The use of the term cisgenesis is an attempt to distinguish GM plants or other organisms produced in this way from transgenics that is GM plants that contain DNA from unrelated organisms. Schouten et al. (2006) introduced the term cisgenesis and defined cisgenesis as the modification in the genetic background of a recipient plant by a naturally derived gene from a cross compatible species including its introns and its native promoter and terminator flanked in the normal sense orientation. Since cisgenes shared a common gene pool available for traditional breeding the final cisgenic plant should be devoid of any kind of foreign DNA viz., selection markers and vector- backbone sequences. Sometimes the word cisgenesis is also referred to as Agrobacterium-mediated gene transfer from a sexually compatible plant where only the T-DNA borders may be present in the recipient organism after transformation (EFSA, 2012). The cisgenesis precludes linkage drag, and hence, prevents hazards from unidentified hitch hiking genes (Schouten, and Jacobsen, 2008). Compared to transgenesis, one of the disadvantages shared by cisgenesis is that characters outside the sexually compatible gene pool cannot be introduced. Furthermore, development of cisgenic crops involves extraordinary proficiency and time compared to transgenic crops. Therefore, the required genes or fragments of genes may not be readily accessible but have to be isolated from the sexually compatible gene pool (Holme et al., 2013).
On 16 February 2012, European Food Safety Authority (EFSA, 2012) reported the detail study concerning the safety aspects of cisgenic plants and validated that cisgenic plants are secure to be used in terms of environment, food and feed, similar to the traditionally bred plants. However, the present GMO regulation keeps the cisgenic micro-organisms out from its supervision. The first scientific statement of bringing forth a true plant obtained by cisgenic approach was reported in apple through the insertion of the internal scab resistance gene HcrVf2 influenced by their own regulatory genes into the cultivar Gala, a scab susceptible cultivar (Vanblaere et al., 2011). Barley with improved phytase activity was produced successfully by Holme et al. 2011, through cisgenic approach. Late blight resistant potatoes have developed by cisgene stacking of R- gene (jo et al., 2014).
A concise and well fabricated presentation the current techniques used for plant genome editing including CRISPER/cas9 system, TALENS, TELES, ZINC FINGER NUCLEASES(ZFN), HEJ (homologous endjoing) and many other high throughout techniques along references.
Speed Breeding is new technology to develop plants or breeding materials within a short possible time without affect seed viability and yield performance.
The use of the term cisgenesis is an attempt to distinguish GM plants or other organisms produced in this way from transgenics that is GM plants that contain DNA from unrelated organisms. Schouten et al. (2006) introduced the term cisgenesis and defined cisgenesis as the modification in the genetic background of a recipient plant by a naturally derived gene from a cross compatible species including its introns and its native promoter and terminator flanked in the normal sense orientation. Since cisgenes shared a common gene pool available for traditional breeding the final cisgenic plant should be devoid of any kind of foreign DNA viz., selection markers and vector- backbone sequences. Sometimes the word cisgenesis is also referred to as Agrobacterium-mediated gene transfer from a sexually compatible plant where only the T-DNA borders may be present in the recipient organism after transformation (EFSA, 2012). The cisgenesis precludes linkage drag, and hence, prevents hazards from unidentified hitch hiking genes (Schouten, and Jacobsen, 2008). Compared to transgenesis, one of the disadvantages shared by cisgenesis is that characters outside the sexually compatible gene pool cannot be introduced. Furthermore, development of cisgenic crops involves extraordinary proficiency and time compared to transgenic crops. Therefore, the required genes or fragments of genes may not be readily accessible but have to be isolated from the sexually compatible gene pool (Holme et al., 2013).
On 16 February 2012, European Food Safety Authority (EFSA, 2012) reported the detail study concerning the safety aspects of cisgenic plants and validated that cisgenic plants are secure to be used in terms of environment, food and feed, similar to the traditionally bred plants. However, the present GMO regulation keeps the cisgenic micro-organisms out from its supervision. The first scientific statement of bringing forth a true plant obtained by cisgenic approach was reported in apple through the insertion of the internal scab resistance gene HcrVf2 influenced by their own regulatory genes into the cultivar Gala, a scab susceptible cultivar (Vanblaere et al., 2011). Barley with improved phytase activity was produced successfully by Holme et al. 2011, through cisgenic approach. Late blight resistant potatoes have developed by cisgene stacking of R- gene (jo et al., 2014).
A concise and well fabricated presentation the current techniques used for plant genome editing including CRISPER/cas9 system, TALENS, TELES, ZINC FINGER NUCLEASES(ZFN), HEJ (homologous endjoing) and many other high throughout techniques along references.
Speed Breeding is new technology to develop plants or breeding materials within a short possible time without affect seed viability and yield performance.
Multiple inbred founder lines are inter-mated for several generations prior to creating inbred lines, resulting in a diverse population whose genomes are fine scale mosaics of contributions from all founders.
