SlideShare a Scribd company logo
DNA barcoding and biochemical profiling of medicinal plants of
Northern and desert areas of Pakistan: Improving socio-economic
standard of people of these regions




 Principal Investigator:
         Prof Amer Jamil
         Dept of Chemistry and Biochemistry
 Co-Principal Investigator:
         Prof Muhammad Ashfaq
         Director, Institute of Agricultural and Resource Economics

              University of Agriculture, Faisalabad
Core issues Associated with
            Medicinal Plants
 Lack of cultivation; mostly wild collection
 Inaccurate identification of medicinal plants
 Substitution or adulteration of the raw ingredients
       - decreased product’s efficacy
       - could prove fatal
 Poor socio-economic condition of the local people
  residing around this valuable resource


              Threat of losing our
        native medicinal plant species
Threats to the medicinal plants
1. Habitat degradation
2. Poverty
     Collection of medicinal herbs without any
     consideration of their regeneration
3. Negative exploitation
  – illegal extraction and transport of the plant material to
    other regions without any permission
4. Lack of awareness
  – Not well aware of the modern values of the medicinal
    plants and the environmental consequences of loss of
    biodiversity
PROBLEM STATEMENT
• Biodiversity conservation
   – A step towards conservation of natural plant resources and
     endangered species of this region
• Most of the local people of the targeted areas are
  living below poverty line
   – Lack of awareness about actual potential of such valuable
     resource; medicinal plants
   – No ownership
• Many medicinal plants are being used due to health
  benefits however,
   – no proper documentation
   – active ingredients of the plants are mostly unknown

   The local people therefore are unable to exploit the valuable
     resource that exists in their vicinity
HYPOTHESIS
Pr oj ect w l l hel p del i ver i ng concr et e
            i
gui del i nes t o devel op i m em abl e
                                  pl ent
pol i ci es f or conser vat i on of nat ur al
r esour ces (m ci nal pl ant s), pr ovi di ng
                edi
ow shi p of t he i ndi genous m er i al
   ner                                at
t o t he l ocal peopl e and st r engt heni ng
of     t he r ur al   econom es of
                              i            t he
t ar get ed r egi ons
Targets to be Achieved
              During First Six Months


Field Visits for the collection of Medicinal Plants

Flow of Medicinal Plants

Designing of the primers

Optimization of the PCR conditions for DNA
  barcoding
Progress During First Six Months of the Project
 Selection of Two Regions of Pakistan Covering Northern
  and Desert Areas

 Main objectives of these visits:

 to identify the marketable species of medicinal plants

 to check the flow of medicinal plants

 to diagnose the problems, facing in performing their activities

 to explore pre and post conflict socioeconomic conditions and
  their impact on livelihood
Questionnaires
 Questionnaires were
 designed for Farmers,
  pickers, shopkeepers and
  hakeems (herbal
  medicine practitioners)
 Questions concerning the
 utility of different plants,
 types of plants, quantity
 of plants used, mode of
 purchase,       rate     of
 consumption, availability,
 profit ratio, economic/
 market value were asked
Questionnaire for Farmers


Name_____________Village_____________Tehsils_____________District__
______________
Age_______ (Years) Farming Experience________ (Years) Schooling
Years_______
Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended
Land (kanals)
Owned area________ Rented in ________ rented out_________ Shared
in_______________
Shared out__________ Operational holding____________
Particulars                                    Name of
                                            Medicinal Plants
                                           A( B( C(
                           Area ( kanal)   )    )      )

Seed               Quantity
                   Cost (Rs)
Land Preparation   No.
(Culti+Sohagas)    Cost
Sowing             Rs.
Hoeing             No.
                   Cost (Rs)
Irrigation         Type
                   No.
                   Cost
Fertilizers        Type/Qty



                   Price/bag
Pesticide/Chemical Type
s                  Qty
                     Cost
Harvesting/process Cost
ing

Other
Costs(Specify)

Output (kg)
( Fresh)

Price per kg
Fresh

Output (kg) (Dry)
Price per kg (Dry)
Sowing and
harvesting time
Labor Cost

        Type           Family labour      Hired labour     Permanent labour

                   Working    Value of Working   Wages per Working   Month
                   hours      family   hours     Day       hour      ly
                              labour                                 Wages

        Men
        Women
        Children
        other


To whom do you sell?
i) Assembler/shopkeeper ii) Medicinal companies iii) Collector iv) Hakim v)
others (Specify)_______
In which form you sell?
•Fresh     ii) Dry    iii) other ( Specify) _______
What problems you face during Production/Marketing etc of product?
(Specify)
What solutions you suggest to resolve these problems? (Specify)
Questionnaire for Picker (Collector)
Name_____________Village_____________Tehsils_____________District________
________
Age_______ (Years) picking Experience________ (Years) Schooling Years_______
Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended
What types of plants you collect (Name)?
1 ____________ 2 _____________ 3 ____________ 4 ____________ 5
_______
From where you collect?
1) Private farms 2) Naturally grown 3) others (specify) _______




  Family labour       No. of hours for collection (per   How many days spent in
                      month)                             a year

  Men

  Women

  Children
In which form do you sell the plants?
•Fresh     ii) Dry    iii) After processing iv) other (Specify) …………….
What is over time population of these plants?
•Increasing             ii) Decreasing             iii) Same
If decreasing, give reasons;
i…………………………………………ii)………………………………………….
To whom do you sell the plants?
i) Hakim ii) Assembler/shopkeeper iii) Send other cities iv) Consumer v) Others (
Specify)…….

