translation of mRNA to a polypeptide

1. 1
2
3 4
5
6
7
8
Identify the
name of each
enzyme or
nucleic acid for
numbers 1-8

2. All late work due by Monday Feb 1st

3. From Genes to Proteins -
Translation
Ch. 14

4. AP Biology Plans for the week of January 25th
through January
29th
, 2016
• Monday 1-25-16: Ch. 14 part 1 notes
• Tuesday 1-26-16: Ch. 14 part 2 notes
• Wednesday 1-27-16: big group diagram of transcription and
translation
• Thursday & Friday 1-28 & 1-29: Review and practice questions
for Ch. 13 and 14
Homework: Study Fig 14.24 on page 287 for a diagram quiz on MONDAY 2-1-16

5. To assist you in your note
taking…
Key vocabulary terms are in
green, bold, underlined font

6. Overview of Concepts
1. The genetic code is a triplet
code
2. Translation is directed by RNA
molecules
3. RNA plays many different roles
in protein synthesis
4. Point mutations may affect
protein formation

7. Objective
Describe the process of translations
Identify the role each type of RNA
plays in the process

8. The triplet code
There are 20 amino
acids (the monomers of
proteins) but only 4
nucleotides (the
monomers of nucleic
acids)
How can just 4 bases
code for 20 different
amino acids?

9. The triplet code
The genetic code is
based on triplets of
bases: a series of non-
overlapping, three
nucleotide “words”
We call these base
triplets in the mRNA
codons
How did scientists
figure out it was 3
bases for each codon?

10. The triplet code
4 nucleotides (A,C,T,G) x 1 in a sequence =
4
different combinations
4 nucleotides x 2 in a sequence =
16 different
combinations
4 different nucleotides x 3 in a sequence =
64
different combinations (for 20 AA’s)

11. The triplet code
The code is redundant
but unambiguous
Each codon codes for only
1 amino acid -
unambiguous
Some amino acids are
coded for by more than
one codon - redundant
Only UGG codes for
tryptophan
AGU, AGC, UCA, UCC, UCG,
UCU all code for serine

12. How did scientists figure out what
amino acid each codon codes for?
1960s - Nierenberg & Mathaei
Used artificial RNA triplets in
tubes with the components for
building proteins
Made chains of uracil first -
UUUUUUUUU
Got all phenylalanines in a chain, so
UUU must code for phenylalanine.
Within a few years, they had
decoded all 64 codons

13. What is translation?
Translation is the
process by which a
cell interprets the
codons along an
mRNA molecule and
builds a polypeptide

14. Who translates the code?
Transfer RNA (tRNA)
is the interpreter of
the genetic code
tRNA is the molecule
responsible for
converting the genetic
code of nucleotides
toto the protein code of
amino acids

15. How does tRNA work?
The cell already has all 20
amino acids in its cytoplasm
(either makes them itself or they are
taken in through the organism’s diet)
Each tRNA is a strand about
80 bases long
Some bases are
complementary to each
other so it can hydrogen
bond to itself
Takes on a clover-leaf shape

16. tRNA
On one end of the tRNA
is an amino acid
On the other end is an
anticodon
The anticodon is
complementary to the
codon in the mRNA

17. So codon by
codon, the tRNAs
deposit amino
acids in the
prescribed order,
and the ribosome
joins them into a
polypeptide chain

18. Some practice
 DNA template strand:
ACCGGTCAGTAC
1. Make the mRNA from this template
2. What will be the tRNA anticodons?

19. Which of the following is NOT true of a codon?
A. It consists of three nucleotides.
B. It is the basic unit of the genetic code.
C. It never codes for more than one amino acid.
D. It may code for the same amino acid as another codon.
E. It extends from one end of a tRNA molecule.

20. The anticodon of a particular tRNA molecule is __________.
A. complementary to the corresponding triplet in rRNA
B. complementary to the corresponding mRNA codon
C. catalytic, making the tRNA a ribozyme
D. changeable, depending on the amino acid that attaches to
the tRNA
E. the part of tRNA that bonds to a specific amino acid

21. Which of the following is NOT true of RNA processing?
A. RNA splicing can be catalyzed by spliceosomes.
B. A primary transcript is often much longer than the final
RNA molecule that leaves the nucleus.
C. Nucleotides may be added at both ends of the RNA.
D. Ribozymes may function in RNA splicing.
E. Exons are cut out before mRNA leaves the nucleus

22. Ribosomes
Ribosomes are the sites of
protein synthesis
They are made up of
ribosomal RNA (rRNA) &
protein
Composed of 2 subunits:
large & small
Subunits are made in the
nucleolus
They join together at the
mRNA to make a functional
ribosome

23. Quick Think
What are the 3 types of RNA and what
do they do?

24. Ribosomes
Ribosomes bring
together the mRNA
and the tRNAs bearing
the correct amino
acids and bond those
amino acids in the
correct order
There are 3 sites on
the ribosome that
function in this
capacity: the E site,
the P site, and the A
site

25. A site - holds the tRNA with the next amino
acid to be added to the chain
P site - holds the tRNA carrying the growing
polypeptide chain
E site - releases tRNAs from the ribosome
here
P
A