Heterotic group âis a group of related or unrelated genotypes from the same or different populations, which display similar combining ability and heterotic response when crossed with genotypes from other genetically distinct germplasm groups.â
A new era of genomics for plant science research has opened due the complete genome sequencing projects of Arabidopsis thaliana and rice. The sequence information available in public database has highlighted the need to develop genome scale reverse genetic strategies for functional analysis (Till et al., 2003). As most of the phenotypes are obscure, the forward genetics can hardly meet the demand of a high throughput and large-scale survey of gene functions. Targeting Induced Local Lesions in Genome TILLING is a general reverse genetic technique that combines chemical mutagenesis with PCR based screening to identity point mutations in regions of interest (McCallum et al., 2000). This strategy works with a mismatch-specific endonuclease to detect induced or natural DNA polymorphisms in genes of interest. A newly developed general reverse genetic strategy helps to locate an allelic series of induced point mutations in genes of interest. It allows the rapid and inexpensive detection of induced point mutations in populations of physically or chemically mutagenized individuals. To create an induced population with the use of physical/chemical mutagens is the first prerequisite for TILLING approach. Most of the plant species are compatible with this technique due to their self-fertilized nature and the seeds produced by these plants can be stored for long periods of time (Borevitz et al., 2003). The seeds are treated with mutagens and raised to harvest M1 plants, which are consequently, self-fertilized to raise the M2 population. DNA extracted from M2 plants is used in mutational screening (Colbert et al., 2001). To avoid mixing of the same mutation only one M2 plant from each M1 is used for DNA extraction (Till et al., 2007). The M3 seeds produce by selfing the M2 progeny can be well preserved for long term storage. Ethyl methane sulfonate (EMS) has been extensively used as a chemical mutagen in TILLING studies in plants to generate mutant populations, although other mutagens can be effective. EMS produces transitional mutations (G/C, A/T) by alkylating G residues which pairs with T instead of the conservative base pairing with C (Nagy et al., 2003). It is a constructive approach for users to attempt a range of chemical mutagens to assess the lethality and sterility on germinal tissue before creating large mutant populations.
Marker Assisted Selection in Crop BreedingPawan Chauhan
Â
Marker Assisted Selection is a value addition to conventional methods of Crop Breeding. It has been gaining importance in plant breeding with new generation of plant breeders and to get accurate and fast desired result from plant breeding.
An overview of agricultural applications of genome editing: Crop plantsOECD Environment
Â
The presentation gives an overview of genome editing applications in relation to crop plants. The aim is to have a better understanding of the specific features of genome editing in comparison with classical breeding and genetic engineering techniques. It will give an overview of some examples of agricultural applications that may be on or close to the market or under research and development. It will also consider the possibility of foreseeing future applications (e.g. variations in CRISPR/Cas applications, DNA-free application, agricultural pest control), if possible.
Genome editing in crop improvement one of the desirable biotechnology concept. It is useful for the production of new varieties against resistance to diseases and insect pests
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)Akshay Deshmukh
Â
clustered regularly interspaced short palindromic repeats is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria. Now CRISPR use as genome editing tool in different Plant Breeder to manipulate the DNA of the crop
Multiple inbred founder lines are inter-mated for several generations prior to creating inbred lines, resulting in a diverse population whose genomes are fine scale mosaics of contributions from all founders.
Heterotic group âis a group of related or unrelated genotypes from the same or different populations, which display similar combining ability and heterotic response when crossed with genotypes from other genetically distinct germplasm groups.â
A new era of genomics for plant science research has opened due the complete genome sequencing projects of Arabidopsis thaliana and rice. The sequence information available in public database has highlighted the need to develop genome scale reverse genetic strategies for functional analysis (Till et al., 2003). As most of the phenotypes are obscure, the forward genetics can hardly meet the demand of a high throughput and large-scale survey of gene functions. Targeting Induced Local Lesions in Genome TILLING is a general reverse genetic technique that combines chemical mutagenesis with PCR based screening to identity point mutations in regions of interest (McCallum et al., 2000). This strategy works with a mismatch-specific endonuclease to detect induced or natural DNA polymorphisms in genes of interest. A newly developed general reverse genetic strategy helps to locate an allelic series of induced point mutations in genes of interest. It allows the rapid and inexpensive detection of induced point mutations in populations of physically or chemically mutagenized individuals. To create an induced population with the use of physical/chemical mutagens is the first prerequisite for TILLING approach. Most of the plant species are compatible with this technique due to their self-fertilized nature and the seeds produced by these plants can be stored for long periods of time (Borevitz et al., 2003). The seeds are treated with mutagens and raised to harvest M1 plants, which are consequently, self-fertilized to raise the M2 population. DNA extracted from M2 plants is used in mutational screening (Colbert et al., 2001). To avoid mixing of the same mutation only one M2 plant from each M1 is used for DNA extraction (Till et al., 2007). The M3 seeds produce by selfing the M2 progeny can be well preserved for long term storage. Ethyl methane sulfonate (EMS) has been extensively used as a chemical mutagen in TILLING studies in plants to generate mutant populations, although other mutagens can be effective. EMS produces transitional mutations (G/C, A/T) by alkylating G residues which pairs with T instead of the conservative base pairing with C (Nagy et al., 2003). It is a constructive approach for users to attempt a range of chemical mutagens to assess the lethality and sterility on germinal tissue before creating large mutant populations.
