Downloaded 37 times
Uploaded byProf. Wim Van Criekinge
2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
The document discusses next generation molecular profiling techniques. It begins with an overview of personalized medicine and biomarkers, then describes first generation molecular profiling methods like gene sequencing, microarrays, and fluorescence in situ hybridization. It then covers next generation sequencing technologies like Roche 454, Illumina, and ABI SOLID that allow high-throughput sequencing of DNA and RNA. Finally, it discusses next generation epigenetic profiling through techniques like methylation analysis and histone modification detection.
More Related Content
Similar to 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
More from Prof. Wim Van Criekinge
![Bio ontologies and semantic technologies[2]](https://cdn.slidesharecdn.com/ss_thumbnails/bioontologiesandsemantictechnologies2-180509123734-thumbnail.jpg?width=640&height=640&fit=bounds)
2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
- 1. Next Generation MolecularProfiling 26 oktober 2011 Auditorium J, Plateau, Gent
- 2. Lab for Bioinformaticsand computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers, mathematicians, molecular biologists
- 3. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
- 8. Personalized Medicine • Theuse of diagnostic tests (aka biomarkers) to identify in advance which patients are likely to respond well to a therapy • The benefits of this approach are to – avoid adverse drug reactions – improve efficacy – adjust the dose to suit the patient – differentiate a product in a competitive market – meet future legal or regulatory requirements • Potential uses of biomarkers – Risk assessment – Initial/early detection – Prognosis – Prediction/therapy selection – Response assessment – Monitoring for recurrence
- 9. Biomarker First used in1971 … An objective and « predictive » measure … at the molecular level … of normal and pathogenic processes and responses to therapeutic interventions Characteristic that is objectively measured and evaluated as an indicator of normal biologic or pathogenic processes or pharmacologic response to a drug A biomarker is valid if: – It can be measured in a test system with well established performance characteristics – Evidence for its clinical significance has been established
- 10. Rationale 1: Why now? Regulatory path becoming more clear There is more at stake than efficient drug development. FDA « critical path initiative » Pharmacogenomics guideline Biomarkers are the foundation of « evidence based medicine » - who should be treated, how and with what. Without Biomarkers advances in targeted therapy will be limited and treatment remain largely emperical. It is imperative that Biomarker development be accelarated along with therapeutics
- 11. Why now ? Firstand maturing second generation molecular profiling methodologies allow to stratify clinical trial participants to include those most likely to benefit from the drug candidate—and exclude those who likely will not—pharmacogenomics- based Clinical trials should attain more specific results with smaller numbers of patients. Smaller numbers mean fewer costs (factor 2-10) An additional benefit for trial participants and internal review boards (IRBs) is that stratification, given the correct biomarker, may reduce or eliminate adverse events.
- 12. Molecular Profiling The studyof specific patterns (fingerprints) of proteins, DNA, and/or mRNA and how these patterns correlate with an individual's physical characteristics or symptoms of disease.
- 13. Generic Health advice •Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolarance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
- 14. Generic Health advice(UNLESS) • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolarance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
- 15. Generic Health advice(UNLESS) • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolerance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
- 16. Generic Health advice(UNLESS) • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolerance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
- 17. EGFR based therapyin mCRC
- 18. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
- 19.
- 23.
- 24.
- 26. First Generation MolecularProfiling • Flow cytometry correlates surface markers, cell size and other parameters • Circulating tumor cell assays (CTC’s) quantitate the number of tumor cells in the peripheral blood. • Exosomes are 30-90 nm vesicles secreted by a wide range of mammalian cell types. • Immunohistochemistry (IHC) measures protein expression, usually on the cell surface.
- 30. First Generation MolecularProfiling • Gene sequencing for mutation detection • Microarray for m-RNA message detection • RT-PCR for gene expression • FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for gene copy number
- 31. Basics of the―old‖ technology • Clone the DNA. • Generate a ladder of labeled (colored) molecules that are different by 1 nucleotide. • Separate mixture on some matrix. • Detect fluorochrome by laser. • Interpret peaks as string of DNA. • Strings are 500 to 1,000 letters long • 1 machine generates 57,000 nucleotides/run • Assemble all strings into a genome.