26. Let’s practice
• mRNA reads:
AUGCCCGACUACGGACGACGGUUUACGUGGGGCCUC
• What amino acids do we need?

29. AUGCCCGACUACGGACGACGGUUUACGUGGGGCCUCUAG
AUG = methionine
CCC = proline
GAC = aspartic acid
UAC = tyrosine
GGA = glycine
CGA = arginine
CGG = argnine
UUU = phenylalanine
ACG = threonine
UGG = tryptophan
GGC = glycine
CUC = leucine
UAG = stop

30. Come forward
• Would the tRNA with methionine please come
up and bring the amino acid for this protein?
– What is the anticodon?
•UAC
AUGCCCGACUACGGACGACGGUUUACGUGGGGCCUC
AUG = methionine
CCC = proline
GAC = aspartic acid
UAC = tyrosine
GGA = glycine
CGA = arginine
CGG = argnine
UUU = phenylalanine
ACG = threonine
UGG = tryptophan
GGC = glycine
CUC = leucine
UAG = stop – release factor

31. Translation has 3 stages
Initiation
Elongation
Termination

32. Initiation
mRNA, the first tRNA with the first
amino acid, and the large & small
subunits of the ribosome come together
The first amino acid is methionine
(codon AUG, the start codon)
This establishes the reading frame
The whole thing is
called a “translation
initiation complex”
and GTP energy is
required to build it

33. Elongation
 More amino acids
are added to the
growing chain
 There are 3
steps catalyzed
by protein
elongation
factors

34. STEP 1 - Codon Recognition
 the anticodon on the
tRNA H-bonds with the
codon in the A site
1. 2 GTPs for energy are
used up here
2. An elongation factor
protein catalyzes this
step

35. STEP 2 - Peptide Bond Formation
The large subunit catalyzes the formation of a
peptide bond between the amino acid in the
A site and the amino acid in the P site

36. STEP 3 -
Translocation
The ribosome
moves the tRNA
in the A site to
the P site
The empty tRNA in
the P site is
moved to the E
site and released
GTP energy is
required here

38. Termination
Happens when one of the 3 stop
codons reaches the A site on the
ribosome
A release factor protein binds to the
stop codon & hydrolysis occurs to free
the polypeptide chain

39. Which component is NOT directly involved in translation?
A. mRNA
B. DNA
C. ribosomes
D. tRNA
E. GTP

40. Which of the following mutations would be most likely to
have a harmful effect on an organism?
A. a single nucleotide deletion near the end of the coding
sequence
B. a deletion of three nucleotides near the middle of a gene
C. a single nucleotide deletion in the middle of an intron
D. a nucleotide-pair substitution
E. a single nucleotide insertion downstream of, and close to,
the start of the coding sequence

41. Polyribosomes
Several ribosomes
can be working at
the same mRNA
strand at the same
time
Strings of these
ribosomes are called
polyribosomes
This helps the cell
make more proteins
more quickly

42. Proteins
As the polypeptide chain
is being formed, it will
begin to coil & fold in to
its 3-D shape
The gene determines
the order of the amino
acids - the primary
structure
The primary structure
determines the
secondary and tertiary
structure

43. Proteins
Proteins may be further
modified by the addition
of sugars, lipids, or
phosphate groups
Enzymes may cleave the
polypeptide chain into
smaller chains
2 or more polypeptide
chains may join to make
the quaternary structure
of a functional protein

44. Proteins
All translation begins in the cytosol on free
ribosomes
If the protein is destined to become part
of an organelle or is to be shipped outside
the cell, the ribosome will move to the ER
and become an attached ribosome

45. Proteins
signal recognition particle (SRP)
brings the ribosome to the ER and
translation continues there

46. Types of RNA
mRNA - messenger RNA (the
code)
tRNA - transfer RNA (brings
amino acids)
rRNA - ribosomal RNA (the
ribosome)
Pre-mRNA - the primary
transcript before editing
snRNA - part of sliceosomes
SRP RNA - part of the signal
recognition particle
& others

48. What makes RNA so versatile?
1. It can H-bond to
itself & to other
nucleic acids
2. It has functional
groups that allow it
to act as an enzyme

49. Point Mutations
A point mutation is a
change in a single base pair
in a gene
They can have catastrophic
consequence, or none at all
There are 3 main types:
Substitution
Insertion
Deletion

50. Substitution mutations
A base pair is replaced with a different
base pair
Because there is redundancy in the genetic
code, this may cause no problem at all
It could also lead to a malformed protein
and be the difference between life and
death

51. Substitution
Think of it like a sentence:
Normal sentence would read
THE DOG BIT THE CAT
A point mutation might make the sentence
read:
THE DOG BIT THE CAR
This changes the meaning of the sentence, but
not dramatically.

52. Changing a single base can cause a
dramatic change:
The base change codes for a different
amino acid, making a different protein
Example: sickle cell anemia

53. Changing a single base
may not cause any
change at all:
The changed base may still
code for the same amino
acid
Proline is coded for by
CCC, CCA, CCG, and CCU,
So a change in the last base
won’t make any difference
to the amino acid that is
added to the protein
chain.

54. Insertions & Deletions
•These mutations add an extra
letter or two or delete letters
•These mutations disrupt the
reading frame and are usually
more severe
•Because of this they are called
frameshift mutations

55. Frameshift Mutations
Think of it as a sentence again:
THE DOG BIT THE CAT
Adding an extra letter makes it:
THH EDO GBI TTH ECA T
It changes the entire sentence to nonsense.
This kind of mutation has a more dramatic
effect on the DNA sequence and is usually
lethal