Downloaded 48 times
More Related Content
bioinfomatics
- 1. Introduction to bioinformatics Sylvia B. Nagl
- 2. What is bioinformatics? • an emerging interdisciplinary research area • deals with the computational management and analysis of biological information: genes, genomes, proteins, cells, ecological systems, medical information, robots, artificial intelligence...
- 3. The Core ofBioinformatics to date •Relationships between TDQAAFDTNIVTLTRFVM EQGRKARGTGEMTQLLNS LCTAVKAISTAVRKAGIA HLYGIAGSTNVTGDQVKK LDVLSNDLVINVLKSSFA TCVLVTEEDKNAIIVEPE KRGKYVVCFDPLDGSSNI DCLVSIGTIFGIYRKNST DEPSEKDALQPGRNLVAA GYALYGSATMLV sequence 3D structure protein functions •Properties and evolution of genes, genomes, proteins, metabolic pathways in cells •Use of this knowledge for prediction, modelling, and design
- 4. “The holy grailof bioinformatics” GCTCCTCACTGTCTGTGTTTATTC TTTTAGCTTCTTCAGATCTTTTAG TCTGAGGAAGCCTGGCATGTGCA AATGAAGTTAACCTAA... > 500, 000 genes sequenced to date Expected number of unique protein structures: ~ 700-1, 000
- 5. Basic concepts •conceptual foundations of bioinformatics: evolution protein folding protein function • bioinformatics builds mathematical models of these processes - to infer relationships between components of complex biological systems
- 6. Information processing incells coding regions regulatory sites nucleic acids transcripts proteins One-to-many mappings! Context-dependence!
- 7. Global approaches: Towarda new Systems Biology Global cell state Genome Genome activation patterns: transcriptomics Protein population: proteomics Organisation: tissue imaging EM X-ray, NMR cells molecular complexes •How does the spatial and temporal organisation of living matter give rise to biological processes?
- 8. Global approaches: Towarda new Systems Biology Perturbation Living cell Dynamic response “Virtual cell” Biological knowledge (computerised) Sequence information Structural information •Basic principles •Practical applications Bioinformatics Mathematical modelling Simulation
- 9. We do notknow yet whether the information in the genome is sufficient to reconstruct an entire biological system. Information on building blocks not enough, information on their interactions is essential. External environment Internal environment Metabolic net Genetic networks DNA hRNA mRNAs proteins
- 10. Bioinformatics in context Genomics Molecular Biophysics biology Molecular evolution Ethical, legal, and social implications Bioinformatics Mathematics/ computer science
- 11. Current challenges tousers • Potential hurdles: Methods are in flux and not fully developed-scattered and heterogeneous resources • Remedies: Web resources navigation guides integration of tools and databanks http://www.biochem.ucl.ac.uk/~nagl/bioinformatics.html
- 12. Example 1 Sequencehomology search of the genome of Plasmodium falciparum Target identification for antimalerial drugs
- 13. The search fornew antimalarial drugs • Malaria is one of the leading causes of morbidity and mortality in the tropics. • 300 to 500 million estimated clinical cases and 1.5 million to 2.7 million deaths per year. • Nearly all fatal cases are caused by Plasmodium falciparum. • The parasite's resistance to conventional antimalarial drugs such as chloroquine is growing at an alarming rate.
- 14. •P. falciparum hasa plastidlike organelle, called the apicoplast, acquired by endosymbiosis of an alga. Jomaa et al. (1999) •Self-replicating, maternally inherited (35kb, circular DNA). •Comparative genome analysis: Search for orthologs. Apicoplast contains enzymes found in plant and bacterial, but not animal metabolic pathways. •Potential target for antimalerial drugs: DOXP reductoisomerase
- 15. Jomaa et al.(1999) Science 285: 1573-1576:
- 16.
- 17. (Boguski, 1999) Thechallenge In 1995, the number of genes in the database started to exceed the number of papers on molecular biology and genetics in the literature!
- 18. Data types primarydata secondary data tertiary data sequence DNA amino acid AATGCGTATAGGC DMPVERILEALAVE primary database secondary “motifs”: regular protein structure expressions, blocks, profiles, fingerprints e. g., alpha-helices, beta-strands secondary db tertiary protein structure domains, folding units tertiary db atomic co-ordinates
- 19. Primary biological databases • Nucleic acid EMBL GenBank DDBJ (DNA Data Bank of Japan) • Protein PIR MIPS SWISS-PROT TrEMBL NRL-3D
- 20. International nucleotide databanks EMBL Europe EMBL EBI GenBank USA NLM NCBI International Advisory Meeting Collaborative Meeting DDBJ Japan NIG CIB TrEMBL NRDB
- 21.
- 22.
- 23.
- 24.
- 25.
- 26.
- 27.
- 28. Other primary proteindatabases • TrEMBL (translated EMBL) in SWISS-PROT format rapid access to sequence data from genome projects computer-annotated supplement to SWISS-PROT translations of all coding sequences (CDS) in EMBL • SP-TrEMBL • REM-TrEMBL: immunoglobulins, T-cell receptors, short fragments, synthetic and patented sequences
- 29. Other primary proteindatabases The Protein Information Resource (PIR) • integrated system of protein sequence databases and derived related databases, e. g., alignment databases • rapid searching, comparison, and pattern matching of protein sequences • retrieval of descriptive, bibliographic, feature, and concurrent cross-reference information • aims to be comprehensive and consistently annotated
- 30. PIR: related databases NRL-3D Sequence-Structure Database • produced by PIR from sequence and annotation information extracted from three-dimensional structures in the Protein Databank (PDB) • allows keyword and similarity searches
- 31. PIR: related databases PATCHX integrated with PIR • a non-redundant database of protein sequences produced by MIPS, the European branch of PIR-International The PIR Protein Sequence Database and PATCHX together provide the most complete collection of protein sequence data currently available in the public domain.
- 32. Composite protein sequencedbs NRDB OWL MIPSX(PIR+PATCHX) SP+TrEMBL PIR PIR PIR TrEMBL SP SP SP SP PDB GenBank MIPSOwn GenPept NRL-3D NRL-3D MIPSH PIRMOD MIPSTrn EMTrans GBTrans Kabat PseqIP
- 33. OWL composite database OWL only released every 6-8 weeks By accession number • By database code • By text • By sequence • By title • By author • By query language • By regular expression Direct OWL access: OWL Blast server
- 34. Two other usefulsites INFOBIOGEN-The Public Catalog of Databases http://www.infobiogen.fr/services/dbcat/ KEGG-Kyoto Encyclopedia of Genes and Genomes http://www.genome.ad.jp/kegg/ Kyoto Encyclopedia of Genes and Genomes (KEGG) is an effort to computerize current knowledge of molecular and cellular biology in terms of the information pathways that consist of interacting molecules or genes and to provide links from the gene catalogs produced by genome sequencing projects.
- 35. Sequence Retrieval System(SRS) Database browser that allows users to •retrieve •link •access entries from all interconnected resources. Users can formulate queries across a range of different database types.
- 36. Guide to ProteinDatabases: http://www.biochem.ucl.ac.uk/~robert/bioinf /lecture1/index.html http://www.biochem.ucl.ac.uk/~robert/bioinf/lecture2/index .html With thanks to Dr Roman Laskowski.