This document provides an overview and introduction to bioinformatics. It discusses the large amounts of biological sequence data that have been generated and how bioinformatics is needed to analyze this data computationally. The document outlines topics that will be covered, including databases, sequence alignment tools like BLAST, gene finding, and protein analysis. Practical workshops are described that will involve database searching, multiple sequence alignments, and interpreting results to understand molecular biology and solve biomedical problems. Questions are welcomed throughout the workshops.
Bioinformatics involves the analysis of biological information using computers and statistical techniques,
In bioinformatics, a sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity that may be a consequence of functional, structural, or evolutionary relationships between the sequences.
The sequence alignment is made between a known sequence and unknown sequence or between two unknown sequences. The known sequence is called reference sequence. The unknown sequence is called query sequence .
BLAST stands for Basic Local Alignment Search Tool. It addresses a fundamental problem in bioinformatics research. BLAST tool is used to compare a query sequence with a library or database of sequences.
In Bioinformatics, is an algorithm and program for comparing primary biological sequence information, such as the amino-acid sequences of proteins or the nucleotides of DNA and/or RNA sequences.
BLAST was developed by stochastic model of Samuel Karlin and Stephen Altschul in 1990. They proposed “a method for estimating similarities between the known DNA sequence of one organism with that of another”.
A BLAST search enables a researcher to compare a subject protein or nucleotide sequence (called a query sequence) with a library or database of sequences and identify database sequences that resemble the query sequence above a certain threshold.
Bioinformatics involves the analysis of biological information using computers and statistical techniques,
In bioinformatics, a sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity that may be a consequence of functional, structural, or evolutionary relationships between the sequences.
The sequence alignment is made between a known sequence and unknown sequence or between two unknown sequences. The known sequence is called reference sequence. The unknown sequence is called query sequence .
BLAST stands for Basic Local Alignment Search Tool. It addresses a fundamental problem in bioinformatics research. BLAST tool is used to compare a query sequence with a library or database of sequences.
In Bioinformatics, is an algorithm and program for comparing primary biological sequence information, such as the amino-acid sequences of proteins or the nucleotides of DNA and/or RNA sequences.
BLAST was developed by stochastic model of Samuel Karlin and Stephen Altschul in 1990. They proposed “a method for estimating similarities between the known DNA sequence of one organism with that of another”.
A BLAST search enables a researcher to compare a subject protein or nucleotide sequence (called a query sequence) with a library or database of sequences and identify database sequences that resemble the query sequence above a certain threshold.
Building Genomic Data Processing and Machine Learning Workflows Using Apache ...Databricks
Epinomics is advancing epigenetic research to drive personalized medicine, using epigenomic data analysis. Their goal is to provide an analysis resource to the community that will promote high-quality data and replicable and interpretable results. They work with academic and commercial users to ingest and analyze their genomic sequencing data and metadata. They extract epigenetic features from the sequenced genome, called “chromatin accessibility”, which are indicative of instrumental epigenetic changes responsible for differential gene expression and disease development.
Epinomics has built an Apache Spark-based pipeline that retrieves chromatin accessibility data from the epigenome, uses GraphX to find overlapping accessibility atlas and then clusters the data and runs machine learning algorithms. This session will provide a primer on epigenomics, details about Epinomics’ Spark-based data pipeline focusing on parallel bioinformatic analysis, and how they use machine learning models to build the epigenomic landscape and accelerate the field of personalized immunotherapy. use GraphX to find overlapping accessibility atlas and then cluster the data and run machine learning algorithms.
In this talk we will provide a primer on epigenomics, details about our Spark based data pipeline focusing on parallel bioinformatic analysis and how we use machine learning models to build the epigenomic landscape and accelerate the field of personalized immunotherapy.
A workshop is intended for those who are interested in and are in the planning stages of conducting an RNA-Seq experiment. Topics to be discussed will include:
* Experimental Design of RNA-Seq experiment
* Sample preparation, best practices
* High throughput sequencing basics and choices
* Cost estimation
* Differential Gene Expression Analysis
* Data cleanup and quality assurance
* Mapping your data
* Assigning reads to genes and counting
* Analysis of differentially expressed genes
* Downstream analysis/visualizations and tables
Building Genomic Data Processing and Machine Learning Workflows Using Apache ...Databricks
Epinomics is advancing epigenetic research to drive personalized medicine, using epigenomic data analysis. Their goal is to provide an analysis resource to the community that will promote high-quality data and replicable and interpretable results. They work with academic and commercial users to ingest and analyze their genomic sequencing data and metadata. They extract epigenetic features from the sequenced genome, called “chromatin accessibility”, which are indicative of instrumental epigenetic changes responsible for differential gene expression and disease development.
Epinomics has built an Apache Spark-based pipeline that retrieves chromatin accessibility data from the epigenome, uses GraphX to find overlapping accessibility atlas and then clusters the data and runs machine learning algorithms. This session will provide a primer on epigenomics, details about Epinomics’ Spark-based data pipeline focusing on parallel bioinformatic analysis, and how they use machine learning models to build the epigenomic landscape and accelerate the field of personalized immunotherapy. use GraphX to find overlapping accessibility atlas and then cluster the data and run machine learning algorithms.
