شرائح محاضرة التلسكوبات الحديثة و ملحقاتها و التي تم عرضها في الجمعية الفلكية الأردنية. دليل أدوات رصد السماء بصرياً و ملحقاتها المساندة للراصد الفلكي الهاوي و المحترف
شرائح محاضرة التلسكوبات الحديثة و ملحقاتها و التي تم عرضها في الجمعية الفلكية الأردنية. دليل أدوات رصد السماء بصرياً و ملحقاتها المساندة للراصد الفلكي الهاوي و المحترف
Training Material inherited form Philips Basics of Ultrasonography. Covers the fundamentals of Ultrasound Waveform, Piezoelectric Effect, Phased Echo Concept, Goal of Ultrasound, Ultrasound Image Construction process, Types of Resolution, Probe Internals, The Doppler Effect, Spectrum Waveform and concept, Color Doppler, Components of Ultrasound.
Training Material inherited form Philips Basics of Ultrasonography. Covers the fundamentals of Ultrasound Waveform, Piezoelectric Effect, Phased Echo Concept, Goal of Ultrasound, Ultrasound Image Construction process, Types of Resolution, Probe Internals, The Doppler Effect, Spectrum Waveform and concept, Color Doppler, Components of Ultrasound.
A l’occasion du 13 août 2014, Journée Nationale de la Femme, qui marque la date anniversaire de la promulgation du Code du Statut Personnel (CSP) ayant doté la femme tunisienne d’un statut unique et privilégié dans le monde arabe, l’Union européenne est heureuse de publier le "Profil Genre de la Tunisie".
Ce document, préparé dans le cadre de la coopération de l’Union européenne avec le Gouvernement de la République tunisienne, a pour objectif de mieux prendre en considération les questions liées au genre.
كيف تختار البرنامج التدريبي الأنسب لك ولموظفيكالمشرف العام
ما أهمية التدريب في حياتك:
التدريب عملية أساسية في نقل الخبرات والتجارب بين الناس. ولا يمكن لانسان أن يحقق نجاحاً وتميزا في مجال ما دون أن يحصل على التدريب الكافي على ايدي خبراء في هذا المجال.
لماذا انت في حاجة الى التدريب :
1. لأن التأهيل العلمي الجامعي والاكاديمي اصبح منفصلا عن الواقع لا يقدم خبرات عملية تساعدك في حياتك العملية وأصبح اهتمام البرامج التعليمية منصباً على الجوانب النظرية والاكاديمية.
2. لأن الواقع يتغير بسرعة والمعارف تتبدل ويجب عليك مواكبة هذا الواقع المتغير. فطرق الانتاج والادارة والتسويق وغيرها تتغير بسرعة مذهلة ولا يمكنك الحصول على خبرات عملية حديثة بدون التدريب
3. لأن المنافسة قوية. ومنافسوك يعتمدون على التدريب في تحقيق التميز.
4. لأن هدفك يستحق. وما ستجنيه من راحة وامتيازات وظيفية وحياتية بعد التدريب يستحق
5. لأن التدريب يعزز الثقة بالنفس ويجعلك في مصاف الخبراء والمحترفين
6. لتقوية مهاراتك وتعزيز سماتك الشخصية التي تؤهلك للعمل في المجال الذي تحبه
Auteurs : Souheil HOUISSA et Olfa CHATER
Institut Supérieur de Documentation, Université de la Manouba, Tunisie
Résumé: L'accès gratuit, en ligne, et sans la plupart des restrictions juridiques aux contenus des revues
scientifiques numériques est un grand privilège pour les utilisateurs, c'est la «voie dorée » du libre accès à l'information scientifique et technique.
Cette contribution explore les données sur les revues arabes en libre accès du répertoire Directory of Open Access Journals (DOAJ) croisées avec celles de African Journals Online (AJOL), afin d’étudier leur représentativité en fonction de leur répartition géographique, modèle d’édition, langue et leur couverture thématique. Les résultats de cette étude révèlent que les revues arabes en libres accès sont beaucoup moins nombreuses que celles du modèle de l’édition électronique traditionnel mais leur nombre augmente de plus en plus rapidement passant au cours des dix dernières années de 6 titres en 2003 à 409 titres en 2013. Cependant, ces revues sont généralement très peu référencées dans les principaux répertoires et portails d’accès aux revues et plusieurs d’entre elles ne sont pas indexées par les moteurs de recherche spécialisés. L’investigation a dévoilé, que les politiques éditoriales d’un grand nombre des revues arabes recensées ne sont pas conformes aux principes fondamentaux d’édition des revues en libre accès et en particulier celles relatives aux droits d’accès, à la conformité des métadonnées et aux modes de financement.
The material of a talk that I prepared to give in the online camel conference of Oman. Unfortunately, I had a death in the family the day before the conference and the material was presented by my friend Dr. Mohammed Alabri from Oman. The material is in Arabic and focused for camel breeders.
The material of a two days workshop that I gave at Sultan Qaboos University in Oman about the importance of livestock biobanks and how to establish an organized one. The workshop was given in Arabic.
A presentation as a webinar for the Winn Feline Foundation that focuses on recent findings related to the signatures of selection in the domestic cat genome
This was my presentation at the Plant and Animal Genome Conference 2019 in San Diego. My talk was a presentation of the thesis project of my student Mona Abdi. The focus of the presentation and project was the genomic signatures of selection in the domestic cat breeds.
This is a my lecture about camels title "Journey around the camel". The lecture was in Arabic and is related to a book under preparation with the same title. This part of the journey around the camel introduces the major camel breeds in the Arabian Peninsula and their external phenotypes and groupings.
This lecture covers some nice stories about the origins of the words "genome" and the derived word "genomics". the lecture also introduces viral, bacterial, and eukaryotic genomes.
This lecture covers key findings to the development of genomics as a field. This first part covers briefly Mendel to knowing that DNA is the genetic material by Hershey and Chase
13. HAGenetics.org
IK_ 3%م ا) 4 ا)'ة 2ب E
ATGCCATCACAAATGCGG
CTATGCCATGACAAATGC
GGCTAATGCCATGACAAAT
GCGGCTAATGCCATGACAA
ATGCGGCTAATGCCATGAC
AAATGCGGCTACATGACAA
ATGCGGCTAATGCCATGAC
AAATGCGGCTAATCATGAC
AAATGCGGCTACATGACCA
TGACAAATGCGGCTACATG
ACAACAACAACAACAACAA
CAACAACAACAACATATATA
TATATATATATATATATATATAT
ATATATATATATATATATATATA
TATATATATATATATATATATAT
ATATATATATATATATATATATA
TATATATATATATATATATATAT
ATATATATATATATATATATATA
TATATATATATATATATATATAT
Met-Pro-Ser-Met-Arg-Lue-Cys-
His-Asp-Lys-Cys-Gly-stop
aÖ%_ و داء %X ن%.à3I ا
Bla bla bla bla bla
More bla bla bla bla