4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea
•Download as PPT, PDF•
2 likes•767 views
This document summarizes a study that used DNA barcoding to identify and classify tea clones from Sri Lanka. Researchers extracted DNA from fresh and processed tea leaf samples using modified CTAB and other extraction methods. They amplified the trnH-psbA spacer region via PCR and sequenced the DNA. Sequence alignments and phylogenetic trees showed genetic variation between clones but close relationships to Camellia sinensis. This is the first method to barcode processed tea, allowing a database to authenticate Sri Lankan tea cultivars.
Report
Share
Report
Share
![[object Object],[object Object],[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Recommended
An improved method for RNA extraction from woody legume species Acacia koa A....
It is difficult to extract high-quality RNA of sufficient quantity from the stem tissues of tree legumes, such as Acacia koa and Leucaena leucocephala, because they contain high amounts of phenolic compounds and polysaccharides. The objective of this study was to develop an improved protocol that produces high-quality RNA from the stem tissues of these tree legumes. We developed a modified method that utilizes a lysis buffer containing a mixture of two commercially available reagents, RLT buffer from Qiagen RNeasy Kit and Fruit-mate™ from Takara. Comparison of the modified method with four other RNA extraction methods (Qiagen RNeasy, Fruit-mate™, TRIzol, and cetyltrimethylammonium bromide (CTAB)) showed that the modified method was far superior to the other methods. The extracted RNA produced reproducible DNA products in reverse transcription-polymerase chain reaction (RT-PCR). This improved protocol is rapid and easy, and it will facilitate genetic studies of A. koa, L. leucocephala, and other woody plants.
Intraspecific variation in Solanum xanthocarpum schard. and wendl.revealed by...
Intraspecific variation in Solanum xanthocarpum schard. and wendl.revealed by...researchplantsciences
Inter-simple sequence repeat (ISSR) analysis was performed in seven accessions of Solanum xanthocarpum Schard. and Wendl. of Assam to evaluate the applicability of this analysis for assessing the intraspecific variation. The value of similarity indices ranged from 0.375 to 0.125. The similarity result indicates the presence of high level of genetic diversity among the accessions of Solanum xanthocarpum Schard. and Wendl. UPGMA cluster analysis revealed clear grouping among the populations. The primers showed abilities in detecting genetic diversity across wild accessions of Solanum xanthocarpum Schard. and Wendl. Thus, ISSR-PCR technology can be used to study genetic variation and genetic relationships in the genus Solanum xanthocarpum Schard. and Wendl.
Article Citation:
Ajoy Kumar Das, Sailendra Prasad Borah.
Intraspecific variation in Solanum xanthocarpum Schard. and Wendl. revealed by ISSR marker.
Journal of Research in Plant Sciences (2012) 1(2): 146-152.
Full Text:
http://www.plantsciences.co.in/documents/PS0035.pdfHPTLC determination of carotenoid profile in the leaf and bark samples of lor...
Influence of host plants on the carotenoid profile of Loranthus longiflorus leaf and bark samples collected from Casuarina equisetifolia and Ficus religiosa host trees were determined by HPTLC method. The methanol extract of L. longiflorus leaf samples obtained from C. equisetifolia host trees showed 9 compounds while it was 8 compounds in the leaf samples collected from F. religiosa host tree. Among the compounds, 5 and 3 compound in each sample, respectively, was identified as carotinoids while the others were unknown. Four compounds from each leaf samples collected from C. equisetifolia (peak no. 4- 6 & 8) and F. religiosa (peak no. 1-3 & 6) host trees showed similar Rf values (0.15, 0.19, 0.23 & 0.53, respectively). Similarly, the methanol extract of L. longiflorus bark sample collected from C. equisetifolia and F. religiosa host trees contained 8 compounds each. Of these compounds only 3 from each sample was identified as carotenoids whereas others were unknown and none of these compounds showed any similar Rf values. One compound from leaf and park samples of L. longiflorus collected from C. equisetifolia (peak no. 6 & 4) and F. religiosa (peak no. 4 & 3) showed similar Rf values (0.23 & 0.26), respectively.
The International Journal of Engineering and Science (IJES)
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
IJRPS-2011
The document summarizes research on the plant Desmodium gangeticum. It finds that the methanolic extract of the leaves contains N, N-dimethyltryptamine through analysis using HPTLC. Specifically:
1) HPTLC analysis of the methanolic leaf extract revealed 10 peaks, indicating the presence of multiple compounds.
2) One compound, labeled DG1, was isolated through PTLC and found to have a Rf value of 0.82 through HPTLC, matching N, N-dimethyltryptamine.
3) While tentative due to a lack of NMR and mass spectroscopy, the research indicates N, N-dimethyltryptamine is present in the leaves of Des
TRIBESTAN AUSTRALIAN study
This document compares two analytical methods, photometric and HPLC-ELSD, for determining components in Tribulus terrestris, particularly the steroidal saponins protodioscin and protogracillin. The photometric method is non-selective and can give misleading results by responding to other compounds, while HPLC-ELSD is more selective but degradation can occur during extraction. Analysis of samples from different geographical origins showed wide phytochemical variation detectable by HPLC-ELSD but not the photometric method. HPLC-ELSD is recommended for accurate analysis of Tribulus terrestris products.
Purification of nucleic acids
Effective disruption of the biological matrix (cell, tissue, environmental or biological sample) to release the nucleic acids. Denaturation of structural proteins associated with the nucleic acids (nucleoproteins) Inactivation of nucleases that will degrade the isolated product (RNase and/or DNase).
Once the genomic DNA is bound to the silica membrane, the nucleic acid is washed with a salt/ethanol solution. These washes remove contaminating proteins, lipopolysaccharides and small RNAs to increase purity while keeping the DNA bound to the silica membrane column.
There are five basic steps of DNA extraction that are consistent across all the possible DNA purification chemistries:
disruption of the cellular structure to create a lysate,
separation of the soluble DNA from cell debris and other insoluble material,
binding the DNA of interest to a purification matrix,
washing proteins and other contaminants away from the matrix and
elution of the DNA.
Blood genomic DNA extraction - Jackson Chary
This document provides instructions for extracting genomic DNA from whole blood using a solution-based extraction kit. The summary is as follows:
The procedure involves lysing red blood cells and white blood cells to isolate genomic DNA from whole blood. The cells are lysed using specific lysis buffers, and proteins and other contaminants are removed through precipitation and washing steps. High molecular weight genomic DNA is then purified through isopropanol precipitation. The extracted DNA can be analyzed through agarose gel electrophoresis and spectrophotometry to assess quality and concentration. High quality genomic DNA will appear as an intact band on the gel without RNA contamination and have an A260/280 ratio around 1.8, indicating pure DNA.
Recommended
An improved method for RNA extraction from woody legume species Acacia koa A....
It is difficult to extract high-quality RNA of sufficient quantity from the stem tissues of tree legumes, such as Acacia koa and Leucaena leucocephala, because they contain high amounts of phenolic compounds and polysaccharides. The objective of this study was to develop an improved protocol that produces high-quality RNA from the stem tissues of these tree legumes. We developed a modified method that utilizes a lysis buffer containing a mixture of two commercially available reagents, RLT buffer from Qiagen RNeasy Kit and Fruit-mate™ from Takara. Comparison of the modified method with four other RNA extraction methods (Qiagen RNeasy, Fruit-mate™, TRIzol, and cetyltrimethylammonium bromide (CTAB)) showed that the modified method was far superior to the other methods. The extracted RNA produced reproducible DNA products in reverse transcription-polymerase chain reaction (RT-PCR). This improved protocol is rapid and easy, and it will facilitate genetic studies of A. koa, L. leucocephala, and other woody plants.
Intraspecific variation in Solanum xanthocarpum schard. and wendl.revealed by...
Intraspecific variation in Solanum xanthocarpum schard. and wendl.revealed by...researchplantsciences
Inter-simple sequence repeat (ISSR) analysis was performed in seven accessions of Solanum xanthocarpum Schard. and Wendl. of Assam to evaluate the applicability of this analysis for assessing the intraspecific variation. The value of similarity indices ranged from 0.375 to 0.125. The similarity result indicates the presence of high level of genetic diversity among the accessions of Solanum xanthocarpum Schard. and Wendl. UPGMA cluster analysis revealed clear grouping among the populations. The primers showed abilities in detecting genetic diversity across wild accessions of Solanum xanthocarpum Schard. and Wendl. Thus, ISSR-PCR technology can be used to study genetic variation and genetic relationships in the genus Solanum xanthocarpum Schard. and Wendl.