Price per kg received for different plants?
i)___________ ii) ______________ iii) _____________ iv) ____________ v)
_______
What is total quantity you sell in a year (Kgs)
i)___________ ii) ______________ iii) _____________ iv) ____________ v)
_______
Have you any other business (job)? Yes _______, No_______, if Yes (Specify)_______
Income per month from the job________________ Income of family from all
sources………….Rs/month
What problems you face during Selling/Collection? (Specify)
What solutions you suggest to resolve these problems?


Time of picking for different plants
1 ____________ 2 _____________         3 ____________    4 ____________    5
_______
Questionnaire for Assembler
                 (Shopkeeper)
Name_____________Village_____________Tehsils_____________Distri
ct________________
Age_______ (Years) Assembling Experience________ (Years)
Schooling Years_______
Family Members__________ Family type: i) Nuclear ii) Joint iii)
Extended
What types of plants you Assemble?
1 _______ 2 _______ 3 _______ 4 _______ 5 _______
From where you purchase?
i) Collector ii) private farm iii) other (Specify) _______
What is your mode of purchase?
i) Go yourself ii) People Come to Sell iii) Hired Collectors iv) Other
(Specify) _______
What price per kg you pay for different plants?
•_____________ ii) ___________ iii) _____________ iv) ___________
v) _______
Ownership of shop? Yes……………..No……………, if No then rent of
shop…………./month
No. of employees ………….. Salaries of employees ………………..
(Rs/month)
Chowkidar charges …………..(Rs/month)
Avg. Electricity bill ………….(Rs/month), Ave. phone bill
………….(Rs/month)
Other costs………………..(Rs/month)
In which form do you sell?
•Fresh      ii) Dry     iii) After processing iv) other ( Specify) _______
To whom do you sell?
i) Hakim ii) Medicinal companies iii) export iv) Consumer v) other
(Specify) _______
Per kg selling price of these plants?
i) ______________         ii) _____________      iii) ______________ iv)
____________ v) _______
If other business is also carried out, what is % of medicinal plant to
total business ………..
What is your perception about the population of these plants?
•Increasing               ii) Decreasing              iii) Same
If decreasing, give reasons;
Is it your full time job? Yes _______, No _______ if No
 Then what is your other Business (Job)? (Specify) _______
Income from other business______________ (Rs/month)
 What problems you face during Selling/Purchasing etc? (Specify)
What solutions you suggest to resolve these problems? (Specify)
Questionnaire For Hakim
           (The herbal medicine practitioner)
Name_____________Village_____________Tehsils_____________District__________
______
Age_______ (Years) Hikmat Experience________ (Years) Schooling Years_______
What type of plants you Purchase from local market (top 5)?
i) _________________ ii) ______________ iii) _____________ iv) ________ v)
________
Source?
•Collector ii) Shopkeeper/Retailer iii) Other (Specify) _________________
What price per kg you pay for different plants (Top 5)?
 i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______

Quantity of plants ( kg) used per month?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
Price of one unit of medicine you charge from customer?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______

Most common diseases cured by these plants?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
Ownership of shop? Yes……………..No……………, if No then
rent of shop…………./month
No. of employees ………….. Salaries of employees
……………….. (Rs/month)
Chowkidar charges …………..(Rs/month)
Avg. Electricity bill ………….(Rs/month), Ave. phone bill
………….(Rs/month)
Other costs………………..(Rs/month)
Total       sale      of     shop      (Income     of
Hikmat)…………………….(Rs/month)

What problems you face during Selling/Purchasing of these local
medicinal plants? (Specify)

What solutions you suggest to resolve these problems? (Specify)
Visit to Northern Area
                               Date        News Headlines
                               4      April,At least 14 people were killed and over 50 others injured in sectarian
                                            violence in Gilgit-Baltistan region of northern Pakistan
                               2012

                               9      April,PAF evacuates 120 foreigners trapped in Giglit-Baltistan curfew

The Northern region included   2012

                               16     Aug, DIG Gilgit Ali Sher confirmed the attack on passengers and killing of about 20


Gilgit-Baltistan.
                                           passengers in the attack of armed terrorists near at Gilgit.
                               2012
                               17 Aug,     [News] Killing People of Giglit-Baltistan – Another Dark Day
                               2012        This is the second time in a span of three months, Armed terrorist of Taliban killed 43 people
                                           from Gilgit-Baltistan on the basis of sectarian affiliations.


                               18 Aug,     Two truck drivers killed in Chalt Hunza Nagar
                               2012

Switched to Swat Valley due    23 Aug,
                               2012
                                           Gilgit Under Curfew:Gilgit (Monitoring Desk): In the post FC man killing and
                                           reported abductions of Truck drivers in various parts of Giglit-Baltistan, and
                                           due to the tense environment the law enforcement agencies have imposed
                                           an unannounced curfew in Giglit-City. It has caused sever problem form many

to Security reasons as the                 people who where visiting for many important official and business related
                                           tasks to the Capital City of Gilgit.



contact person in GB did not   28 Aug,
                               2012
                                               Two men including a policeman were killed and another was injured in
                                                       shootings in the restive town of Gilgit on Saturday.


recommend the visit at that
                               28 Aug,
                               2012
                                               Criminals running toward GB: Interior Minister Rehman Malik
                               07 Sep,     Aug 16: Terrorists ambushed four buses, pulled out the passengers and shot
                               2012        at least 19 of them dead in the Babusar Top area of Mansehra district on

time.                                      Thursday.
                                           “More than 50 terrorists wearing commando uniform intercepted a convoy
                                           going from Rawalpindi to Gilgit-Baltistan before 7am, hauled off passengers
                                           from four vans, identified them through their national identity cards and shot
                                           19 of them dead,” District Coordination Officer Dr Amber Ali Khan said


                               07 Sep,     Gilgit Baltistan Legislative Assembly in a unanimous resolution on Tuesday
                               2012        condemned the recent terrorist attacks killing innocent people

                               12 Dec,     Terror attacks increased in GB:Advocate Yawar was seriously injured at
                               2012        Domail locality, after attacked by a hand-grenade

                               12 Dec,
                               2012
                                           Violence in Gilgit: two killed several injured
Visit to Swat

 Collection, Photography                and       Preservation   of
  Medicinal Plants
 More than 50 fresh medicinal plants were collected
  from the Swat valley
 About 35 dry Medicinal Plant Parts were also
  collected


      Special thanks to Dr Hassan Sher for providing help
Diagrammatic Representation of Medicinal Plants’
           Flow in the Swat Valley
                            Picker/
                           Collectors




              Shopkeeper                 Middlemen



           Consumers         Pansaars          Traders




     Pharma and other          Hakeems                   Export
        Industries
List of Medicinal Plants (in Dry Form) collected from Swat valley
      Sr. No                    Name                   Parts Collected
        1         Buntal (Impatiens glandulifera)          Seeds
        2                     Khakshir                     Seeds
        3                       Onion                      Seeds
        4                      Rehan                       Seeds
        5                   Tudari Surkh                   Seeds
        6                      Kehoon                      Seeds
        7                       Methi                      Seeds
        8                      Serala                      Seeds
        9                    Smaq dana                     Seeds
        10                     Kasoos                      Seeds
        11                     Curfus                      Seeds
        12                    Persosha                     Weeds
        13           Aconitum heterophyllum                Weeds
        14               Guchi (Mushroom)                  Weeds
        15                    Anjabaar                     Weeds
        16                     Kakora                      Weeds
        17                Kabab e khaddan                  Weeds
        18                  Berg e Bensa                   Weeds
        19     Dar e hild/ Darishk/ Zarishka/ Kornay       Weeds
        20                    Ephedra                      Weeds
        21                     Damasa                      Weeds
        22                 Gidder tobacco                  Weeds
        23                 Gul e banafsha                  Weeds
        24             Noor Alum/ Shakakal                 Weeds
        25                 Zakhm e hayat                   Weeds
        26                   Gul e Tesu                    Weeds
        27                    Discoria                     Weeds
        28                   Mamekh                        Weeds
        29               Mater Jer (Roots)                 Weeds
        30            Mushk e Bala/ Asaroon                Weeds
        31                      Kuth                       Weeds
        32                    Ratan Jo                     Weeds
        33                  Mushk e bala                   Weeds
        34                 Afsateeen/ Arae                 Weeds
        35                   Materikeria                   Weeds
Medicinal Plants from Swat
Visit to desert area (Cholistan desert)
 Yazman, Channer Pir and Derawer fort
 were visited
 About 50 medicinal plants were collected




   Special thanks to Cholistan Institute of Desert Studies for providing help during the visit
Medicinal Plants collection from the Cholistan desert
Seeds of medicinal plants collected from the Cholistan desert
            S. No.                 Botanical Name       Common Name

        1            Acacia ampliceps

        2            Acacia nilotica

        3            Capparis decidua               Karir

        4            Cenchrus biflorus

        5            Cenchrus ciliaris

        6            Cymbopogon jwarancusa          Khawi

        7            Ficus benghalensis

        8            Ficus religiosa

        9            Panicum turgidum

        10           Sporobolus violadas

        11           Vetiveria zizanioides          Dhaman
Medicinal Plants (Fresh) collected from
                     the Cholistan Desert
Sr No          Botanical Name     Common Name             Medicinal Use, if known


1       Suaeda fruticosa          Kali Lani
2       Salsola foetida           Lani
3       Haloxylon salicornicum    Lana
4       Crotalaria burhia         Chag
5       Haloxylon recurvum        Khar          Treatment of intestinal ulcer
6       Fagonia cretica           Dhamasha
7       Dipterygium glaucum       Thuma
8       Cenchrus prorate          Durban
9       Leptadenia pyrotechnica   Khip
10      Calotropis procera        Ak            Against inflammation, snake bite, digestive
                                                tract infections, etc
11      Cymbopogon jwarancusa     Khavi         To treat cough and as blood purifier
12      Capparis decidua          Karir         Against rheumatism, pain and wounds
13      Aerva javanica            Bui-Kaltan    Against diarrhea and haematuria in cattle
14      Tamarix dioica            Lai
15      Calligonum polygonoides   Phog
16      Prosopis cineraria        Jandi/Kandi   Treatment of rheumatism in animals
• The local collectors provide the desert medicinal plants to
  the wholesale dealers and hakims at a very cost because of
  lack of awareness about the importance of medicinal plants.
• No market is available for the sale/purchase of medicinal
  plants.
• No policy by the Provisional or Federal Government exists
  regarding Pricing, Selling, Purchasing, Marketing,
  Distribution, Export and Sustainability of medicinal plants
  found naturally in Cholistan desert.
• Cholistan Institute of Desert Studies (CIDS) has taken some
  initiative to make the farmers, collectors and Hakims aware
  of the importance of the medicinal plants.
Preservation of medicinal plants
Visit to the market of medicinal plants in
Lahore
 Central Market of Pakistan for selling/purchase/
  export of the Medicinal Plants
 Usually peoples were reluctant to answers, they
  were afraid because they were considering as tax
  officer
 After detailed introduction and showing the
  visiting cards and ID card, some of them agreed
  and Few gave information due to references
 Suspicions prevailing in the market
 A few plants have been discovered recently with
  antidiabetic and/or anticancer potential. Price is
  up to Rs. 4000/kg, but are exported without
  acknowledging their real value; there is no export
  policy.
An overview of visit to Medicinal Plant Market in Lahore
Wholesalers Name   Name of plants (they Locality        of   M. Comments
                   deal)                Plants
1.Shakoor Sahib    Banafsha, Reetha,      Swat Valley           > No Adulteration in Swat Traders
(Papar Market)     Brooza,          Koor,                       > Adulteration is here
                   Bhman Surkh, Puth                            >If we go there (e,g in Swat, etc) our bargaining
                   Patri, Malathi, etc.                         power becomes weak


2.Mr. Naeem        Banafsha               Jungles/ Mountains    > Majority of the traders about 150 in are
(Paper Mandi)                                                   working in Akbari Mandi while only 35-40 in
                                                                Papar Mandi

3.Mr Asif          6-7 Major Plants       From Local market >Incredible margins exist due to lack of price
(Papar Mandi)                             and      resell    to Policy
                                          Retailer/ Processor

4.Mr. Shahbaz      Matar Jarri (Doodh     From different    > In Akbari Mandi genuine traders of M. Plants
(Akbari Mandi)     Bacha), Asheesh        Localities        are only 25-30 (Out of 150); Rest are doing mix
                                                            business of karyana and medicinal plants
                                                            > There is no export policy or price system
                                                            > Hamdard, Marhaba, Ajmal, Hakeems, etc
                                                            purchase to use
5.Wahab Traders    5-6 Medicinal Plants   Export from local D-S based price system
(Akbar Mandi)                             market as well as
                                          from Swat
DNA Barcoding
 Discriminatory power
    Low intra-species variability
    Species level genetic variability
 Short sequence length: 400-800
 Universality
Collection of Specimens    (Leaves, roots, shoots or flowers of medicinal plants)




      DNA isolation        Omitted step; replaced with an advanced method:
                           Phire Plant Direct PCR kit (Thermo Scientific)

      Amplification of selected   (ITS2 of nuclear genome; matK, psbA-trnH, rbcL of
        DNA regions by PCR        cpDNA)


           Sequencing of amplified
                                            (Sanger Method)
                 products


               Sequencing matching &
                                              (BLAST and Reference database of NCBI)
                    alignment


                   Species identification
                                                (various bioinfomatics tools)
                   & Phylogenetic study
DNA Barcoding and Conservation of
        Plant Biodiversity
 A standardized library of barcodes will enable
  - identification of rare, native or invasive, endangered
  species
  - systematic and conservation-based studies
  - track ancient divergences between basal lineages
  - trace organism's evolutionary history and
  systematic/taxonomic relationships
 Authentication of the status of our biodiversity
 Adulterated herbal medicinal materials
 Establish the evolutionary links of the plant species that
  are missing at the moment
DNA barcoding analysis
 Primers designing and optimization of PCR conditions

 Selection of four genes ITS, rbcL, trnH-psbA, and matK

 Primers’ detail used for DNA barcoding studies
                                                         Amplicon length
  S. No.    Primer Name               Sequence
                                                              (bp)

  1.           ITS 5F        5′GGAAGTAAAAGTCGTAACAAGG         700

  2.           ITS 4R         5′TCCTCCGCTTATTGATATGC          700

  3.           rbcL 1f        5′ATGTCACCACAAACAGAAAC          750

  4.          rbcL 724r       5′TCGCATGTACCTGCAGTAGC          750

  5.       trnH-psbA psbAF   5′GTTATGCATGAACGTAATGCTC       400-600

  6.       trnH-psbA trnH2   5′CGCGCATGGTGGATTCACAATCC      400-600

  7.         matK 390F       5′CGATCTATTCATTCAATATTTC         850

  8.         matK 1326R      5′TCTAGCACACGAAAGTCGAAGT         850
PCR conditions for different regions of DNA from the Plants
                PCR reaction                                             Cycling Protocol
                                                                           3 step protocol
      Component             25 µL reaction        Cycle step                                    Cycles
                                                                       Temp.            Time
                                                    Initial            98 ˚C            5 min
         H2 O                    9.5 µL                                                           1
                                                 denaturation
                                                 Denaturation          98 ˚C           5 sec
 Phire plant PCR buffer         12.5 µL           Annealing          Variable*         1 min     30
                                                   Extension           72 ˚C           1 min
 Primer F and Primer R         1.3 µL each      Final Extension        72 ˚C           7 min
    DNA polymerase               0.5 µL                                                           1
      Seed sample           0.5 mm punch
        *Annealing temperatures: ITS 51 oC, rbcL 56 oC, trnH-psbA 55 oC, matK 52 oC
Agarose gel for amplified fragments after PCR. Lane 1 ITS, Lane
 2 rbcL, Lane 3 DNA ladder, Lane 5 trnH-psbA, Lane 7 matK1
Conclusions
~100 plants collected and preserved from both the
 regions; another visit will be made to the desert area
 during March (best season) for further collection of
 the plants and in May to the Swat valley.
No valid price system for the sale/purchase of the
 medicinal plants was found in the main markets.
Wholesalers buy the medicinal plants from different
 collectors at a very low rate and sell in bulk amount at
 higher rates to the bigger markets.
The PCR based method for DNA barcoding is
 optimized and ready to be applied on the medicinal
 plants.
Conclusion….continued

It was noted that the local people could not exploit
  the medicinal plants due to the following reasons:
• Lack of awareness regarding time of harvesting of
  the medicinal plants
• Roots and/or shoots that are grazed and collected for
  medicinal purpose are a threat for their regeneration
• Lack of skills for using medicinal plants as economic
  opportunity
• Lack of knowledge about the marketing of available
  medicinal plants species
Conclusion….continued

• Poor management of medicinal plants such as
  uncontrolled and unsystematic grazing, improper
  harvesting and mismanagement

• Pickers suffer the problems including low price paid
  by dealers, lack of appropriate tools and equipments,
  etc., as well as no proper market for sale.
Work in progress/future work
 Identification of the unidentified plants by a taxonomist
 Amplification of the desired DNA sequences from the
  collected medicinal plants followed by sequencing and
  phylogenetic analysis
 Detailed socio-economic analyses of the regions with
  respect to the medicinal plants
 Biochemical analysis on selected plants of both the regions
  to assess their real economic importance and value
 Organization of awareness workshops in both the regions
 Development of policy guidelines for implementation in
 the regions for conservation of medicinal plants and
 improving economic condition of the local people
Documentation of medicinal plants on molecular
basis is necessary for conservation of biodiversity,
and to provide ownership of the important plants to
the respective region, ultimately leading to improve
the socio-economic condition of the neglected
communities

More Related Content

Similar to DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad

Plant Breeding - 1.pdfbbbbvvvvvvvkkjjkjj
Plant Breeding - 1.pdfbbbbvvvvvvvkkjjkjjPlant Breeding - 1.pdfbbbbvvvvvvvkkjjkjj
Plant Breeding - 1.pdfbbbbvvvvvvvkkjjkjj
BestoonHassanAhmed
 
Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...
Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...
Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...
Mr.Allah Dad Khan
 
Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...
Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...
Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...
Mr.Allah Dad Khan
 
8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx
8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx
8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx
TerenceJohnAguinaldo
 
Green culture business final ppt
Green culture business final pptGreen culture business final ppt
Green culture business final pptAditya Suiwal
 
Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project CWR Project
 
Imortance and possibility of organic agriculure in kailali
Imortance and possibility of organic agriculure in kailaliImortance and possibility of organic agriculure in kailali
Imortance and possibility of organic agriculure in kailali
Ravi Dhami
 
State of Organic Seed (SOS) Report Part 2
State of Organic Seed (SOS) Report Part 2State of Organic Seed (SOS) Report Part 2
State of Organic Seed (SOS) Report Part 2
Seeds
 
Problems in marketing of of medicinal plants in pakistan Presentation By Mr ...
Problems in marketing of  of medicinal plants in pakistan Presentation By Mr ...Problems in marketing of  of medicinal plants in pakistan Presentation By Mr ...
Problems in marketing of of medicinal plants in pakistan Presentation By Mr ...
Mr.Allah Dad Khan
 
Alternative Agronomic Crops
Alternative Agronomic CropsAlternative Agronomic Crops
Alternative Agronomic Crops
Gardening
 
Seed Production and Variety Development for Organic Systems
Seed Production and Variety Development for Organic SystemsSeed Production and Variety Development for Organic Systems
Seed Production and Variety Development for Organic Systems
Seeds
 
Personal reflection on the status and challenges regarding use of agricultura...
Personal reflection on the status and challenges regarding use of agricultura...Personal reflection on the status and challenges regarding use of agricultura...
Personal reflection on the status and challenges regarding use of agricultura...
ExternalEvents
 
Gpb 811 converted
Gpb 811 convertedGpb 811 converted
Gpb 811 converted
SHUATS
 
Potatoes: Organic Production and Marketing
Potatoes: Organic Production and Marketing Potatoes: Organic Production and Marketing
Potatoes: Organic Production and Marketing
Gardening
 
THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...
THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...
THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...
Murray Hunter
 
Ideotype breeding of some model crops
Ideotype breeding of some model cropsIdeotype breeding of some model crops
Ideotype breeding of some model crops
Dr. Kaushik Kumar Panigrahi
 
Organic Marketing Resources
Organic Marketing ResourcesOrganic Marketing Resources
Organic Marketing Resources
ElisaMendelsohn
 
Organic Marketing Resources
Organic Marketing ResourcesOrganic Marketing Resources
Organic Marketing Resources
ElisaMendelsohn
 
Organic Marketing Resources
Organic Marketing ResourcesOrganic Marketing Resources
Organic Marketing Resources
ElisaMendelsohn
 

Similar to DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad (20)

Plant Breeding - 1.pdfbbbbvvvvvvvkkjjkjj
Plant Breeding - 1.pdfbbbbvvvvvvvkkjjkjjPlant Breeding - 1.pdfbbbbvvvvvvvkkjjkjj
Plant Breeding - 1.pdfbbbbvvvvvvvkkjjkjj
 
Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...
Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...
Arid marketing problems of medicinal plants A Presentation By Mr Allah Dad kh...
 
Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...
Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...
Arid marketing problems of medicinal plants By Mr Allah Dad Khan Former D.G ,...
 
8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx
8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx
8. Organic-Crop-Production-Standards-Conversion-to-Organic-Agriculture.pptx
 
Green culture business final ppt
Green culture business final pptGreen culture business final ppt
Green culture business final ppt
 
Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project Introduction to prebreeding component of CWR project
Introduction to prebreeding component of CWR project
 
Imortance and possibility of organic agriculure in kailali
Imortance and possibility of organic agriculure in kailaliImortance and possibility of organic agriculure in kailali
Imortance and possibility of organic agriculure in kailali
 
State of Organic Seed (SOS) Report Part 2
State of Organic Seed (SOS) Report Part 2State of Organic Seed (SOS) Report Part 2
State of Organic Seed (SOS) Report Part 2
 
Problems in marketing of of medicinal plants in pakistan Presentation By Mr ...
Problems in marketing of  of medicinal plants in pakistan Presentation By Mr ...Problems in marketing of  of medicinal plants in pakistan Presentation By Mr ...
Problems in marketing of of medicinal plants in pakistan Presentation By Mr ...
 
Alternative Agronomic Crops
Alternative Agronomic CropsAlternative Agronomic Crops
Alternative Agronomic Crops
 
Seed Production and Variety Development for Organic Systems
Seed Production and Variety Development for Organic SystemsSeed Production and Variety Development for Organic Systems
Seed Production and Variety Development for Organic Systems
 
Personal reflection on the status and challenges regarding use of agricultura...
Personal reflection on the status and challenges regarding use of agricultura...Personal reflection on the status and challenges regarding use of agricultura...
Personal reflection on the status and challenges regarding use of agricultura...
 
Gpb 811 converted
Gpb 811 convertedGpb 811 converted
Gpb 811 converted
 
Potatoes: Organic Production and Marketing
Potatoes: Organic Production and Marketing Potatoes: Organic Production and Marketing
Potatoes: Organic Production and Marketing
 
Flavoure5.4.2011
Flavoure5.4.2011Flavoure5.4.2011
Flavoure5.4.2011
 
THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...
THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...
THE ORGANIC PRODUCTION OF ESSENTIAL OILS - Chapter 10 of Essential Oils: Art,...
 
Ideotype breeding of some model crops
Ideotype breeding of some model cropsIdeotype breeding of some model crops
Ideotype breeding of some model crops
 
Organic Marketing Resources
Organic Marketing ResourcesOrganic Marketing Resources
Organic Marketing Resources
 
Organic Marketing Resources
Organic Marketing ResourcesOrganic Marketing Resources
Organic Marketing Resources
 
Organic Marketing Resources
Organic Marketing ResourcesOrganic Marketing Resources
Organic Marketing Resources
 

More from International Food Policy Research Institute

Food consumption patterns and nutritional status in pakistan
Food consumption patterns and nutritional status in pakistan Food consumption patterns and nutritional status in pakistan
Food consumption patterns and nutritional status in pakistan
International Food Policy Research Institute
 
Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...
Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...
Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...
International Food Policy Research Institute
 
LESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. Dani
LESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. DaniLESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. Dani
LESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. Dani
International Food Policy Research Institute
 
Floods and Natural Disasters in South Asia: Implications for Food Security by...
Floods and Natural Disasters in South Asia: Implications for Food Security by...Floods and Natural Disasters in South Asia: Implications for Food Security by...
Floods and Natural Disasters in South Asia: Implications for Food Security by...
International Food Policy Research Institute
 
Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...
Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...
Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...
International Food Policy Research Institute
 
CGE Modeling and Microsimulations by Dr. Dario Debowicz
CGE Modeling and Microsimulations by Dr. Dario DebowiczCGE Modeling and Microsimulations by Dr. Dario Debowicz
CGE Modeling and Microsimulations by Dr. Dario Debowicz
International Food Policy Research Institute
 
Poverty and Inequality Measurement By Dr. Dario Debowicz
Poverty and Inequality Measurement By Dr. Dario DebowiczPoverty and Inequality Measurement By Dr. Dario Debowicz
Poverty and Inequality Measurement By Dr. Dario Debowicz
International Food Policy Research Institute
 
Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...
Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...
Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...
International Food Policy Research Institute
 
Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...
Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...
Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...
International Food Policy Research Institute
 
What Determines Farmers’ Response towards Adopting New Technology in KP? by D...
What Determines Farmers’ Response towards Adopting New Technology in KP? by D...What Determines Farmers’ Response towards Adopting New Technology in KP? by D...
What Determines Farmers’ Response towards Adopting New Technology in KP? by D...
International Food Policy Research Institute
 
The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...
The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...
The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...
International Food Policy Research Institute
 
Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...
Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...
Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...
International Food Policy Research Institute
 
Integrating Rural Urban Linkages for Regional Development in the Province of ...
Integrating Rural Urban Linkages for Regional Development in the Province of ...Integrating Rural Urban Linkages for Regional Development in the Province of ...
Integrating Rural Urban Linkages for Regional Development in the Province of ...
International Food Policy Research Institute
 
Tax Policy Research to Support a New Framework for Sustained Economic Growth ...
Tax Policy Research to Support a New Framework for Sustained Economic Growth ...Tax Policy Research to Support a New Framework for Sustained Economic Growth ...
Tax Policy Research to Support a New Framework for Sustained Economic Growth ...
International Food Policy Research Institute
 
Economic Analysis of Challenges in Development of High-Value Agriculture: The...
Economic Analysis of Challenges in Development of High-Value Agriculture: The...Economic Analysis of Challenges in Development of High-Value Agriculture: The...
Economic Analysis of Challenges in Development of High-Value Agriculture: The...
International Food Policy Research Institute
 
Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...
Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...
Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...
International Food Policy Research Institute
 
Maximizing Farm Income and Other Livelihood Opportunities through Introductio...
Maximizing Farm Income and Other Livelihood Opportunities through Introductio...Maximizing Farm Income and Other Livelihood Opportunities through Introductio...
Maximizing Farm Income and Other Livelihood Opportunities through Introductio...
International Food Policy Research Institute
 
Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...
Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...
Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...
International Food Policy Research Institute
 
Estimating the Size and Operations of the Public Sector and its Impact on Whe...
Estimating the Size and Operations of the Public Sector and its Impact on Whe...Estimating the Size and Operations of the Public Sector and its Impact on Whe...
Estimating the Size and Operations of the Public Sector and its Impact on Whe...
International Food Policy Research Institute
 

More from International Food Policy Research Institute (20)

Food consumption patterns and nutritional status in pakistan
Food consumption patterns and nutritional status in pakistan Food consumption patterns and nutritional status in pakistan
Food consumption patterns and nutritional status in pakistan
 
Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...
Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...
Addressing the Needs of the Internally Displaced Persons in Pakistan by Dr S...
 
LESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. Dani
LESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. DaniLESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. Dani
LESSONS FROM REHABILITATION OF DISPLACED PERSONS by Dr. Anis A. Dani
 
Floods and Natural Disasters in South Asia: Implications for Food Security by...
Floods and Natural Disasters in South Asia: Implications for Food Security by...Floods and Natural Disasters in South Asia: Implications for Food Security by...
Floods and Natural Disasters in South Asia: Implications for Food Security by...
 
Pakistan Strategy Support Program Overview by Dr. Stephen Davies, Dr. Sohail ...
Pakistan Strategy Support Program Overview by Dr. Stephen Davies, Dr. Sohail ...Pakistan Strategy Support Program Overview by Dr. Stephen Davies, Dr. Sohail ...
Pakistan Strategy Support Program Overview by Dr. Stephen Davies, Dr. Sohail ...
 
Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...
Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...
Microsimulating FGT Indicators Based on Pakistan HIES 2010-11 by Dr. Dario De...
 
CGE Modeling and Microsimulations by Dr. Dario Debowicz
CGE Modeling and Microsimulations by Dr. Dario DebowiczCGE Modeling and Microsimulations by Dr. Dario Debowicz
CGE Modeling and Microsimulations by Dr. Dario Debowicz
 
Poverty and Inequality Measurement By Dr. Dario Debowicz
Poverty and Inequality Measurement By Dr. Dario DebowiczPoverty and Inequality Measurement By Dr. Dario Debowicz
Poverty and Inequality Measurement By Dr. Dario Debowicz
 
Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...
Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...
Batkhela (Malakand) Bazar: A Catalyst for Socio-Economic and Political Change...
 
Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...
Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...
Enhancing Water Productivity by Using Feasible Efficient Irrigation Technique...
 
What Determines Farmers’ Response towards Adopting New Technology in KP? by D...
What Determines Farmers’ Response towards Adopting New Technology in KP? by D...What Determines Farmers’ Response towards Adopting New Technology in KP? by D...
What Determines Farmers’ Response towards Adopting New Technology in KP? by D...
 
The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...
The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...
The Size and Nature of Informal Entrepreneurship in Pakistan and How to Tackl...
 
Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...
Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...
Economic Growth and Protection of Life, Property and Contracts by Dr. Shabib ...
 
Integrating Rural Urban Linkages for Regional Development in the Province of ...
Integrating Rural Urban Linkages for Regional Development in the Province of ...Integrating Rural Urban Linkages for Regional Development in the Province of ...
Integrating Rural Urban Linkages for Regional Development in the Province of ...
 
Tax Policy Research to Support a New Framework for Sustained Economic Growth ...
Tax Policy Research to Support a New Framework for Sustained Economic Growth ...Tax Policy Research to Support a New Framework for Sustained Economic Growth ...
Tax Policy Research to Support a New Framework for Sustained Economic Growth ...
 
Economic Analysis of Challenges in Development of High-Value Agriculture: The...
Economic Analysis of Challenges in Development of High-Value Agriculture: The...Economic Analysis of Challenges in Development of High-Value Agriculture: The...
Economic Analysis of Challenges in Development of High-Value Agriculture: The...
 
Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...
Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...
Qualitative and Quantitative Analyses of Antibiotics, Heavy Metals, Mycotoxin...
 
Maximizing Farm Income and Other Livelihood Opportunities through Introductio...
Maximizing Farm Income and Other Livelihood Opportunities through Introductio...Maximizing Farm Income and Other Livelihood Opportunities through Introductio...
Maximizing Farm Income and Other Livelihood Opportunities through Introductio...
 
Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...
Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...
Agent-Based Modeling Simulations for Solving Pakistan's Urban Challenges by D...
 
Estimating the Size and Operations of the Public Sector and its Impact on Whe...
Estimating the Size and Operations of the Public Sector and its Impact on Whe...Estimating the Size and Operations of the Public Sector and its Impact on Whe...
Estimating the Size and Operations of the Public Sector and its Impact on Whe...
 

DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad

  • 1. DNA barcoding and biochemical profiling of medicinal plants of Northern and desert areas of Pakistan: Improving socio-economic standard of people of these regions Principal Investigator: Prof Amer Jamil Dept of Chemistry and Biochemistry Co-Principal Investigator: Prof Muhammad Ashfaq Director, Institute of Agricultural and Resource Economics University of Agriculture, Faisalabad
  • 2. Core issues Associated with Medicinal Plants  Lack of cultivation; mostly wild collection  Inaccurate identification of medicinal plants  Substitution or adulteration of the raw ingredients - decreased product’s efficacy - could prove fatal  Poor socio-economic condition of the local people residing around this valuable resource Threat of losing our native medicinal plant species
  • 3. Threats to the medicinal plants 1. Habitat degradation 2. Poverty Collection of medicinal herbs without any consideration of their regeneration 3. Negative exploitation – illegal extraction and transport of the plant material to other regions without any permission 4. Lack of awareness – Not well aware of the modern values of the medicinal plants and the environmental consequences of loss of biodiversity
  • 4. PROBLEM STATEMENT • Biodiversity conservation – A step towards conservation of natural plant resources and endangered species of this region • Most of the local people of the targeted areas are living below poverty line – Lack of awareness about actual potential of such valuable resource; medicinal plants – No ownership • Many medicinal plants are being used due to health benefits however, – no proper documentation – active ingredients of the plants are mostly unknown The local people therefore are unable to exploit the valuable resource that exists in their vicinity
  • 5. HYPOTHESIS Pr oj ect w l l hel p del i ver i ng concr et e i gui del i nes t o devel op i m em abl e pl ent pol i ci es f or conser vat i on of nat ur al r esour ces (m ci nal pl ant s), pr ovi di ng edi ow shi p of t he i ndi genous m er i al ner at t o t he l ocal peopl e and st r engt heni ng of t he r ur al econom es of i t he t ar get ed r egi ons
  • 6. Targets to be Achieved During First Six Months Field Visits for the collection of Medicinal Plants Flow of Medicinal Plants Designing of the primers Optimization of the PCR conditions for DNA barcoding
  • 7. Progress During First Six Months of the Project  Selection of Two Regions of Pakistan Covering Northern and Desert Areas  Main objectives of these visits:  to identify the marketable species of medicinal plants  to check the flow of medicinal plants  to diagnose the problems, facing in performing their activities  to explore pre and post conflict socioeconomic conditions and their impact on livelihood
  • 8. Questionnaires  Questionnaires were designed for Farmers, pickers, shopkeepers and hakeems (herbal medicine practitioners)  Questions concerning the utility of different plants, types of plants, quantity of plants used, mode of purchase, rate of consumption, availability, profit ratio, economic/ market value were asked
  • 9. Questionnaire for Farmers Name_____________Village_____________Tehsils_____________District__ ______________ Age_______ (Years) Farming Experience________ (Years) Schooling Years_______ Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended Land (kanals) Owned area________ Rented in ________ rented out_________ Shared in_______________ Shared out__________ Operational holding____________
  • 10. Particulars Name of Medicinal Plants A( B( C( Area ( kanal) ) ) ) Seed Quantity Cost (Rs) Land Preparation No. (Culti+Sohagas) Cost Sowing Rs. Hoeing No. Cost (Rs) Irrigation Type No. Cost Fertilizers Type/Qty Price/bag
  • 11. Pesticide/Chemical Type s Qty Cost Harvesting/process Cost ing Other Costs(Specify) Output (kg) ( Fresh) Price per kg Fresh Output (kg) (Dry) Price per kg (Dry) Sowing and harvesting time
  • 12. Labor Cost Type Family labour Hired labour Permanent labour Working Value of Working Wages per Working Month hours family hours Day hour ly labour Wages Men Women Children other To whom do you sell? i) Assembler/shopkeeper ii) Medicinal companies iii) Collector iv) Hakim v) others (Specify)_______ In which form you sell? •Fresh ii) Dry iii) other ( Specify) _______ What problems you face during Production/Marketing etc of product? (Specify) What solutions you suggest to resolve these problems? (Specify)
  • 13. Questionnaire for Picker (Collector) Name_____________Village_____________Tehsils_____________District________ ________ Age_______ (Years) picking Experience________ (Years) Schooling Years_______ Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended What types of plants you collect (Name)? 1 ____________ 2 _____________ 3 ____________ 4 ____________ 5 _______ From where you collect? 1) Private farms 2) Naturally grown 3) others (specify) _______ Family labour No. of hours for collection (per How many days spent in month) a year Men Women Children
  • 14. In which form do you sell the plants? •Fresh ii) Dry iii) After processing iv) other (Specify) ……………. What is over time population of these plants? •Increasing ii) Decreasing iii) Same If decreasing, give reasons; i…………………………………………ii)…………………………………………. To whom do you sell the plants? i) Hakim ii) Assembler/shopkeeper iii) Send other cities iv) Consumer v) Others ( Specify)……. Price per kg received for different plants? i)___________ ii) ______________ iii) _____________ iv) ____________ v) _______ What is total quantity you sell in a year (Kgs) i)___________ ii) ______________ iii) _____________ iv) ____________ v) _______ Have you any other business (job)? Yes _______, No_______, if Yes (Specify)_______ Income per month from the job________________ Income of family from all sources………….Rs/month What problems you face during Selling/Collection? (Specify) What solutions you suggest to resolve these problems? Time of picking for different plants 1 ____________ 2 _____________ 3 ____________ 4 ____________ 5 _______
  • 15. Questionnaire for Assembler (Shopkeeper) Name_____________Village_____________Tehsils_____________Distri ct________________ Age_______ (Years) Assembling Experience________ (Years) Schooling Years_______ Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended What types of plants you Assemble? 1 _______ 2 _______ 3 _______ 4 _______ 5 _______ From where you purchase? i) Collector ii) private farm iii) other (Specify) _______ What is your mode of purchase? i) Go yourself ii) People Come to Sell iii) Hired Collectors iv) Other (Specify) _______ What price per kg you pay for different plants? •_____________ ii) ___________ iii) _____________ iv) ___________ v) _______
  • 16. Ownership of shop? Yes……………..No……………, if No then rent of shop…………./month No. of employees ………….. Salaries of employees ……………….. (Rs/month) Chowkidar charges …………..(Rs/month) