blind approach of simply sequencing the whole set
of genome. That contained all the coding and non-
coding sequence. later assigning different regions
in the sequence with functions (Sequence
Annotation).

108. • Salient Features of Human Genome
• The human genome contains 3164.7 million nucleotide
bases.
• The average gene consists of 3000 bases, but sizes
varies.
• the largest known human gene being dystrophin has2.4
million bases.
• The total number of genes is estimated at 30,000. it is
lower than previous estimates of 80,000 to 1,40,000
genes.
• Almost all (99.9 per cent) nucleotide bases are exactly
the same in all people.
• The functions are unknown for over 50 per cent of
discovered genes.
• Less than 2 per cent of the genome codes for proteins.

111. • Repeated sequences make up very large portion of
the human genome.
• Chromosome 1 has most genes (2968), and the Y
has the fewest (231).
• Scientists have identified about 1.4 million locations
where singlebase DNA differences (SNPs – single
nucleotide polymorphism -‘snips.
• This information helps to finding chromosomal
locations for disease-associated sequences and
tracing human history.

113. DNA finger printing technology
• It is the technology used
for identification of
individual at genetic level.
• This technology was first
developed by alec Jeffreys,
in 1985.
• DNA fingerprinting
involves identifying
differences in some
specific regions in DNA
sequence called as
repetitive DNA,
Born: 9 January
1950 (age 62)
Oxford, United
Kingdom

114. • These repetitive DNA are separated from bulk genomic
DNA at different peaks during density gradient
centrifugation. The bulk DNA forms a major peak and
the other small peaks are referred to as satellite DNA.
• These sequences show high degree of polymorphism
and form basis of DNA fingerprinting.
• The inheritable mutation is observed in a population at
high frequency it is referred as DNA polymorphism.
• The principle of DNA finger printing is based on
matching of VNTRs of DNA collected at crime spot with
suspect person DNA.

115. • VNTRs: Variable number of tandem repeats. It is also
called as mini satellites that shows very high degree of
polymorphism.
• VNTRs are very specific to individual and differs from
person to person. It shows some similarities between
family members.
• VNTRs of identical twins are same. Hence it is not
possible to identify individuality in identical twins by
DNA finger printing technology.
• Southern blotting: It is the technique of transferring
DNA from agar gel to nylon sheath.
• Probe: Single stranded polynucleotide fragment
complementary to specific sequence of nucleotides of
DNA is called probe. It is mainly used in identify VNTRs
and desired gene

116. Steps involved in DNA finger printing
technology.

118. • The DNA finger printing technique involved
Southern blot and hybridisation using radiolabelled
VNTR as a probe. It included
I. isolation of DNA,
II. digestion of DNA by restriction endonucleases,
III. separation of DNA fragments by electrophoresis,
IV. transferring (blotting) of separated DNA fragments
to nylon sheath.
V. hybridisation using labelled VNTR probe,
VI. detection of hybridised DNA fragments by
autoradiography.

119. Application of DNA finger printing
technology.
1. It is used to identify criminals and rapist.
2. To solve parental dispute.
3. To solve immigrant problems.
4. To identify dead bodies of soldiers died in wars.
5. To identify dead bodies of person died at
accidents and bomb blast.
6. To identify racial groups.
7. To detect inheritable disorders.
8. To detect donor cell in case of transplantation.

120. • The DNA is isolated from the sample of blood
cells, hair root cells, semen or bone collected at
crime spot.
• The DNA of suspect also collected and isolated
separately.
• The isolated DNA is treated with REN to cut into
number of fragments.
• The DNA fragments are separated according to
their length on gel slab using gel electrophoresis.
• The DNA strand on gel slab is treated with
alkaline solution to split double strand in to single
strand.

121. • The single strand DNA is transferred to nylon
sheath using southern blotting technology.
• The single stranded DNA is hybridized with
radioactive probes of VNTRs . The excess of
probes are washed off.
• Nylon sheath is X-ray photographed to get
bands of VNTRs.
• The bands of X-ray sheath is the DNA finger
print.
• Comparing the DNA finger print of sample
collected at crime spot with suspect identifies
the individuality.

122. • Southern blotting: The technique of
transferring DNA from agar gel to nylon
sheath is called southern blotting.
• Probe: Single stranded polynucleotide
fragment complementary to specific
sequence of nucleotides of DNA is called
probe. It is mainly used in identify VNTRs
and desired gene