- 33. Genetic Variation AmongPeople Single nucleotide polymorphisms (SNPs) GATTTAGATCGCGATAGAG GATTTAGATCTCGATAGAG 0.1% difference among people
- 34. The genome fitsas an e-mail attachment
- 35. First Generation MolecularProfiling • Gene sequencing for mutation detection • Microarray for m-RNA message detection • RT-PCR for gene expression • FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for gene copy number
- 36.
- 37. First Generation MolecularProfiling • Gene sequencing for mutation detection • Microarray for m-RNA message detection • RT-PCR for gene expression • FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for gene copy number
- 39. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
- 40. Basics of the―new‖ technology • Get DNA. • Attach it to something. • Extend and amplify signal with some color scheme. • Detect fluorochrome by microscopy. • Interpret series of spots as short strings of DNA. • Strings are 30-300 letters long • Multiple images are interpreted as 0.4 to 1.2 GB/run (1,200,000,000 letters/day). • Map or align strings to one or many genome.
- 41. Next Generation Technologies •Roche (454) –Emulsion PCR –Polymerase –Natural Nucleotides • 100-500 Mb for 5-15k –1% error rate –Homopolymers
- 46.
- 47. Read Length isNot As Important For Resequencing 100% % of Paired K-mers with Uniquely 90% 80% Assignable Location 70% 60% E.COLI 50% HUMAN 40% 30% 20% 10% 0% 8 10 12 14 16 18 20 Length of K-mer Reads (bp) Jay Shendure
- 48. Short Read Techologies •Illumina GA (HiSeq, MySeq) • ABI SOLID
- 52. Other second generationtechnology: (ABI) SOLID
- 54.
- 56. Second generation DNA/RNAprofiling
- 57. Second Generation DNAprofiling • Enrichment Sequencing • ChIP-Seq (Chromosome Immunoprecipitation) • A substitute for ChIP-chip • Eg. to find the binding sequence of proteins (TFBS)
- 58. Paired End Readsare Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
- 59. Paired End Readsare Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
- 60. Second Generation DNAprofiling • Exome Sequencing (aka known as targeted exome capture) is an efficient strategy to selectively sequence the coding regions of the genome to identify novel genes associated with rare and common disorders. • 160K exons
- 61. Second Generation DNAprofiling
- 62. Second Generation DNAprofiling
- 63.
- 64.
- 65. Second Generation RNAprofiling Besides the 6000 protein coding-genes … 140 ribosomal RNA genes 275 transfer RNA gnes 40 small nuclear RNA genes >100 small nucleolar genes Function of RNA genes pRNA in 29 rotary packaging motor (Simpson et el. Nature 408:745-750,2000) Cartilage-hair hypoplasmia mapped to an RNA Contents-Schedule (Ridanpoa et al. Cell 104:195-203,2001) The human Prader-Willi ciritical region (Cavaille et al. PNAS 97:14035-7, 2000)
- 66. Second Generation RNAprofiling RNA genes can be hard to detects UGAGGUAGUAGGUUGUAUAGU C.elegans let-27; 21 nt (Pasquinelli et al. Nature 408:86-89,2000) Often small Sometimes multicopy and redundant Often not polyadenylated (not represented in ESTs) Immune to frameshift and nonsense mutations No open reading frame, no codon bias Often evolving rapidly in primary sequence
- 67. Second Generation RNAprofiling Although details of the methods vary, the concept behind RNA-seq is simple: • isolate all mRNA • convert to cDNA using reverse transcriptase • sequence the cDNA • map sequences to the genome The more times a given sequence is detected, the more abundantly transcribed it is. If enough sequences are generated, a comprehensive and quantitative view of the entire transcriptome of an organism or tissue can be obtained.