In this talk we will provide a primer on epigenomics, details about our Spark based data pipeline focusing on parallel bioinformatic analysis and how we use machine learning models to build the epigenomic landscape and accelerate the field of personalized immunotherapy.
A workshop is intended for those who are interested in and are in the planning stages of conducting an RNA-Seq experiment. Topics to be discussed will include:
* Experimental Design of RNA-Seq experiment
* Sample preparation, best practices
* High throughput sequencing basics and choices
* Cost estimation
* Differential Gene Expression Analysis
* Data cleanup and quality assurance
* Mapping your data
* Assigning reads to genes and counting
* Analysis of differentially expressed genes
* Downstream analysis/visualizations and tables
INTRODUCTION
DEFINITION OF BIOINFORMATICS
HISTORY
OBJECTIVE OF BIOINFORMATIC
TOOLS OF BIOINFORMATICS
PROCEDURE AND TOOLS OF BIOINFORMATIC
BIOLOGICAL DATABASES
HOMOLOGY AND SIMILARITY TOOLS (SEQUENCE ALIGNMENT)
PROTEIN FUNCTION ANALYSIS TOOLS
STRUCTURAL ANALYSIS TOOLS
SEQUENCE MANIPULATION TOOLS
SEQUENCE ANALYSIS TOOLS
APPLICATION
CONCLUSION
REFERENCES
Performance Improvement of BLAST with Use of MSA Techniques to Search Ancesto...journal ijrtem
process in which instead comparing whole query sequence with database sequence it breaks
query sequence into small words and these words are used to align patterns. it uses heuristic method which
make it faster than earlier smith-waterman algorithm. But due small query sequence used for align in case of
very large database with complex queries it may perform poor. To remove this draw back we suggest by using
MSA tools which can filter database in by removing unnecessary sequences from data. This sorted data set then
applies to BLAST which can then indentify relationship among them i.e. HOMOLOGS, ORTHOLOGS,
PARALOGS. The proposed system can be further use to find relation among two persons or used to create
family tree. Ortholog is interesting for a wide range of bioinformatics analyses, including functional annotation,
phylogenetic inference, or genome evolution. This system describes and motivates the algorithm for predicting
orthologous relationships among complete genomes. The algorithm takes a pairwise approach, thus neither
requiring tree reconstruction nor reconciliation
Performance Improvement of BLAST with Use of MSA Techniques to Search Ancesto...IJRTEMJOURNAL
BLAST is most popular sequence alignment tool used to align bioinformatics patterns. It uses
local alignment process in which instead comparing whole query sequence with database sequence it breaks
query sequence into small words and these words are used to align patterns. it uses heuristic method which
make it faster than earlier smith-waterman algorithm. But due small query sequence used for align in case of
very large database with complex queries it may perform poor. To remove this draw back we suggest by using
MSA tools which can filter database in by removing unnecessary sequences from data. This sorted data set then
applies to BLAST which can then indentify relationship among them i.e. HOMOLOGS, ORTHOLOGS,
PARALOGS. The proposed system can be further use to find relation among two persons or used to create
family tree. Ortholog is interesting for a wide range of bioinformatics analyses, including functional annotation,
phylogenetic inference, or genome evolution. This system describes and motivates the algorithm for predicting
orthologous relationships among complete genomes. The algorithm takes a pairwise approach, thus neither
requiring tree reconstruction nor reconciliation
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
2. Outline
Workshops chronology on hands out
Brief background information
Applications & role
Bioinformatics tools
Practical classes
Problem solving exercises
What’s expected of you ?
Questions/comments are welcome at all
points
3. Aims
To introduce the concepts and language of
bioinformatics.
To provide an understanding of how nucleic acid
and protein sequence data is obtained and
analysed.
To develop skills in utilising online databases and
interpreting data.
To develop an understanding of how bioinformatics
can be applied to solve specific problems in
biomedical science.
To develop transferable IT and communications
skills.