Marker Assisted Selection in Crop BreedingPawan Chauhan
Â
Marker Assisted Selection is a value addition to conventional methods of Crop Breeding. It has been gaining importance in plant breeding with new generation of plant breeders and to get accurate and fast desired result from plant breeding.
An overview of agricultural applications of genome editing: Crop plantsOECD Environment
Â
The presentation gives an overview of genome editing applications in relation to crop plants. The aim is to have a better understanding of the specific features of genome editing in comparison with classical breeding and genetic engineering techniques. It will give an overview of some examples of agricultural applications that may be on or close to the market or under research and development. It will also consider the possibility of foreseeing future applications (e.g. variations in CRISPR/Cas applications, DNA-free application, agricultural pest control), if possible.
Genome editing in crop improvement one of the desirable biotechnology concept. It is useful for the production of new varieties against resistance to diseases and insect pests
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)Akshay Deshmukh
Â
clustered regularly interspaced short palindromic repeats is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria. Now CRISPR use as genome editing tool in different Plant Breeder to manipulate the DNA of the crop
Recent Updates on Application of CRISPR/Cas9 Technique in Agriculture.pptxKANIZFATEMA7268
Â
Crop improvement is essential to attaining world food security and enhancing nutrition for
human beings. Both conventional breeding and modern molecular breeding have contributed to
increased crop production and quality. However, the time and resources for breeding practices
have been limited. It takes a long time to bring a novel improved crop to the market, and the
genetic sources from wild species cannot be always available for crops of our interests. Genome
editing technology implemented molecular breeding can overcome those limitations of time and
resource by facilitating the specific editing of plant genomes. CRISPR/Cas9 is a rapidly
developing technology that has been successfully applied in major crops eg: rice, wheat, maize,
barley, Arabidopsis, vegetables, fruits for crop improvement, disease resistance, abiotic stress
resistance etc. by gene knockouts, gene replacement, multiplex editing, interrogating gene
function, and transcription modulation in plants. As only a short RNA sequence must be
synthesized to confer recognition of a new target, CRISPR/Cas9 is a relatively cheap and easy to
implement technology that has proven to be extremely versatile. Together with other sequencespecific nucleases, CRISPR/ Cas9 is a game-changing technology that is poised to revolutionize
plant breeding and crop engineering.
Engineering plant immunity using crispr cas9 to generate virus resistanceSheikh Mansoor
Â
Targeted genome editing by use of artificial nucleases has the plausible potential to speed basic research as well as plant breeding by providing the means to modify genomes quickly in a specific and predictable manner but advanced CRISPR-Cas9 based technologies first confirmed in mammalian cell systems are quickly being fitted for use in plants. These new technologies increase CRISPR-Cas9âs utility and effectiveness by diversifying cellular capabilities through expression construct system evolution and enzyme orthogonality, as well as enhanced efficiency through delivery and expression mechanisms. RNA-guided genome editing using Streptococcus pyogenes CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) has renewed the concept of genome editing in plants. CRISPR-associated surveillance complexes are easily programmable molecular sleds that can target any sequence of choice. These complexes offer new opportunities for implementation in biotechnology. Recent studies have used CRISPR/Cas9 to engineer virus resistance in plants, either by directly targeting and cleaving the viral genome, or by modifying the host plant genome to introduce viral immunity. The CRISPR/Cas9 platform could also be used for targeted mutagenesis to identify host factors that control plant resistance and susceptibility to viral infection. Thus, CRISPR/Cas9 technology offers a promising approach for under- standing and engineering resistance to single and multiple viral infections in plants.
Fine mapping of stay-green QTLs on sorghum chromosome SBI-10L-An approach fro...ICRISAT
Â
Sorghum is the fifth most important C4 cereal crop grown globally in arid and semi-arid climatic conditions. Drought is the major cause for loss of productivity worldwide. Delayed senescence of plants leads to adaptation to drought stress conditions by staying-green and giving high yields. In order to identify and dissect the stay-green genomic regions we have developed a high resolution fine mapping population from introgression line cross RSG04008-6 (stay-green) Ă J2614-11 (shoot fly resistant). Nearly 1894 F2 genotypes were screened with 8 SSR in order to identify double recombinants for both the parents in the sorghum chromosome-10 long arm (SBI-10L).
CRISPR-Cas is an adaptive immune system existing in most bacteria and archaea, preventing them from being infected by phages, viruses and other foreign genetic elements.
This presentation explains about the working and applications of CRISPR-CAS system.