Article Citation:
Ajoy Kumar Das, Sailendra Prasad Borah.
Intraspecific variation in Solanum xanthocarpum Schard. and Wendl. revealed by ISSR marker.
Journal of Research in Plant Sciences (2012) 1(2): 146-152.
Full Text:
http://www.plantsciences.co.in/documents/PS0035.pdfHPTLC determination of carotenoid profile in the leaf and bark samples of lor...
Influence of host plants on the carotenoid profile of Loranthus longiflorus leaf and bark samples collected from Casuarina equisetifolia and Ficus religiosa host trees were determined by HPTLC method. The methanol extract of L. longiflorus leaf samples obtained from C. equisetifolia host trees showed 9 compounds while it was 8 compounds in the leaf samples collected from F. religiosa host tree. Among the compounds, 5 and 3 compound in each sample, respectively, was identified as carotinoids while the others were unknown. Four compounds from each leaf samples collected from C. equisetifolia (peak no. 4- 6 & 8) and F. religiosa (peak no. 1-3 & 6) host trees showed similar Rf values (0.15, 0.19, 0.23 & 0.53, respectively). Similarly, the methanol extract of L. longiflorus bark sample collected from C. equisetifolia and F. religiosa host trees contained 8 compounds each. Of these compounds only 3 from each sample was identified as carotenoids whereas others were unknown and none of these compounds showed any similar Rf values. One compound from leaf and park samples of L. longiflorus collected from C. equisetifolia (peak no. 6 & 4) and F. religiosa (peak no. 4 & 3) showed similar Rf values (0.23 & 0.26), respectively.
The International Journal of Engineering and Science (IJES)
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
IJRPS-2011
The document summarizes research on the plant Desmodium gangeticum. It finds that the methanolic extract of the leaves contains N, N-dimethyltryptamine through analysis using HPTLC. Specifically:
1) HPTLC analysis of the methanolic leaf extract revealed 10 peaks, indicating the presence of multiple compounds.
2) One compound, labeled DG1, was isolated through PTLC and found to have a Rf value of 0.82 through HPTLC, matching N, N-dimethyltryptamine.
3) While tentative due to a lack of NMR and mass spectroscopy, the research indicates N, N-dimethyltryptamine is present in the leaves of Des
TRIBESTAN AUSTRALIAN study
This document compares two analytical methods, photometric and HPLC-ELSD, for determining components in Tribulus terrestris, particularly the steroidal saponins protodioscin and protogracillin. The photometric method is non-selective and can give misleading results by responding to other compounds, while HPLC-ELSD is more selective but degradation can occur during extraction. Analysis of samples from different geographical origins showed wide phytochemical variation detectable by HPLC-ELSD but not the photometric method. HPLC-ELSD is recommended for accurate analysis of Tribulus terrestris products.
Purification of nucleic acids
Effective disruption of the biological matrix (cell, tissue, environmental or biological sample) to release the nucleic acids. Denaturation of structural proteins associated with the nucleic acids (nucleoproteins) Inactivation of nucleases that will degrade the isolated product (RNase and/or DNase).
Once the genomic DNA is bound to the silica membrane, the nucleic acid is washed with a salt/ethanol solution. These washes remove contaminating proteins, lipopolysaccharides and small RNAs to increase purity while keeping the DNA bound to the silica membrane column.
There are five basic steps of DNA extraction that are consistent across all the possible DNA purification chemistries:
disruption of the cellular structure to create a lysate,
separation of the soluble DNA from cell debris and other insoluble material,
binding the DNA of interest to a purification matrix,
washing proteins and other contaminants away from the matrix and
elution of the DNA.
Blood genomic DNA extraction - Jackson Chary
This document provides instructions for extracting genomic DNA from whole blood using a solution-based extraction kit. The summary is as follows:
The procedure involves lysing red blood cells and white blood cells to isolate genomic DNA from whole blood. The cells are lysed using specific lysis buffers, and proteins and other contaminants are removed through precipitation and washing steps. High molecular weight genomic DNA is then purified through isopropanol precipitation. The extracted DNA can be analyzed through agarose gel electrophoresis and spectrophotometry to assess quality and concentration. High quality genomic DNA will appear as an intact band on the gel without RNA contamination and have an A260/280 ratio around 1.8, indicating pure DNA.
Antimicrobial activity of catharanthus roseus .
The document summarizes a study that investigated the antimicrobial activity and phytochemical composition of extracts from Catharanthus roseus against wound isolates. Key findings include:
1) Ethanolic extracts of C. roseus showed the highest antibacterial activity against Pseudomonas aeruginosa. Phytochemical analysis revealed the presence of flavonoids, tannins, alkaloids and terpenoids in extracts.
2) Against various wound pathogens, ethanolic extracts were most effective against P. aeruginosa, followed by S. aureus, E. coli, K. pneumoniae and S. pyogenes.
3) Thin layer chromatography identified brown spots in ethanolic extracts and yellow spots in
Isolation of RNA
methods of isolation and extraction of RNA by using different source such as plant tissues, bacterial culture, etc. Ribonucleic acid can be isolated from plant tissue for the purpose of:
– mRNA isolation
– In vitro translation
– Northern analysis
– cDNA library construction
Rigorous ribonuclease free environment is to be maintained
All glasswares, plasticwares and reagents made RNAse free (using 0.01% DEPC)
Next day, DEPC is inactivated by autoclaving for 30 min
Total RNA is isolated and separated from DNA and protein after extraction with a solution called as Trizol. Trizol is an acidic solution containing guanidinium thiocyanate (GITC), phenol and chloroform. GITC irreversibly denatures proteins and RNases. This is followed by centrifugation.
Dna extraction from molluscs -Jackson chary
This document describes a method for efficiently extracting high-quality genomic DNA from molluscs. The method uses an automatic nucleic acid isolation system to extract DNA from tissue samples stored in ethanol. The extracted DNA is purified and analyzed for concentration, purity, and integrity. PCR is used to amplify histone H3 genes and random DNA segments from the extracted DNA of various mollusc species, demonstrating the DNA is suitable for downstream molecular applications like sequencing and population genetics studies.
DNA & RNA isolation
The technique of molecular biology like DNA isolation, RNA isolation, PCR, Western blot, RFLP, etc was developed with development in science. This presentation includes the method of DNA and RNA isolation and their Quantification techniques.
Tephrosia cinerea (leguminoseae) crude leaves extracts and their phytotoxic ...
Tephrosia cinerea (leguminoseae) crude leaves extracts and their phytotoxic ...SSR Institute of International Journal of Life Sciences
ABSTRACT- This research evaluated the phytotoxic effect of the hexane (H.E), ethyl acetate (EtOAc.E) and methanolic (MeOH.E) crude extracts of the Tephrosia cinerea leaves on the seed germination of seeds using two weed species, Mimosa pudica (Malícia) and Senna obtusifolia (Mata-pasto), as test plants. The compounds were isolated using classic chromatography techniques and the structural elucidation of the compounds was performed by 1H and 13C NMR (1D and 2D) techniques. The ethyl acetate and methanolic extracts of T. cinerea were the most active, as they inhibited the germination of seeds in 92.0% and 81.0% respectively of malícia and mata-pasto, the ethyl acetate extract inhibited germination by 81.0% and the methanolic extract by 32.0%. The chemical study led to isolation of cinnamic acid and rotenone from the ethyl acetate extract, and mixture containing triacylglycerol and β-sitosterol fatty acids from the hexane extract and the disaccharide trehalose from methanolic extract.
Key-words- Invasive species, Phytotoxicity, Crude extracts, Rotenone
Machine learning/deep learning application in tea industry
Tea industry is looking towards Machine/Deep learning technology to improvise the process related to tea manufacturing including tea leaves selection, quality, chemical analysis/composition, health benefits and end-to-end supply. The slide coves gist of already published work of some of the researchers and, also includes scope of future work for Tea plus ML/deep learning enthusiast.
Asmaa sabrey
This document describes a study on genetic improvement of Stevia rebaudiana genotypes through selection. Nineteen Stevia accessions were collected and evaluated over two seasons for morphological and chemical traits. High genetic diversity was found between genotypes for traits like plant height, branch number, leaf weight, and content of stevioside and rebaudioside A. Random amplified polymorphic DNA (RAPD) analysis also showed genetic polymorphisms between accessions. The results indicate potential for these genotypes in future breeding programs to develop superior Stevia varieties.
Dna isolation from various sources
this section helps students how to isolate DNA from various sources. specially life life science fields such as biotechnology, biology, and medical laboratory
Dna extraction from whole blood
This lectureis about DNA extraction from whole Blood presented by Tuba nafees she is msc graduate in Biotechnology from University of Karachi, Sindh Pakistan.
lecture video is also there in youtube link:
https://www.youtube.com/watch?v=cGr__SuqYgY&t=409s
Alkaline lysis as an efficient and economical alternative for dna extraction ...
Alkaline lysis as an efficient and economical alternative for dna extraction ...Jose Camilo Torres Romero
Studies related to DNA extraction are becoming more ambitious in the sense that large studies are intended to be carried out with minimum DNA sources. The DNA extracted must be of quality for genetic, forensic, population and genomic studies, these samples must be easy to obtain and product of efficient manipulation.Samples obtained from horsehair are an importanttechnical challenge since they constitute the preferred non-invasive sample for genetic studies in horses, which has been shown to obtain reliable results in a short time. In this sense, working into effective techniques to optimizeDNA extraction of scarse samples is a pertinent task. In this study, different DNA extraction methods were evaluated from mane samples obtained from a population of wild horses from the Region of Arauca in eastern Colombia.Three DNA extraction methods were evaluated (phenol chloroform, alkaline lysis and twocommercial DNA extraction kit), DNA concentration, purity and qualityweredeterminate and PCR amplification product were obtain using primers for a hypervariable region of DNA mitochondrial. DNA preparation from hair roots using alkaline lysis was the most economical and efficient method with which it was possible to obtain high quality and quantity DNAComparison of different dna extraction methods for forensic samples
This study compared three DNA extraction kits - the QIAamp DNA Investigator kit from Qiagen, the ZR Genomic DNA kit from Zymo Research, and the AccuPrep Genomic DNA Extraction kit from Bioneer. The Qiagen kit produced the highest DNA yield from 200 μl of blood at 5.6 μg. It also produced the purest DNA with an A260/A280 ratio of 1.85. The Zymo kit had the shortest extraction time at 25 minutes but yielded only 2.39 μg of DNA. While the Bioneer kit cost the least per sample at $1.50, it produced a lower yield of 2.74 μg and poorer purity. The study provides a comparison
DNA Extraction Methods
This document discusses DNA extraction methods. It defines DNA as the molecule that carries genetic information in cells. There are several common DNA extraction procedures, including organic phenol-chloroform extraction and non-organic proteinase K and salting out extraction. The organic extraction method uses phenol-chloroform to separate and purify DNA from other cellular components after cell lysis and protein digestion. It results in high-quality double-stranded DNA but is time-consuming and involves hazardous chemicals. Non-organic and chelex extractions are simpler alternatives that yield single-stranded DNA and remove PCR inhibitors. Extracted DNA has various applications, such as disease diagnosis, forensic DNA fingerprinting, and plant breeding.
Isolation of plant genomic DNA
The document summarizes a workshop held on February 11, 2021 at Smt. Kasturbai Walchand College in Sangli to demonstrate experiments from the revised syllabus of the B.Sc. III practical course. It includes demonstrations and explanations of experiments on isolating plant genomic DNA and estimating the DNA using diphenylamine. It also discusses the steps involved in genetically engineering golden rice through the introduction of genes from daffodil and bacteria to allow the rice plant to produce beta-carotene.
DNA extraction method for Plant sample
The CTAB method is used to extract DNA from plant cells. It involves lysing plant cells with the cationic detergent CTAB in a similar way that SDS is used to lyse bacterial cells. The procedure freezes and grinds a plant sample, incubates it in CTAB buffer, precipitates the DNA with chloroform, isoamyl alcohol and isopropanol, washes it with ethanol, and dissolves the final DNA pellet in TE buffer. Gel electrophoresis is then used to check the integrity of the extracted DNA.
Purification of dna from living cells
1. Purification of total DNA from bacterial cells involves growing and harvesting the bacterial culture, disrupting the cells, removing cellular components except DNA, and concentrating the DNA.
2. Cells are disrupted through chemical or physical lysis methods. Chemical lysis uses lysozyme and EDTA to weaken the cell wall and SDS to disrupt the cell membrane.
3. Phenol-chloroform extraction is used to remove proteins from the cell extract by partitioning them into the organic phase, leaving DNA and RNA in the aqueous phase. Ethanol precipitation is then used to concentrate the purified DNA.
corrected (Autosaved) (Autosaved)
The document discusses an internship involving molecular studies and phytochemical analysis of plants. It describes extracting DNA from Zinnia plants using the CTAB method with varying protocols, and performing phytochemical tests on Aloe vera to detect various compounds. The intern acknowledges those who assisted with the project. Tables of contents and introduction are provided on Zinnia, DNA extraction, CTAB method, Aloe vera, and the phytochemicals to be tested.
Dna extraction from human blood
This document describes the process of extracting DNA from human blood. It involves lysing blood cells, digesting proteins, washing red blood cells, precipitating proteins and DNA, and purifying the extracted DNA. The key steps are cell lysis using TNE buffer, protein digestion with Proteinase K and SDS, phenol-chloroform extraction to separate DNA from other cell components, precipitation of DNA with isopropanol, and resuspension of purified DNA in TE buffer. A variety of reagents are required including Tris, EDTA, NaCl, SDS, Proteinase K, phenol, chloroform, isopropanol, and ethanol.
DNA- Basics on isolation, quantification, storage
This presentation gives an overall idea about the DNA, its history, protocol for isolation, methods of quantification and different storage conditions
Isolation of DNA
This document describes several methods for isolating and purifying DNA, RNA, and bacteriophages from plant and bacterial cells. For DNA isolation from plant cells, the method involves freezing and grinding plant tissue, lysing the cells with CTAB buffer, purifying the DNA with chloroform, precipitating it with isopropanol, washing it, and eluting the purified DNA. For plasmid and bacteriophage DNA isolation from bacterial cells, several techniques are described that separate DNA based on size or conformation differences, such as alkaline lysis and CsCl gradient centrifugation. RNA isolation methods include organic extraction to separate RNA from other cell components, as well as direct lysis methods.
Dna extraction overview
To obtain DNA in a relatively purified form which can be used for further investigations, i.e. PCR, sequencing
Dario Lijtmaer - Brief introduction to barcoding and the current goals and ca...
Dario Lijtmaer - Brief introduction to barcoding and the current goals and ca...Consortium for the Barcode of Life (CBOL)
This document provides an overview of a training session on DNA barcoding methods. The training will cover: Module I on the introduction and pipeline of barcoding; Module II on acquiring and handling specimens and tissue samples; Module III on laboratory methods and information management; and Module IV on taxon-specific aspects of the barcoding pipeline. It also discusses the organization of the International Barcode of Life project (iBOL), which aims to generate barcodes for 5 million species by 2014 through various working groups focused on different taxa and methodologies.Dna barcoding
DNA barcoding was first proposed by Paul Herbert in 2003.
Basic Principle
Dna Barcoding is based on premise that a short standardized sequence can distinguish individuals of a specie because genetic variation between specie exceeds that within specie.
More Related Content
What's hot
Antimicrobial activity of catharanthus roseus .
The document summarizes a study that investigated the antimicrobial activity and phytochemical composition of extracts from Catharanthus roseus against wound isolates. Key findings include:
1) Ethanolic extracts of C. roseus showed the highest antibacterial activity against Pseudomonas aeruginosa. Phytochemical analysis revealed the presence of flavonoids, tannins, alkaloids and terpenoids in extracts.
2) Against various wound pathogens, ethanolic extracts were most effective against P. aeruginosa, followed by S. aureus, E. coli, K. pneumoniae and S. pyogenes.
3) Thin layer chromatography identified brown spots in ethanolic extracts and yellow spots in
Isolation of RNA
methods of isolation and extraction of RNA by using different source such as plant tissues, bacterial culture, etc. Ribonucleic acid can be isolated from plant tissue for the purpose of:
– mRNA isolation
– In vitro translation
– Northern analysis
– cDNA library construction
Rigorous ribonuclease free environment is to be maintained
All glasswares, plasticwares and reagents made RNAse free (using 0.01% DEPC)
Next day, DEPC is inactivated by autoclaving for 30 min
Total RNA is isolated and separated from DNA and protein after extraction with a solution called as Trizol. Trizol is an acidic solution containing guanidinium thiocyanate (GITC), phenol and chloroform. GITC irreversibly denatures proteins and RNases. This is followed by centrifugation.
Dna extraction from molluscs -Jackson chary
This document describes a method for efficiently extracting high-quality genomic DNA from molluscs. The method uses an automatic nucleic acid isolation system to extract DNA from tissue samples stored in ethanol. The extracted DNA is purified and analyzed for concentration, purity, and integrity. PCR is used to amplify histone H3 genes and random DNA segments from the extracted DNA of various mollusc species, demonstrating the DNA is suitable for downstream molecular applications like sequencing and population genetics studies.
DNA & RNA isolation
The technique of molecular biology like DNA isolation, RNA isolation, PCR, Western blot, RFLP, etc was developed with development in science. This presentation includes the method of DNA and RNA isolation and their Quantification techniques.
Tephrosia cinerea (leguminoseae) crude leaves extracts and their phytotoxic ...
Tephrosia cinerea (leguminoseae) crude leaves extracts and their phytotoxic ...SSR Institute of International Journal of Life Sciences
ABSTRACT- This research evaluated the phytotoxic effect of the hexane (H.E), ethyl acetate (EtOAc.E) and methanolic (MeOH.E) crude extracts of the Tephrosia cinerea leaves on the seed germination of seeds using two weed species, Mimosa pudica (Malícia) and Senna obtusifolia (Mata-pasto), as test plants. The compounds were isolated using classic chromatography techniques and the structural elucidation of the compounds was performed by 1H and 13C NMR (1D and 2D) techniques. The ethyl acetate and methanolic extracts of T. cinerea were the most active, as they inhibited the germination of seeds in 92.0% and 81.0% respectively of malícia and mata-pasto, the ethyl acetate extract inhibited germination by 81.0% and the methanolic extract by 32.0%. The chemical study led to isolation of cinnamic acid and rotenone from the ethyl acetate extract, and mixture containing triacylglycerol and β-sitosterol fatty acids from the hexane extract and the disaccharide trehalose from methanolic extract.
Key-words- Invasive species, Phytotoxicity, Crude extracts, Rotenone
Machine learning/deep learning application in tea industry
Tea industry is looking towards Machine/Deep learning technology to improvise the process related to tea manufacturing including tea leaves selection, quality, chemical analysis/composition, health benefits and end-to-end supply. The slide coves gist of already published work of some of the researchers and, also includes scope of future work for Tea plus ML/deep learning enthusiast.
Asmaa sabrey
This document describes a study on genetic improvement of Stevia rebaudiana genotypes through selection. Nineteen Stevia accessions were collected and evaluated over two seasons for morphological and chemical traits. High genetic diversity was found between genotypes for traits like plant height, branch number, leaf weight, and content of stevioside and rebaudioside A. Random amplified polymorphic DNA (RAPD) analysis also showed genetic polymorphisms between accessions. The results indicate potential for these genotypes in future breeding programs to develop superior Stevia varieties.
Dna isolation from various sources
this section helps students how to isolate DNA from various sources. specially life life science fields such as biotechnology, biology, and medical laboratory
Dna extraction from whole blood
This lectureis about DNA extraction from whole Blood presented by Tuba nafees she is msc graduate in Biotechnology from University of Karachi, Sindh Pakistan.
lecture video is also there in youtube link:
https://www.youtube.com/watch?v=cGr__SuqYgY&t=409s
Alkaline lysis as an efficient and economical alternative for dna extraction ...
Alkaline lysis as an efficient and economical alternative for dna extraction ...Jose Camilo Torres Romero
Studies related to DNA extraction are becoming more ambitious in the sense that large studies are intended to be carried out with minimum DNA sources. The DNA extracted must be of quality for genetic, forensic, population and genomic studies, these samples must be easy to obtain and product of efficient manipulation.Samples obtained from horsehair are an importanttechnical challenge since they constitute the preferred non-invasive sample for genetic studies in horses, which has been shown to obtain reliable results in a short time. In this sense, working into effective techniques to optimizeDNA extraction of scarse samples is a pertinent task. In this study, different DNA extraction methods were evaluated from mane samples obtained from a population of wild horses from the Region of Arauca in eastern Colombia.Three DNA extraction methods were evaluated (phenol chloroform, alkaline lysis and twocommercial DNA extraction kit), DNA concentration, purity and qualityweredeterminate and PCR amplification product were obtain using primers for a hypervariable region of DNA mitochondrial. DNA preparation from hair roots using alkaline lysis was the most economical and efficient method with which it was possible to obtain high quality and quantity DNAComparison of different dna extraction methods for forensic samples
This study compared three DNA extraction kits - the QIAamp DNA Investigator kit from Qiagen, the ZR Genomic DNA kit from Zymo Research, and the AccuPrep Genomic DNA Extraction kit from Bioneer. The Qiagen kit produced the highest DNA yield from 200 μl of blood at 5.6 μg. It also produced the purest DNA with an A260/A280 ratio of 1.85. The Zymo kit had the shortest extraction time at 25 minutes but yielded only 2.39 μg of DNA. While the Bioneer kit cost the least per sample at $1.50, it produced a lower yield of 2.74 μg and poorer purity. The study provides a comparison
DNA Extraction Methods
This document discusses DNA extraction methods. It defines DNA as the molecule that carries genetic information in cells. There are several common DNA extraction procedures, including organic phenol-chloroform extraction and non-organic proteinase K and salting out extraction. The organic extraction method uses phenol-chloroform to separate and purify DNA from other cellular components after cell lysis and protein digestion. It results in high-quality double-stranded DNA but is time-consuming and involves hazardous chemicals. Non-organic and chelex extractions are simpler alternatives that yield single-stranded DNA and remove PCR inhibitors. Extracted DNA has various applications, such as disease diagnosis, forensic DNA fingerprinting, and plant breeding.
Isolation of plant genomic DNA
The document summarizes a workshop held on February 11, 2021 at Smt. Kasturbai Walchand College in Sangli to demonstrate experiments from the revised syllabus of the B.Sc. III practical course. It includes demonstrations and explanations of experiments on isolating plant genomic DNA and estimating the DNA using diphenylamine. It also discusses the steps involved in genetically engineering golden rice through the introduction of genes from daffodil and bacteria to allow the rice plant to produce beta-carotene.
DNA extraction method for Plant sample
The CTAB method is used to extract DNA from plant cells. It involves lysing plant cells with the cationic detergent CTAB in a similar way that SDS is used to lyse bacterial cells. The procedure freezes and grinds a plant sample, incubates it in CTAB buffer, precipitates the DNA with chloroform, isoamyl alcohol and isopropanol, washes it with ethanol, and dissolves the final DNA pellet in TE buffer. Gel electrophoresis is then used to check the integrity of the extracted DNA.
Purification of dna from living cells
1. Purification of total DNA from bacterial cells involves growing and harvesting the bacterial culture, disrupting the cells, removing cellular components except DNA, and concentrating the DNA.
2. Cells are disrupted through chemical or physical lysis methods. Chemical lysis uses lysozyme and EDTA to weaken the cell wall and SDS to disrupt the cell membrane.
3. Phenol-chloroform extraction is used to remove proteins from the cell extract by partitioning them into the organic phase, leaving DNA and RNA in the aqueous phase. Ethanol precipitation is then used to concentrate the purified DNA.
corrected (Autosaved) (Autosaved)
The document discusses an internship involving molecular studies and phytochemical analysis of plants. It describes extracting DNA from Zinnia plants using the CTAB method with varying protocols, and performing phytochemical tests on Aloe vera to detect various compounds. The intern acknowledges those who assisted with the project. Tables of contents and introduction are provided on Zinnia, DNA extraction, CTAB method, Aloe vera, and the phytochemicals to be tested.