4. In this workshop…..
You will learn about how data is
generated and analysed
As well as what the generated data can
tell us about the molecular biology of
organisms
And various practical applications of
this knowledge
6. Why bioinformatics?
Over the past decade massive amounts
of sequence data have been generated
This has more recently been joined by
gene expression data obtained from
microarrays and proteomic technologies
This vast amount of data can only be
analysed using various specialised
computer algorithms
7. Main Topics (Review............)
Genome organisation and analysis
Functional genomics
Advanced techniques in molecular biology
Archives, information retrieval and alignments:
Nucleic acid sequence databases; genome
databases; protein sequence databases; database
searching
Dot plots (SIMILARITY MATRX) and sequence
alignments (PSI BLAST);
Genome expression: Microarray analysis,
proteomics, eukaryotic genome expression
11. Five W that all biologists
should know
NCBI (The National Center for Biotechnology Information;
http://www.ncbi.nlm.nih.gov/
EBI (The European Bioinformatics Institute)
http://www.ebi.ac.uk/
The Canadian Bioinformatics Resource
http://www.cbr.nrc.ca/
SwissProt/ExPASy (Swiss Bioinformatics Resource)
http://expasy.cbr.nrc.ca/sprot/
PDB (The Protein Databank)
http://www.rcsb.org/PDB/
12. Remember while using web
server-based tools
You are using someone else’s
computer
You are (probably) getting a reduced
set of options or capacity
Servers are great for sporadic or proof-
of-principle work, but for intensive work,
the software should be obtained and
run locally
13. Human Gene Index Database
HGI is a database of expressed DNA
sequences, mostly made of ESTs, which are
a type of partial cDNA
EST stands for Expressed Sequence Tag
These short sequences were created using
essentially the same method used to make
cDNAs
As such they represent the expressed part of
a genome and are made from mRNA which is
ultimately expressed from GENES
16. Similarity Searching
There are a variety of computer
programs that are used for making
comparisons between DNA sequences.
The most popular is known as BLAST
(Basic Local Alignment Search Tool)
BLAST is free at the NCBI website
17. BLAST is Complex
Similarity searching relies on the concepts of
alignment and distance between pairs of
sequences.
Distances can only be measured between
aligned sequences (match vs. mismatch at
each position).
A similarity search is a process of testing the
best alignment of a query sequence with
every sequence in a database.
18. Workshop -1 (database search & inference of possible
homology)
Please refer to getting started with bioinformatics
INTRO TO BLAST
Basic Local Alignment Search Tool
It is used to compare a query sequence with those contained in
nucleotide databases by aligning the query sequence with
previously characterised genes, therefore helping in identifying
genes.
The emphasis of this tool is to find regions of sequence
similarity between two different genes.
These sequence alignments can yield clues about the structure
and function of a novel sequence, and about its evolutionary
history and homology with other sequences in the database.
19. BLAST has Automatic
Translation
BLASTX makes automatic translation (in all
6 reading frames) of your DNA query
sequence to compare with protein
databanks
TBLASTN makes automatic translation of
an entire DNA database to compare with
your protein query sequence
Only make a DNA-DNA search if you are
working with a sequence that does not code
for protein.
20. A typical sequence ready for
submission to BLAST
>THC2465887
GGCTGCGGAGGACCGACCGTCCCCACGCCTGCCGCCCCGCGACCCCGACCGCCAGCATGATCGCCGCGCAGCTCCTGGCC
TATTACTTCACGGAGCTGAAGGATGACCAGGTCAAAAAGATTGACAAGTATCTCTATGCCATGCGGCTCTCCGATGAAAC
TCTCATAGATATCATGACTCGCTTCAGGAAGGAGATGAAGAATGGCCTCTCCCGGGATTTTAATCCAACAGCCACAGTCA
AGATGTTGCCAACATTCGTAAGGTCCATTCCTGATGGCTCTGAAAAGGGAGATTTCATTGCCCTGGATCTTGGTGGGTCT
TCCTTTCGAATTCTGCGGGTGCAAGTGAATCATGAGAAAAACCAGAATGTTCACATGGAGTCCGAGGTTTATGACACCCC
AGAGAACATCGTGCACGGCAGTGGAAGCCAGCTTTTTGATCATGTTGCTGAGTGCCTGGGAGATTTCATGGAGAAAAGGA
AGATCAAGGACAAGAAGTTACCTGTGGGATTCACGTTTTCTTTTCCTTGCCAACAATCCAAAATAGATGAGGCCATCCTG
ATCACCTGGACAAAGCGATTTAAAGCGAGCGGAGTGGAAGGAGCAGATGTGGTCAAACTGCTTAACAAAGCCATCAAAAA
GCGAGGGGACTATGATGCCAACATCGTAGCTGTGGTGAA
23. Understand the
Statistics!
BLAST produces an E-value for every match
This is the same as the P value in a statistical test
A match is generally considered significant if the
E-value < 0.05 (smaller numbers are more significant)
Very low E-values (e-100) are homologs or
identical genes
Moderate E-values are related genes
Long regions of moderate similarity are more
important than short regions of high identity.
24. BLAST is Approximate
BLAST makes similarity searches very
quickly because it takes shortcuts.
looks for short, nearly identical “words” (11 bases)
It also makes errors
misses some important similarities
makes many incorrect matches
easily fooled by repeats or skewed composition
25. Bad Genome
Annotation
Gene finding is at best only 90%
accurate.
New sequences are automatically
annotated with BLAST scores.
Bad annotations propagate
Its going to take us 10-20 years or more
to sort this mess out!
26. Conclusions
We have only touched small parts of
the elephant
Trial and error (intelligently) is often
your best tool
Keep up with the main five sites, and
you’ll have a pretty good idea of what is
happening and available