Multi-source connectivity as the driver of solar wind variability in the heli...SĂŠrgio Sacani
Â
The ambient solar wind that flls the heliosphere originates from multiple
sources in the solar corona and is highly structured. It is often described
as high-speed, relatively homogeneous, plasma streams from coronal
holes and slow-speed, highly variable, streams whose source regions are
under debate. A key goal of ESA/NASAâs Solar Orbiter mission is to identify
solar wind sources and understand what drives the complexity seen in the
heliosphere. By combining magnetic feld modelling and spectroscopic
techniques with high-resolution observations and measurements, we show
that the solar wind variability detected in situ by Solar Orbiter in March
2022 is driven by spatio-temporal changes in the magnetic connectivity to
multiple sources in the solar atmosphere. The magnetic feld footpoints
connected to the spacecraft moved from the boundaries of a coronal hole
to one active region (12961) and then across to another region (12957). This
is refected in the in situ measurements, which show the transition from fast
to highly AlfvĂŠnic then to slow solar wind that is disrupted by the arrival of
a coronal mass ejection. Our results describe solar wind variability at 0.5âau
but are applicable to near-Earth observatories.
Slide 1: Title Slide
Extrachromosomal Inheritance
Slide 2: Introduction to Extrachromosomal Inheritance
Definition: Extrachromosomal inheritance refers to the transmission of genetic material that is not found within the nucleus.
Key Components: Involves genes located in mitochondria, chloroplasts, and plasmids.
Slide 3: Mitochondrial Inheritance
Mitochondria: Organelles responsible for energy production.
Mitochondrial DNA (mtDNA): Circular DNA molecule found in mitochondria.
Inheritance Pattern: Maternally inherited, meaning it is passed from mothers to all their offspring.
Diseases: Examples include Leberâs hereditary optic neuropathy (LHON) and mitochondrial myopathy.
Slide 4: Chloroplast Inheritance
Chloroplasts: Organelles responsible for photosynthesis in plants.
Chloroplast DNA (cpDNA): Circular DNA molecule found in chloroplasts.
Inheritance Pattern: Often maternally inherited in most plants, but can vary in some species.
Examples: Variegation in plants, where leaf color patterns are determined by chloroplast DNA.
Slide 5: Plasmid Inheritance
Plasmids: Small, circular DNA molecules found in bacteria and some eukaryotes.
Features: Can carry antibiotic resistance genes and can be transferred between cells through processes like conjugation.
Significance: Important in biotechnology for gene cloning and genetic engineering.
Slide 6: Mechanisms of Extrachromosomal Inheritance
Non-Mendelian Patterns: Do not follow Mendelâs laws of inheritance.
Cytoplasmic Segregation: During cell division, organelles like mitochondria and chloroplasts are randomly distributed to daughter cells.
Heteroplasmy: Presence of more than one type of organellar genome within a cell, leading to variation in expression.
Slide 7: Examples of Extrachromosomal Inheritance
Four Oâclock Plant (Mirabilis jalapa): Shows variegated leaves due to different cpDNA in leaf cells.
Petite Mutants in Yeast: Result from mutations in mitochondrial DNA affecting respiration.
Slide 8: Importance of Extrachromosomal Inheritance
Evolution: Provides insight into the evolution of eukaryotic cells.
Medicine: Understanding mitochondrial inheritance helps in diagnosing and treating mitochondrial diseases.
Agriculture: Chloroplast inheritance can be used in plant breeding and genetic modification.
Slide 9: Recent Research and Advances
Gene Editing: Techniques like CRISPR-Cas9 are being used to edit mitochondrial and chloroplast DNA.
Therapies: Development of mitochondrial replacement therapy (MRT) for preventing mitochondrial diseases.
Slide 10: Conclusion
Summary: Extrachromosomal inheritance involves the transmission of genetic material outside the nucleus and plays a crucial role in genetics, medicine, and biotechnology.
Future Directions: Continued research and technological advancements hold promise for new treatments and applications.
Slide 11: Questions and Discussion
Invite Audience: Open the floor for any questions or further discussion on the topic.
A brief information about the SCOP protein database used in bioinformatics.
The Structural Classification of Proteins (SCOP) database is a comprehensive and authoritative resource for the structural and evolutionary relationships of proteins. It provides a detailed and curated classification of protein structures, grouping them into families, superfamilies, and folds based on their structural and sequence similarities.
Richard's entangled aventures in wonderlandRichard Gill
Â
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
THE IMPORTANCE OF MARTIAN ATMOSPHERE SAMPLE RETURN.SĂŠrgio Sacani
Â
The return of a sample of near-surface atmosphere from Mars would facilitate answers to several first-order science questions surrounding the formation and evolution of the planet. One of the important aspects of terrestrial planet formation in general is the role that primary atmospheres played in influencing the chemistry and structure of the planets and their antecedents. Studies of the martian atmosphere can be used to investigate the role of a primary atmosphere in its history. Atmosphere samples would also inform our understanding of the near-surface chemistry of the planet, and ultimately the prospects for life. High-precision isotopic analyses of constituent gases are needed to address these questions, requiring that the analyses are made on returned samples rather than in situ.