Dna extraction from human blood
This document describes the process of extracting DNA from human blood. It involves lysing blood cells, digesting proteins, washing red blood cells, precipitating proteins and DNA, and purifying the extracted DNA. The key steps are cell lysis using TNE buffer, protein digestion with Proteinase K and SDS, phenol-chloroform extraction to separate DNA from other cell components, precipitation of DNA with isopropanol, and resuspension of purified DNA in TE buffer. A variety of reagents are required including Tris, EDTA, NaCl, SDS, Proteinase K, phenol, chloroform, isopropanol, and ethanol.
DNA- Basics on isolation, quantification, storage
This presentation gives an overall idea about the DNA, its history, protocol for isolation, methods of quantification and different storage conditions
Isolation of DNA
This document describes several methods for isolating and purifying DNA, RNA, and bacteriophages from plant and bacterial cells. For DNA isolation from plant cells, the method involves freezing and grinding plant tissue, lysing the cells with CTAB buffer, purifying the DNA with chloroform, precipitating it with isopropanol, washing it, and eluting the purified DNA. For plasmid and bacteriophage DNA isolation from bacterial cells, several techniques are described that separate DNA based on size or conformation differences, such as alkaline lysis and CsCl gradient centrifugation. RNA isolation methods include organic extraction to separate RNA from other cell components, as well as direct lysis methods.
Dna extraction overview
To obtain DNA in a relatively purified form which can be used for further investigations, i.e. PCR, sequencing
What's hot (20)
Tephrosia cinerea (leguminoseae) crude leaves extracts and their phytotoxic ...
Tephrosia cinerea (leguminoseae) crude leaves extracts and their phytotoxic ...
Machine learning/deep learning application in tea industry
Machine learning/deep learning application in tea industry
Alkaline lysis as an efficient and economical alternative for dna extraction ...
Alkaline lysis as an efficient and economical alternative for dna extraction ...
Comparison of different dna extraction methods for forensic samples
Comparison of different dna extraction methods for forensic samples
Viewers also liked
Dario Lijtmaer - Brief introduction to barcoding and the current goals and ca...
Dario Lijtmaer - Brief introduction to barcoding and the current goals and ca...Consortium for the Barcode of Life (CBOL)
This document provides an overview of a training session on DNA barcoding methods. The training will cover: Module I on the introduction and pipeline of barcoding; Module II on acquiring and handling specimens and tissue samples; Module III on laboratory methods and information management; and Module IV on taxon-specific aspects of the barcoding pipeline. It also discusses the organization of the International Barcode of Life project (iBOL), which aims to generate barcodes for 5 million species by 2014 through various working groups focused on different taxa and methodologies.Dna barcoding
DNA barcoding was first proposed by Paul Herbert in 2003.
Basic Principle
Dna Barcoding is based on premise that a short standardized sequence can distinguish individuals of a specie because genetic variation between specie exceeds that within specie.
Gary Paakkonen Photography
This document provides information about 9 photographs taken by Gary Paakkonen. It states that the photos are copyrighted and cannot be reproduced without the photographer's consent. Brief descriptions of each photo are given, noting their subjects and locations in Ontario, Canada. Contact information is provided for viewing and purchasing prints of the full photo portfolio.
Hodgetts et al., 2016 (gen-2016-0010)
This document discusses the use of DNA barcoding for biosecurity purposes in the UK plant protection program. It presents several case studies where DNA barcoding was successfully used to identify regulated plant pests and insect vectors. Some limitations of expanding the use of DNA barcoding in diagnostic laboratories are also discussed, such as the need for large reference databases of sequences for accurate identification of species.
Poster (Final)
DNA barcoding uses short, standardized gene sequences to identify species. This study tested whether DNA sequences from the CO1, NAD4, and NAD5 genes could distinguish the fruit fly Bactrocera zonata from other Bactrocera species. DNA was extracted from B. zonata specimens collected from three locations in Egypt and sequenced. The results showed identical NAD4 sequences within populations but some single nucleotide polymorphisms in CO1, supporting its use for barcoding. Comparisons to GenBank sequences showed the closest matches were to other Bactrocera species, differing by at least 3%, demonstrating the potential for DNA barcoding to accurately identify unknown specimens.
Dr Aron Fazekas - Plant DNA Barcoding; data workflow
This document outlines the workflow for plant DNA barcoding data, including:
1) Editing raw sequence data by trimming primers, editing miscalls, and ensuring congruence between forward and reverse reads.
2) Aligning the edited sequence data using various alignment programs, and checking the alignment for errors.
3) Uploading the edited and aligned data to the Barcode of Life Database (BOLD) and using BOLD tools to quality check the data and create trees.
Dr Sarah Adamowicz - Field collections
Legal issues, logistics, data quality and acquisition, and collection/preservation methods with regards to field collecting.
Dario Lijtmaer - DNA extraction
An overview of DNA extraction protocols from small scale labs right up to high-throughput facilities.
DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and D...
DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and D...International Food Policy Research Institute
Presented on February 10th, 2013 at the Second Research Competitive Grants Conference in Islamabad, Pakistan.Dna barcoding
DNA barcoding is a standardized approach to identifying plants and animals by minimal sequences of DNA, called DNA barcodes.
DNA barcode - short gene sequences taken from a standardized portion of the genome that is used to identify species
and this presentation gives much introducing about DNA barcodes developed for Prokaryotes and Eukaryotes.
Various barcoding genes which are evolutionary conserved.
techniques to develop a DNA bar-code and its future perspectives
Current technologies and future technologies of DNA barcoding. Applications regarding environment awareness. it also contains 2-3 case studies
David Schindel - DNA Barcoding and the consortium for the barcode of life (CBOL)
David Schindel - DNA Barcoding and the consortium for the barcode of life (CBOL)Consortium for the Barcode of Life (CBOL)
Presentation explaining what and why is DNA barcoding? what are CBOL and iBOL? The activities of CBOL and the fourth International Barcode ConferenceDNA Barcoding: A simple way of identifying species by DNA
DNA barcoding makes it easier for experts and non- experts to identify species including from bits and pieces, immature forms, and those with many close look-alikes. Applications include health, environment, and education. High school students are using DNA barcoding to explore the world around them and make scientific discoveries. Like a giant Wikipedia entry, the multitude of researchers depositing DNA barcodes in GenBank are creating the first large-scale maps of the genetic structure of biodiversity.
Use of DNA barcoding and its role in the plant species/varietal Identifica...
Plant DNA barcoding research is shifting beyond performance comparisons of different DNA regions towards practical applications. The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1(CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. The studies on cucumis sp for the application of DNA barcode shows the possibility of discrimination at species level not the varietal level using the matK gene barcode. The phylogenetic tree constructed by using matK gene sequences clearly differentiated the species C. sativus and C. melo which will help for the future application in cucumis taxonomy and phylogeny studies
Flex sola
FlexSola is an innovative housing design that provides flexibility, affordability, and environmental benefits. The design allows units to accommodate one or two dwellings and be constructed with one, two, or three storeys. FlexSola units can also be expanded over time. The houses incorporate renewable energy sources like solar panels and geo-thermal heating. FlexSola addresses many current housing trends like aging populations, multigenerational living, and working from home. The flexible and affordable design helps create stable, caring communities.
Rm 01
This document outlines the syllabus for a risk management course at the University of Economics in Kraków, Poland. It includes 15 seminars covering key topics in risk management like the risk management process, financial risk, operational risk, and applying risk management in different industries. Attendance is optional but rewarded, and the exam grade will depend on test scores, class participation, and an optional presentation. Materials will be provided online, and the document lists reference books and websites for further learning.
How to Access KKU Database via VPN System
This document provides instructions for accessing research databases through Khon Kaen University's VPN system. It explains that VPN adds an extra layer of security and allows users to login remotely. The steps are to browse to the VPN website, enter username and password to sign in, choose the database you want to access, and then you can download full-text articles through the VPN connection from off-campus. The librarian's contact information is also provided for any assistance.
James Metcalfe's Real Estate Market update for Our Home Toronto 08,11
The document provides tips for applying paint to surfaces using brushes or rollers. It discusses ideal weather conditions for different paint types and how to properly load and use brushes and rollers. Maintaining a "wet edge" as you paint is emphasized to avoid lap marks. Cleaning equipment immediately after use and proper brush storage is also covered.
Advocating Sensible Sanitation in North America: What Works
PHLUSH advocates for sanitation issues in North America. They have addressed public toilet design challenges in Portland by redesigning toilets for cost effectiveness, function, safety, accessibility, and ease of maintenance. For emergency sanitation, they promoted a simple twin bucket toilet system for earthquakes. Regarding ecological sanitation, PHLUSH brought experts together, shared information on sustainable sanitation systems, and addressed code barriers. Cross-cultural information sharing on toilet design and awareness has been valuable. PHLUSH asks questions about water, climate change, and future sanitation needs.
Viewers also liked (20)
Dario Lijtmaer - Brief introduction to barcoding and the current goals and ca...
Dario Lijtmaer - Brief introduction to barcoding and the current goals and ca...
Dr Aron Fazekas - Plant DNA Barcoding; data workflow
Dr Aron Fazekas - Plant DNA Barcoding; data workflow
DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and D...
DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and D...
David Schindel - DNA Barcoding and the consortium for the barcode of life (CBOL)
David Schindel - DNA Barcoding and the consortium for the barcode of life (CBOL)
DNA Barcoding: A simple way of identifying species by DNA
DNA Barcoding: A simple way of identifying species by DNA
Use of DNA barcoding and its role in the plant species/varietal Identifica...
Use of DNA barcoding and its role in the plant species/varietal Identifica...
James Metcalfe's Real Estate Market update for Our Home Toronto 08,11
James Metcalfe's Real Estate Market update for Our Home Toronto 08,11
Advocating Sensible Sanitation in North America: What Works
Advocating Sensible Sanitation in North America: What Works
Similar to 4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea
Rice dna extraction miniprep protocol
DNA extraction is an important step in molecular assays and plays a vital role in obtaining highresolution results in gel-based systems, particularly in the case of cereals with high content of interfering components in the early steps of DNA extraction.This is a rapid miniprep DNA extraction method, optimized for rice, which was achieved via creating some modifications in present DNA extraction methods, especially in first step of breaking down and lyses of cell wall, and the use of cheap and frequent chemicals, found in every lab, in the next steps. The normal quality and quantity was obtained by the method. The PCR based assays also revealed the efficiency of the method.
The advantages of this method are: 1- it is applicable with both dry and fresh samples, 2- no need to large weight samples, 3- no need to liquid nitrogen and 4- easy, rapid and applicable in every laboratory.
molecular biology techniques -jaypee university of information technology- ra...
molcular biology techniques- ravi ranjan lb-
contents- basic molecular biology techniques - DNA and RNA isolation from plant sample, nanodrop technique, pcr and cloning.
molecular biology techniques -jaypee university of information technology- ra...
basic molecular biology techniques - DNA and RNA isolation from plant sample, nanodrop technique, pcr and cloning.
EXTRACTION OF GENOMIC DNA FROM PLANT SOURCE.pptx
The main purpose of these slides is to convey information to the Professors, Lecturers, and Students. These slides contain authentic information about this topic which is mentioned in that.
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
The document describes a protocol for isolating genomic DNA from powdered nutmeg seeds (Myristica fragrans) that yields high molecular weight DNA suitable for PCR amplification. The protocol involves a modified CTAB extraction procedure with 2M NaCl, 0.3% beta-mercaptoethanol, and 1.5% polyvinylpyrrolidone. The isolated DNA was of high quality with A260/280 ratios of 1.6-1.7 and yielded 4-6 μg/g of dried tissue. The DNA could be consistently amplified by PCR with random primers, demonstrating its suitability for molecular analysis of traded nutmeg powders.
Isolation and pcr amplification of genomic dna from traded seeds of nutmeg
This document summarizes a study that developed an efficient protocol for isolating genomic DNA from powdered nutmeg seeds. The protocol uses a modified CTAB extraction method with 2M NaCl, 0.3% beta-mercaptoethanol, and 1.5% polyvinylpyrrolidone. The isolated DNA yielded 4-6 μg/g of tissue and was successfully amplified via PCR using random primers, producing distinct band patterns. The protocol will help trace the geographic origin of traded nutmeg powders through DNA fingerprinting and molecular profiling techniques, protecting intellectual property rights.
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
The document describes a protocol for isolating genomic DNA from powdered nutmeg seeds (Myristica fragrans) that yields high molecular weight DNA suitable for PCR amplification. The protocol involves a modified CTAB extraction procedure with 2M NaCl, 0.3% beta-mercaptoethanol, and 1.5% polyvinylpyrrolidone. The isolated DNA was of high quality with A260/280 ratios of 1.6-1.7 and yielded 4-6 μg/g of dried tissue. The DNA could be consistently amplified by PCR with random primers, demonstrating its suitability for molecular analysis of traded nutmeg powders.
Journal of chromatography@ sudeb mandal
Validation and uncertainty analysis of a multi-residue method for 42 pesticides in made tea, tea infusion and spent leaves using ethyl acetate extraction and liquid chromatography–tandem mass spectrometer
ISOLATION OF DNA FROM BACTERIAL CELL 1.pptx
This document describes a procedure for isolating genomic DNA from bacterial cells. It involves growing a culture of bacterial cells, harvesting and lysing the cells to release the DNA. The DNA is then purified using phenol-chloroform extraction and precipitated with alcohol. The extracted DNA is analyzed on an agarose gel and quantified. Alternative methods are also discussed, including using DNAzol or sonication for cell lysis and silver nanoparticles or TE buffer for DNA extraction and purification. The overall procedure allows for the isolation of pure bacterial genomic DNA for use in downstream molecular biology applications.
BIO DECAFFEINATION-A STUDY ON THE EFFECTS OF BREVIBACTERIUM ON DIFFERENT SAMP...
HPLC analysis of caffeine was performed in SHIMADZU LC 20 – AD system, and the caffeine compounds were separated on a
C18 column under isocratic conditions with 40% methanol in water at a flow rate of 1.0 ml/min. Compounds eluting from the
column were detected and the peak areas were compared with those obtained with standards of known concentration. The HPLC
analysis of caffeine degradation by Brevibacterium is done by injecting the sample volume of about 20μl HPLC analysis is done
for the sample at different incubation periods with standard caffeine concentration (Known). The sample is analyzed for every
twelve hours of incubation and peak values are obtained. Caffeine concentration is an important parameter to be checked as
excessive consumption of caffeine leads to many health hazards.
Keywords: , Biodecaffeination, Brevibacterium, HPLC.
Report on molecular biology techniques
This is an internship report on molecular biology techniques, which was performed at PERD center under the guidance of Dr. Anshu Srivastava. This pdf contains all the basic information which is a preliminary requisite to know while approaching the molecular biology experimentally.
9 112 Samaradivakara S DNA barcoding of cinnamon
9 112 Samaradivakara S DNA barcoding of cinnamonUniversity of Sri Jayewardenepura, Dept Forestry and Environment
The document discusses using DNA barcoding to identify cinnamon species. It finds that the TrnH locus amplified more successfully than MatK from cinnamon leaf DNA. Sequencing of TrnH produced high quality sequences for some species, though not all matched known sequences. Extracting DNA from cinnamon bark was unsuccessful for barcoding due to low chloroplast content and inhibitory compounds. Overall, TrnH barcoding shows promise for identifying cinnamon leaf varieties but not bark.Final Project (Final Version)
This document summarizes a student research project estimating genetic variation among accessions of the Shorea robusta plant using molecular genetics techniques. The student thanks their research advisor and laboratory colleagues for guidance and assistance. They obtained leaf samples from 10 accessions of S. robusta and isolated DNA using various extraction buffer recipes and purification techniques over 5 trials, until DNA was successfully extracted and visible from all samples. The student will now amplify the isolated DNA using RAPD and SCoT PCR primers, analyze band patterns via gel electrophoresis, and use software to examine genetic relationships between accessions based on variation.
Innovative beverages
This document presents research on developing innovative beverage products using dandelion roots and leaves. Dandelion was analyzed for its chemical composition, antioxidant properties, and potential to replace some coffee and tea. Coffee substitutes were made by blending dandelion roots with Arabic coffee or instant coffee. Dandelion tea was made alone or blended with hibiscus. Sensory testing found that roots blended with light Arabic coffee and leaves blended with hibiscus were most accepted. The study aims to promote using dandelion as a natural, inexpensive plant in Egypt and to produce healthier coffee and tea substitutes.
My Biochemistry research
The document summarizes research on the anti-Salmonella typhi activities of crude extracts from Camellia sinensis (green tea). Key findings include:
- Crude extracts from green tea showed inhibition of S. typhi in agar diffusion tests, with diameter inhibition areas of 33.3-40% for ethanol extracts and 39.5-44.7% for water extracts.
- Further fractionation of the crude extract in non-aqueous solvents like n-hexane, benzene, dichloromethane, and ethyl acetate showed reduced inhibition compared to the water fraction.
- Colony counting plate experiments confirmed a decrease in bacterial colonies with the crude water extract, providing
Kenyatta university. dna extration docx
1. The document describes a HotSHOT DNA extraction method to isolate DNA from fish fins. The method uses sodium hydroxide (NaOH) to lyse cells and release DNA. The NaOH treatment denatures the DNA. Tris buffer is then used to neutralize the solution and renature the DNA.
2. The method involves homogenizing fish fins, treating with hot NaOH to lyse cells and denature DNA, cooling and neutralizing with Tris buffer. Centrifugation pellets debris and collects DNA in the supernatant.
3. The HotSHOT method provides a rapid, inexpensive way to obtain PCR-quality DNA from fish fins compared to traditional methods. The isolated DNA is suitable for
NUCLEIC ACID EXTRACTION, PURIFICATION ON AGAROSE AND POLYACRYLAMIDE GEL AND PCR
NUCLEIC ACID EXTRACTION, PURIFICATION ON AGAROSE AND POLYACRYLAMIDE GEL AND PCREmmanuel Nestory Kayuni
The document provides information about DNA and RNA extraction techniques from animal and plant cells. It discusses extracting nucleic acids using kits with varying costs and protocols for extracting DNA from animal tissue and plants. It also summarizes analyzing extracted nucleic acids through electrophoresis on agarose and polyacrylamide gels and using polymerase chain reaction (PCR) for applications such as DNA sequencing, forensics, and population genetics.Molecular analysis of genetic variability and relationship among Tulsi (Ocimu...
Molecular analysis of genetic variability and relationship among Tulsi (Ocimum sanctum) varieties using RAPD markers.
Final ppt project and tour
This document describes a study on genetic diversity in soybean (Glycine max) using RAPD marker. Six soybean genotypes were collected and their DNA was extracted using the CTAB method. The DNA was quantified and found to range from 158-502 ng/μl. The objectives were to analyze genetic diversity among the genotypes using RAPD marker. The methodology involved DNA extraction, quantification, PCR amplification with RAPD primers, and resolving the amplified products through gel electrophoresis. The results showed good quality DNA was extracted. The study provides information on genetic variation that can aid in soybean breeding programs.
seed DNA extraction.pdf
This document describes a modified CTAB method for quick extraction of genomic DNA from rice seeds/grains and leaves. The method was optimized to extract high quality DNA suitable for PCR analysis using rice microsatellite primers. The method involves soaking rice tissues in extraction buffer, homogenizing, phenol-chloroform extraction, chloroform extraction, precipitation with isopropanol and washing with ethanol. DNA yields of 1.2-1.8 μg/ml were obtained from different rice tissues. The extracted DNA showed clear bands when run on agarose gel and gave good amplification with SSR primers, demonstrating it is suitable for downstream PCR applications. This protocol provides a simple, cost-effective and high-throughput method for rice DNA extraction.
Similar to 4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea (20)
molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
Isolation and pcr amplification of genomic dna from traded seeds of nutmeg
Isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
BIO DECAFFEINATION-A STUDY ON THE EFFECTS OF BREVIBACTERIUM ON DIFFERENT SAMP...
BIO DECAFFEINATION-A STUDY ON THE EFFECTS OF BREVIBACTERIUM ON DIFFERENT SAMP...
NUCLEIC ACID EXTRACTION, PURIFICATION ON AGAROSE AND POLYACRYLAMIDE GEL AND PCR
NUCLEIC ACID EXTRACTION, PURIFICATION ON AGAROSE AND POLYACRYLAMIDE GEL AND PCR
Molecular analysis of genetic variability and relationship among Tulsi (Ocimu...
Molecular analysis of genetic variability and relationship among Tulsi (Ocimu...
Recently uploaded
Programming Foundation Models with DSPy - Meetup Slides
Prompting language models is hard, while programming language models is easy. In this talk, I will discuss the state-of-the-art framework DSPy for programming foundation models with its powerful optimizers and runtime constraint system.
Full-RAG: A modern architecture for hyper-personalization
Mike Del Balso, CEO & Co-Founder at Tecton, presents "Full RAG," a novel approach to AI recommendation systems, aiming to push beyond the limitations of traditional models through a deep integration of contextual insights and real-time data, leveraging the Retrieval-Augmented Generation architecture. This talk will outline Full RAG's potential to significantly enhance personalization, address engineering challenges such as data management and model training, and introduce data enrichment with reranking as a key solution. Attendees will gain crucial insights into the importance of hyperpersonalization in AI, the capabilities of Full RAG for advanced personalization, and strategies for managing complex data integrations for deploying cutting-edge AI solutions.
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdf
Discover how MongoDB Atlas and vector search technology can revolutionize your application's search capabilities. This comprehensive presentation covers:
* What is Vector Search?
* Importance and benefits of vector search
* Practical use cases across various industries
* Step-by-step implementation guide
* Live demos with code snippets
* Enhancing LLM capabilities with vector search
* Best practices and optimization strategies
Perfect for developers, AI enthusiasts, and tech leaders. Learn how to leverage MongoDB Atlas to deliver highly relevant, context-aware search results, transforming your data retrieval process. Stay ahead in tech innovation and maximize the potential of your applications.
#MongoDB #VectorSearch #AI #SemanticSearch #TechInnovation #DataScience #LLM #MachineLearning #SearchTechnology
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAU
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-und-domino-lizenzkostenreduzierung-in-der-welt-von-dlau/
DLAU und die Lizenzen nach dem CCB- und CCX-Modell sind für viele in der HCL-Community seit letztem Jahr ein heißes Thema. Als Notes- oder Domino-Kunde haben Sie vielleicht mit unerwartet hohen Benutzerzahlen und Lizenzgebühren zu kämpfen. Sie fragen sich vielleicht, wie diese neue Art der Lizenzierung funktioniert und welchen Nutzen sie Ihnen bringt. Vor allem wollen Sie sicherlich Ihr Budget einhalten und Kosten sparen, wo immer möglich. Das verstehen wir und wir möchten Ihnen dabei helfen!
Wir erklären Ihnen, wie Sie häufige Konfigurationsprobleme lösen können, die dazu führen können, dass mehr Benutzer gezählt werden als nötig, und wie Sie überflüssige oder ungenutzte Konten identifizieren und entfernen können, um Geld zu sparen. Es gibt auch einige Ansätze, die zu unnötigen Ausgaben führen können, z. B. wenn ein Personendokument anstelle eines Mail-Ins für geteilte Mailboxen verwendet wird. Wir zeigen Ihnen solche Fälle und deren Lösungen. Und natürlich erklären wir Ihnen das neue Lizenzmodell.
Nehmen Sie an diesem Webinar teil, bei dem HCL-Ambassador Marc Thomas und Gastredner Franz Walder Ihnen diese neue Welt näherbringen. Es vermittelt Ihnen die Tools und das Know-how, um den Überblick zu bewahren. Sie werden in der Lage sein, Ihre Kosten durch eine optimierte Domino-Konfiguration zu reduzieren und auch in Zukunft gering zu halten.
Diese Themen werden behandelt
- Reduzierung der Lizenzkosten durch Auffinden und Beheben von Fehlkonfigurationen und überflüssigen Konten
- Wie funktionieren CCB- und CCX-Lizenzen wirklich?
- Verstehen des DLAU-Tools und wie man es am besten nutzt
- Tipps für häufige Problembereiche, wie z. B. Team-Postfächer, Funktions-/Testbenutzer usw.
- Praxisbeispiele und Best Practices zum sofortigen Umsetzen
GraphRAG for Life Science to increase LLM accuracy
GraphRAG for life science domain, where you retriever information from biomedical knowledge graphs using LLMs to increase the accuracy and performance of generated answers
Video Streaming: Then, Now, and in the Future
In his public lecture, Christian Timmerer provides insights into the fascinating history of video streaming, starting from its humble beginnings before YouTube to the groundbreaking technologies that now dominate platforms like Netflix and ORF ON. Timmerer also presents provocative contributions of his own that have significantly influenced the industry. He concludes by looking at future challenges and invites the audience to join in a discussion.
UiPath Test Automation using UiPath Test Suite series, part 6
Welcome to UiPath Test Automation using UiPath Test Suite series part 6. In this session, we will cover Test Automation with generative AI and Open AI.
UiPath Test Automation with generative AI and Open AI webinar offers an in-depth exploration of leveraging cutting-edge technologies for test automation within the UiPath platform. Attendees will delve into the integration of generative AI, a test automation solution, with Open AI advanced natural language processing capabilities.
Throughout the session, participants will discover how this synergy empowers testers to automate repetitive tasks, enhance testing accuracy, and expedite the software testing life cycle. Topics covered include the seamless integration process, practical use cases, and the benefits of harnessing AI-driven automation for UiPath testing initiatives. By attending this webinar, testers, and automation professionals can gain valuable insights into harnessing the power of AI to optimize their test automation workflows within the UiPath ecosystem, ultimately driving efficiency and quality in software development processes.
What will you get from this session?
1. Insights into integrating generative AI.
2. Understanding how this integration enhances test automation within the UiPath platform
3. Practical demonstrations
4. Exploration of real-world use cases illustrating the benefits of AI-driven test automation for UiPath
Topics covered:
What is generative AI
Test Automation with generative AI and Open AI.
UiPath integration with generative AI
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
National Security Agency - NSA mobile device best practices
Threats to mobile devices are more prevalent and increasing in scope and complexity. Users of mobile devices desire to take full advantage of the features
available on those devices, but many of the features provide convenience and capability but sacrifice security. This best practices guide outlines steps the users can take to better protect personal devices and information.
Communications Mining Series - Zero to Hero - Session 1
This session provides introduction to UiPath Communication Mining, importance and platform overview. You will acquire a good understand of the phases in Communication Mining as we go over the platform with you. Topics covered:
• Communication Mining Overview
• Why is it important?
• How can it help today’s business and the benefits
• Phases in Communication Mining
• Demo on Platform overview
• Q/A
Uni Systems Copilot event_05062024_C.Vlachos.pdf
Unlocking Productivity: Leveraging the Potential of Copilot in Microsoft 365, a presentation by Christoforos Vlachos, Senior Solutions Manager – Modern Workplace, Uni Systems
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Monitoring and observability aren’t traditionally found in software curriculums and many of us cobble this knowledge together from whatever vendor or ecosystem we were first introduced to and whatever is a part of your current company’s observability stack.
While the dev and ops silo continues to crumble….many organizations still relegate monitoring & observability as the purview of ops, infra and SRE teams. This is a mistake - achieving a highly observable system requires collaboration up and down the stack.
I, a former op, would like to extend an invitation to all application developers to join the observability party will share these foundational concepts to build on:
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
The choice of an operating system plays a pivotal role in shaping our computing experience. For decades, Microsoft's Windows has dominated the market, offering a familiar and widely adopted platform for personal and professional use. However, as technological advancements continue to push the boundaries of innovation, alternative operating systems have emerged, challenging the status quo and offering users a fresh perspective on computing.
One such alternative that has garnered significant attention and acclaim is Nitrux Linux 3.5.0, a sleek, powerful, and user-friendly Linux distribution that promises to redefine the way we interact with our devices. With its focus on performance, security, and customization, Nitrux Linux presents a compelling case for those seeking to break free from the constraints of proprietary software and embrace the freedom and flexibility of open-source computing.
20240609 QFM020 Irresponsible AI Reading List May 2024
Everything I found interesting about the irresponsible use of machine intelligence in May 2024
みなさんこんにちはこれ何文字まで入るの？40文字以下不可とか本当に意味わからないけどこれ限界文字数書いてないからマジでやばい文字数いけるんじゃないの？えこ...
ここ3000字までしか入らないけどタイトルの方がたくさん文字入ると思います。
20240607 QFM018 Elixir Reading List May 2024
Everything I found interesting about the Elixir programming ecosystem in May 2024
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
Dr. Sean Tan, Head of Data Science, Changi Airport Group
Discover how Changi Airport Group (CAG) leverages graph technologies and generative AI to revolutionize their search capabilities. This session delves into the unique search needs of CAG’s diverse passengers and customers, showcasing how graph data structures enhance the accuracy and relevance of AI-generated search results, mitigating the risk of “hallucinations” and improving the overall customer journey.
Recently uploaded (20)
Programming Foundation Models with DSPy - Meetup Slides
Programming Foundation Models with DSPy - Meetup Slides
Full-RAG: A modern architecture for hyper-personalization
Full-RAG: A modern architecture for hyper-personalization
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdf
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdf
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAU
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAU
GraphRAG for Life Science to increase LLM accuracy
GraphRAG for Life Science to increase LLM accuracy
UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6
National Security Agency - NSA mobile device best practices
National Security Agency - NSA mobile device best practices
Communications Mining Series - Zero to Hero - Session 1
Communications Mining Series - Zero to Hero - Session 1
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
20240609 QFM020 Irresponsible AI Reading List May 2024
20240609 QFM020 Irresponsible AI Reading List May 2024
みなさんこんにちはこれ何文字まで入るの？40文字以下不可とか本当に意味わからないけどこれ限界文字数書いてないからマジでやばい文字数いけるんじゃないの？えこ...
みなさんこんにちはこれ何文字まで入るの？40文字以下不可とか本当に意味わからないけどこれ限界文字数書いてないからマジでやばい文字数いけるんじゃないの？えこ...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea
- 1. DNA Barcoding Of Tea Camellia sinensis (L)Kuntz In Sri Lanka E.D.T.S.Wickramasinghe(USJP) Neil D. Fernandopulle(Genetech) P.L.Hettiarachchi(USJP)
- 7. It was not possible to extract DNA from processed tea leaf samples even by using modified CTAB method. Another extraction method described by Hupfer et al ., (1998); Hotzel et al ., (1999); Meyer et al ., (1997); Poms et al ., (2001) was used to extract DNA from processed tea leaves. Processed tea leaves and tea dust were used to extract DNA .
- 9. Selection of a Barcoding region The trnH – PsbA spacer (~450 bp) of the plastid was selected as the barcoding region. This region is one of the most variable and easily amplified across a broad range of land plants.
- 10. W for A or T Y for C or T primer Sequence(5’-3’) Annealing temperature (ºC) Expected Product Size (bp) Forward primer Trn – H CGCGCATGGTGGATTCACAATCC 50 450 Reverse Primer Psb – A GTWATGCAYGAACGTAATGCC
- 11. PCR Agarose gel electrophoresis and gel purification Sequencing and editing
- 12. 2% agarose gel stained with ethidium bromide showing PCR amplified products of DNA extracted from fresh leaf sample using modified CTAB method. 450 bp marker
- 13. Lanes 1 – 16. DNA extracted from samples TRI 3063, TRI 3022, TRI 4006, TRI DN, TRI 4014, TRI 4021, TRI 3015, TRI 3018, TRI 4042, TRI 4052, TRI 2025, TRI 4028, TRI 2043, TRI DG7, TRI 3025, TRI 4046, respectively. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
- 15. Sequencing data of sample TRI DG7 Sequencing data of sample TRI2025
- 16. Alignment of psb-A region of six samples
- 17. Phylogenetic tree obtained for sequenced samples and Camellia sinensis var. sinensis at NCBI . Genetic Distance