- 68. Second Generation RNAprofiling • Comparing to microarray – Microarray • Closed technology: Prior knowledge required • Affected by pseudo-genes (homologous of real genes) • Low sensitivity – RNA-Seq • Open technology: No prior knowledge required • Not affected by pseudo-genes because exact sequence is measured • Other information could be yielded (SNP, Alternative splicing)
- 69. ncRNAs in humangenome tRNA 600 SRP RNA 1 18S rRNA 200 RNase P RNA 1 5.8S rRNA 200 Telomerase RNA 1 28S rRNA 200 RNase MRP 1 5S rRNA 200 Y RNA 5 snoRNA 300 miRNA 250 Vault 4 U1 40 7SK RNA 1 U2 30 Xist 1 U4 30 H19 1 U5 30 BIC 1 U6 20 U4atac 5 Antisense RNAs 1000s? U6atac 5 Cis reg regions 100s? U11 5 U12 5 Others ?
- 71. Mapping Structural Variationin Humans >1 kb segments - Thought to be Common 12% of the genome (Redon et al. 2006) - Likely involved in phenotype variation and disease CNVs - Until recently most methods for detection were low resolution (>50 kb)
- 72. Size Distribution ofCNV in a Human Genome
- 74. Next next generationsequencing Third generation sequencing Now sequencing
- 75. Ultra-low-cost SINGLE moleculesequencing
- 76. Pacific Biosciences: AThird Generation Sequencing Technology Eid et al 2008
- 77.
- 78.
- 79. Second Generation Proteinprofiling • Proteomics MS-MS-based exclusively in discovery mode • Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
- 80. MS/MS identification pipeline overview pipeline Goal filter dataset Goal prior to multi-tiered database Goal search database Bonanza define PTMs search profile prior to database search Bonanza + IggyPep
- 81. Second Generation Proteinprofiling • Proteomics MS-MS-based exclusively in discovery mode • Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
- 82. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
- 83. Defining Epigenetics Genome DNA Reversible changes in gene expression/function Without changes in DNA Chromatin sequence Epigenome Can be inherited from precursor cells Gene Expression Allows to integrate intrinsic with environmental signals Phenotype (including diet) CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 84. CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 85. Epigenetic Regulation: Post TranslationalModifications to Histones and Base Changes in DNA Epigenetic modifications of histones and DNA include: – Histone acetylation and methylation, and DNA methylation Histone Methylation Me Me Histone Me Acetylation Ac DNA Methylation CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 87. MGMT Biology O6 Methyl-Guanine MethylTransferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 88. MGMT Promoter Methylation Predicts Benefitform DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation Median Overall Survival 25 21.7 months 20 plus temozolomide 15 12.7 months 10 radiotherapy radiotherapy 5 Adapted from Hegi et al. NEJM 2005 0 352(10):1036-8. Non-Methylated Methylated Study with 207 patients MGMT Gene MGMT Gene CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 89. Genome-wide methylation by methylationsensitive restriction enzymes CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 90. Genome-wide methylation by probes CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 91. MBD_Seq Condensed Chromatin DNA Sheared Immobilized Methyl Binding Domain DNA Sheared CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 92. MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
- 93. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
- 94. Bioinformatics, a lifescience discipline … management of expectations Math Computer Science Theoretical Biology NP AI, Image Analysis Datamining structure prediction (HTX) Bioinformatics Discovery Informatics – Computational Genomics Interface Design Expert Annotation Sequence Analysis (Molecular) Informatics Biology Computational Biology
- 95. Translational Medicine: Aninconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes ?? • Space/time continuum …
- 96. Translational Medicine: Aninconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes … • ―space/time‖ continuum
- 99. Cellular programming Epigenetic (meta)information = stem cells
- 100. Cellular reprogramming Tumor Tumor Development and Growth Epigenetically altered, self- renewing cancer stem cells
- 101. Cellular reprogramming Gene-specific Epigenetic reprogramming
- 102.