3. Genome Editing
⢠Genetic engineering in which DNA is inserted, replaced,
or removed from a genome using artificially engineered
nucleases
Requirement
⢠Availability of genomic sequence
⢠Gene function
⢠Efficient plant transformation
4.
5. ZFN (Zinc Finger Nuclease)
⢠Zinc-finger protein
⢠FokI nuclease domain
⢠Dimeric form
⢠Two different ZFN monomers bind to different strand
⢠Separated by a 5-7 bp spacer sequence
⢠Specify 18bp of DNA per cleavage
⢠ZF recognizes three base
6. Transcription activator-like effector nucleases (TALENS)
DNABinding Domain
DNA Cleavage Domain
DNABinding Domain (TALE)
30-40 bp length target sequences ,
with 12- to 21-bp spacer
Repeat variable
diresidues
8. Random repair of
DSB INDEL
Gene correction
Point mutation
Insertion of cis-gene
or transgene
Bortesi et al 2014
Cellular DNA Repair Mechanism
9. Factors ZFN (2003) TALEN (2010) CRISPR/Cas9 (2013)
Recognition site 18-36 bp 30-40 bp 22 bp (20-bp guide sequence
+ 2- bp PAM)
Restriction in
target site
G-rich Start with T End with an NGG
Sequence Success
rate
Low High High
Off-target effects High Low Variable
Cytotoxicity Variable to high Low Low
Size ~1 kb*2 ~3 kb*2 4.2 kb (Cas9 from
Streptococcus pyogenes) +
0.1 kb (sgRNA)
Ease of engineering DifďŹcult Moderate Easy
Ease of
multiplexing
Low Low High
Time Months Weeks Days
Comparison of three classes of designed nucleases
(Xiong et al 2015)
10. Applications
Plant and organ
development
e.g. Tomato domestication
Reproductive
and fruit related
traits
e.g. Parthenocarpy in
tomato
Stress related
traits
Biotic stress
resistance
e.g. Powdery
mildew resistance
in Tomato
Abiotic stress
resistance
e.g. Drought
resistance in
Tomato
Herbicide
resistance
e.g. Herbicide
resistance in
Watermelon
Quality traits
Health
promoting traits
e.g. Anthocyanin
content in Tomato
Storage and shelf
life related traits
e.g. Reduced enzymatic
browning in potato
Genome deletion by
NHEJ
Gene knockout
Point mutation
by Base editing
Promoter
replacement
Indel mutation
using DNA free
GE
Site directed Mutagenesis
using CRISPR Cas9
Multiplexing and trait
stacking
Indel mutation
APPLICATIONS OF GE TOOLS IN VEGETABLE BREEDING
11. Data mining and
sgRNA target selection
Transformation
and transformants
regeneration
Selection of CRISPR
Cas9 system &
delivery method
RB
Procedure of GE e.g. CRISPR/Cas9 system in potato
(Hameed et al 2019)
13. Crop species Target gene G E tool Phenotypic change References
Solanum
lycopersicum
PROCERA (PRO) TALEN Longer internodes and lighter
green leaves with smoother
margins
Lor et al (2014)
ARGONAUTE7
(SlAGO7)
CRISPR Needle-like or wiry leaves Brooks et al (2014)
SHORT-ROOT
(SHR)
CRISPR Short (hairy) roots with
stunted meristematic and
elongation zones
Ron et al (2014)
SP5G, O, MULT ,
FAS and CycB
CRISPR Tomato domestication
targeting 5 genes
Zsogon et al (2018)
SlGAI CRISPR Gibberellin response and
dwarfism
Tomlinson et al
(2019)
SlEIN2, SlERFE1,
SlARF2B, SlGRAS8,
SlACS2, SlACS4
CRISPR Ethylene response and fruit
development
Hu et al (2019)
1. Plant and organ development
Application of GE in vegetable breeding
14. De novo domestication of wild tomato using genome editing
SELFPRUNING (Solyc06g074350),
OVATE (Solyc02g085500)
FRUIT WEIGHT (Solyc02g090730),
FASCIATED/YABBY (Solyc11g071810)
MULTIFLORA (Solyc02g077390)
LYCOPENE BETA-CYCLASE (Solyc04g040190)
(Zsogon et al 2018)
15. Genomic sequence showing the site of gRNA targeting and missense mutation in
the O and MULT genes
(Zsogon et al 2018)
16. CycB and FAS genomic sequence showing site of gRNA targeting and missense mutations
using vector pTC603
(Zsogon et al 2018)
17. Height and number of flowers per inflorescence in WT and mutant plants
WT 3-5 3-11
Plantheight
No.offlowersininflorescence
WT 3-5 3-11
(Zsogon et al 2018)
180
160
140
120
100
80
60
40
20
0
18. Fruit locules, Weight and Lycopene concentration in WT and mutant lines
(Zsogon et al 2018)
19. Reproductive and fruit related traits
Crop sp. Target gene GE tool Phenotypic changes References
Solanum
lycopersic
um
SlBOP1,
SlBOP2,
SlBOP3, TFAM1,
TFAM2
CRISPR/Cas9 Altered photoperiod response,
flowering, determinate growth,
earliness, harvest index & yield
Xu et al (2016)
Soyk et al (2016)
sp5G CRISPR/ Cas9
J2,EJ2 and LIN CRISPR/Cas9 Altered branching, increased yield Soyk et al (2017)
SLAGAMOUS-
LIKE 6 (SlAGL6)
CRISPR/Cas9 Parthenocarpy, red fruit & higher
Brix
Klap et al (2017)
IIA9 CRISPR/Cas9 Parthenocarpy Ueta et al (2017)
SlMAPK20 CRISPR/Cas9 Aborted pollen development Chen et al (2018)
Solanum
tuberosum
S-RNase CRISPR/ Cas9 Self-incompatibility Ye et al (2018)
Brassica
oleracea
BoPDS, BoSRK3,
BoMS1
CRISPR/ Cas9 Albino phenotype & self-
incompatibility
Ma et al (2019)
FRIGIDA TALEN Early flowering phenotype Sun et al (2013)
Cucumis
sativus
CmWIP1 CRISPR/Cas9 Gynoecious phenotype Hu et al (2017)
20. Rapid breeding of parthenocarpic tomato plants using
CRISPR/Cas9
1. Constructed two new CRISPR/Cas9 vectors with different promoters
2. Designed three gRNAs (gRNA1, gRNA2, and gRNA3) with a target sequence
within the second exon of the SlIAA9 gene
(Ueta et al 2017)
21. 3. Detect mutations in the CRISPR/Cas9 mutant tomato plants
WT pEgPubi4_237-2A-GFP-T0 pEgP237-2A-GFP-T0
Signalintensity
Multiple heteroduplex (HMA) peaks (red arrows): Mutant tomato calli,
Single peak (blue arrow): wild-type control
(Ueta et al 2017)
22. Average seed numbers/fruits in WT
and mutant type
Parthenocarpy fruits in wild type
and mutant type
(Ueta et al 2017)
23. Crop species Target gene Phenotypic change References
Solanum
lycopersicum
MILDEW RESISTANT
LOCUS O (SlMlo1)
Resistance to powdery mildew Nekrasov et al
(2017)
DOWNY MILDEW
RESISTANCE
(SlDMR6-1)
Resistance to Pseudomonas
syringae
de Toledo et al
(2016)
Coat protein, Replicase
from TYLCV
Resistance to TYLCV Tashkandi et al
(2018)
SlJAZ2 Resistance to bacterial speck Ortigosa et al
(2019)
Solanum
tuberosum
Coilin gene Resistance to biotic and
abiotic stress
Makhotenko et al
(2019)
Brassica
napus
WRKY11 and WRKY70 Biotic resistance Sun et al (2018)
Cucumis
sativus
eIF4E Viral resistance
(CVYC,ZYMV,PRSV-W)
Chandrasekaran et
al (2016)
Biotic stresses
24. Rapid generation of a transgene free powdery mildew resistant by
genome deletion
Generating knockout deletion in the SlMlo1 locus
Using the Golden Gate cloning system to assemble CRISPR constructs
(Nekrasov et al 2017)
25. ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49
WT ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG
Plant 1 ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG
Plant 2 ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48
Plant 8 ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48
Plant 10
ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48
Target 1 Target2
*
*
*
WT
slmlo1 8-2
slmlo1 8-4
slmlo1 8-6 (T-DNA)
PCR analysis and Illumina whole genome sequencing confirmed presence of a homozygous
deletion in the SlMlo1 locus
(Nekrasov et al 2017)
27. Crop species Target gene GE tool Phenotypic chang References
Solanum
lycopersicum
SlMAPK3 CRISPR/Cas9 Higher sensitivity to drought Wang et al
(2017)
SlNPR1 CRISPR/Cas9 Reduced drought tolerance Li et al (2019)
CBF1 CRISPR/Cas9 Chilling tolerance Li et al (2018)
SlMAPK3 CRISPR/Cas9 Drought stress Wang et al
(2017)
Tolerance to abiotic stress
Solanum
tuberosum
ACETOLACTATE
SYNTHASE1-2 (StALS1)
TALEN
Enhanced
herbicide
resistance
Nicolia et al (2015)
StALS1 TALEN/CRISPR/Cas9 Butler et al (2016)
Solanum
lycopersicum
SlALS1 CRISPR/Cas9 Danilo et al (2019)
SlALS1, SlALS2 CRISPR/Cas9 Veillet et al (2019)
Citrullus
lanatus
ClALS (Cla019277) Base editing Tian et al (2018)
Herbicide resistance
28. Crop
species
Target gene GE tool Phenotypic changes References
Health promoting traits
Solanum
Lycopersic
um
ANTHOCHYANIN 1 (ANT1) CRISPR/Cas9
TALEN
Anthocyanin content Cermak et al
(2015)
SlMYB12 CRISPR/Cas9 Pink tomato fruit color Deng et al (2018)
PHYTOENE DESATURASE
(PDS)
CRISPR/Cas9 Albino phenotype Pan et al (2016)
PDS and GABA-TP1,
GABA-TP2, GABA-TP3,
CAT9 and SSADH
CRISPR/Cas9 Îł-aminobutyric acid metabolism
increase content of GABA
Li et al (2017)
LEAFY-COTYLEDON1-
LYKE4 (L1L4)
ZFN Greater content of soluble solids,
fiber, phenol and β-carotene
Gago et al (2017)
Psy1 and CrtR-b2 CRISPR/Cas9 Carotenoid metabolism DâAmbrosio et al
(2018)
SGR1, Blc, LCY-E, LCY-B1,
LCY-B2
CRISPR/Cas9 Increased lycopene content Li et al (2018)
Solanum
tuberosum
Sterol side chain reductase 2
(SSR2)
TALEN Reduced content of steroidal
glycoalkaloids in leaves
Sawai et al
(2014)
St16DOX CRISPR/Cas9 Steroidal glycoalkaloids
metabolism
Nakayasu et al
(2018)
Citrullus
lanatus
ClPDS CRISPR/Cas9 Albino phenotype Tian et al (2017)
Quality traits
29. Rapid development of anthocyanin rich tomato
ANTHOCHYANIN 1 (ANT1) CRISPR/Cas9 and TALEN Promoter replacement/HDR
Gene targeting with the modified BeYDV vector through
Agrobacterium-mediated transformation (Cermak et al 2015)
30. Insertion of a strong promoter upstream of a gene controlling anthocyanin
biosynthesis (ANT1)
Dark purple coloration in flowers, fruit and
foliage results from targeted promoter
insertion
(Cermak et al 2015)
31. PCR genotyping
ANT1 locus after
gene targeting
11 of 16 purple calli
gave the correct PCR
product
16 of 16 purple calli
gave the correct
product at the right
junction
(Cermak et al 2015)
32. Storage, shelf life related and technological quality traits
Crop
species
Target gene GE tool Phenotypic changes References
Solanum
lycopersicu
m
RIPENING
INHIBITOR
(RIN))
CRISPR/Cas9 Fruits never turn red,
altered firmness
Ito et al (2015)
Pectate lyase
(Solyc03g111690)
CRISPR/Cas9 Altered firmness Uluisik et al
(2016)
ALC CRISPR/Cas9 Shelf life Y u et al (2017)
Solanum
tuberosum
Vacuolar
invertase (VInv)
TALEN Undetectable level of
reducing sugar in
tubers
Clasen et al
(2016)
Granule-bound
starch synthase
(GBSS)
CRISPR/Cas9 Amylose-free starch
tubers
Andersson et al
(2017)
StPPO2 CRISPR/Cas9 Reduced enzymatic
browning
Gonzalez et al
(2020)
Quality traits
33. Reduced Enzymatic Browning in Potato Tubers by Specific Editing of a Polyphenol Oxidase
Gene using CRISPR/Cas9 System
(Gonzalez et al 2020)
Structure of StPPO2 gene
Off target identification
Alignment of sgRNA157 with StPPO1 and StPPO4 genes
34. High Resolution Fragment Analysis (HRFA)
Sequencing of StPPO2 alleles in selected lines (Gonzalez et al 2020)
35. Discoloration development at times 0, 24 and 48 h after cutting of tubers
Relative Enzymatic Browning and PPO Activity in tubers (Gonzalez et al 2020)
37. Simultaneous targeting of multi gene
SELFPRUNING (Solyc06g074350),
OVATE (Solyc02g085500)
FRUIT WEIGHT (Solyc02g090730),
FASCIATED/YABBY (Solyc11g071810)
MULTIFLORA (Solyc02g077390)
LYCOPENE BETA-CYCLASE (Solyc04g040190)
e.g. De novo domestication of wild tomato using genome editing (Zosgon et al 2018)
High efficiency: Multi targeting
Potential of GE in vegetable breeding
39. Progress towards transgene elimination and detection of edited plantsâŚ.
(Khatodia et al 2016)
Transgenes are segregated out either through selfing or backcrossing
40. Complimentary ToTraditional Breeding : Solution to Linkage Drag
e.g. Never has progenies with good flavor and better postharvest quality, disease
resistant tomato within 1to 2 generation
Reduce Linkage drag: creation of desire allele at intended locus
41. Precision vegetable breeding
⢠Create diversity in existing plant species/ germplasm
⢠Use of GE plants as donor parent
⢠Knock out of genes involved in cross incompatibility and hybrid sterility
⢠Development of haploid plants: spindle fiber formation and cell division
⢠Development of male sterility plants: Maintaining pollen fertility
â˘Analyzing gene function: quantitative traits
â˘Understanding gene/protein interactions
â˘Network of genes involved in biological pathways
Functional genomics
(Aglawe et al 2018)
43. Target gene Genome editing tool Phenotypic change
ClALS (Cla019277 Base editing Enhanced herbicide resistance against tribenuron
Converting C to T in the codon of Pro190 (CCG) result in amino acid change
Physical map of base editing vector pBSE901 harboring the target sequence
Base-editing: Engineering herbicide-resistant watermelon variety
(Tian et al 2018)
44. 45 out of 199 T0 plants
contained base-edited allele
â˘Tribenuron herbicide @ 0, 17, and 68 g ai/ ha
â˘14 days after herbicide treatment
Primers ALS-F and ALS-R used to amplify fragment
spanning Pro190 region of ALS gene
(Tian et al 2018)
45. Vector with
desired sgRNA
and Cas9
Tumefaciens
mediated T-DNA
transfer
In vivo expression of
sgRNA and Cas9
Formation of
sgRNA
complex
Purified
Recombinant
Cas9
In vitro transcribed
sgRNA
In vitro formation of gRNA-Cas9
complex
Direct delivery into cells by PEG
fusion
Target detection
Targeted cleavage
Cell repair mechanism
Mutated
genome
Mutated genome
DNA free genome editing
DNA-free CRISPR/Cas9Classic CRISPR/Cas9
(Metje-Sprink et al 2019)
46. Cas 9 nuclease fused with
chromatin modification
enzymes DNMT domain
Epigenome modification
Methylation
Activity of stressor, diseases
resistance gene promoter and
enhancer, and also may activate the
silent gene
Histone modification
How epigenetics
changes developed in
plants and how plants
are adopted in a
diverse
environment??
(Aglawe et al 2018)
47. Targeted transcriptional regulation
Transcription factors, activators,
enhancers and suppressors
Regulate gene
expression
Transcriptional level
SDNs used to target transcriptional regulation of endogenous genes
Improve complex or quantitative traits
Cas9 nucleases fused with activation domain or suppressor domain to regulate gene expression
(Aglawe et al 2018)
48. ⢠Argentina: NPBTs in 2015
⢠No any new combination of genetic material (e.g. a transgene/uses a transgene
which is removed in the final product)- a non-GM regulatory classification
⢠New combination of genetic material (e.g. uses a transgene which remains in
the final product)- final product falls under GM classification
Regulatory considerations of genome editing
(Lema, 2019; Friedrichs, 2019)
Process-triggered GE regulatory systems Product-triggered regulations
Australia, New Zealand, Europe, and India Canada and the United States
Consider: techniques used Relevant novelty of the trait was considered,
irrespective of the technology used
If recombinant DNA technologies are deployed in the
development of a crop, then regulation applies
Focuses on the inherent risk of the final product
New regulations of genome editing:
(Khatodia et al 2016)
49. Commercialized output of Genome editing
⢠DuPont-Pioneerâs new CRISPR-Cas waxy corn hybrid (disrupted Wx1)
⢠First CRISPR edited plant in market
⢠Without Wx1, corn produce a large amount of amylopectin
(Nature Biotechnology NEWS)
50. Conclusions
⢠GE revolutionized the vegetable breeding, due to its simplicity, flexibility,
consistency, and high-efficiency
⢠CRISPR can improve crops more quickly than traditional approaches if the
nucleotide sequence, function of target gene and efficient plant transformation
methods are known
⢠Production of non-transgenic plants have been the most important goal for the
practical use of genome editing
⢠Number of traits right from plant organ development, reproductive traits, biotic
and abiotic stresses as well as various quality traits
⢠Reduction in generation cycle, linkage drag and time required to produce the
variety with improve traits
⢠Potential of the new approaches like: base editing, DNA free genome editing,
epigenome modification and targeted transcriptional regulation are still lacking in
vegetable crops
51. Projects on CRISPR Cas9 at PAU
Development of a haploid inducer stock
through CRISPR/Cas9 RNP mediated knockout of ZmPLA1
gene and its orthologue in Maize and Rice: Dr Priti Sharma and
Dr D. Bhatia
Engineering of rice susceptible elite cultivars for enhanced disease resistance using
genome editing CRISPR/Cas9 technology
Dr Arun Kumar
DST Funded Project Development of resistant starch wheat using genome editing
technology Dr Pooja Manchanda
⢠Enhancement of rice bran oil quality through CRISPR/CAS9 based editing of
LIPOXYGENASE 3 (LOX3) gene
⢠CRISPR/Cas9-mediated PECTATE LYASE gene editing for enhanced shelf life of tomato
⢠Genome Editing of Lipoxygenase-2 (Lox-2) to eliminate beany flavor in soybean
Students research project
52. CRISPR pioneers (from left to right): Jennifer
Doudna, Feng Zhang, and Emmanuelle Charpentier
J Doudna: Department of Molecular and
Cell Biology, University of California,
Berkeley
E Charpentier: Umea Centre for Microbial
Research, Department of Molecular Biology,
UmeĂĽ University, Sweden
F. Zhang: Broad Institute of MIT
Cambridge, USA.
THANK YOU
Editor's Notes
(self prunung, fruit weight, shape, fasication, multiflora and lycopene genes)
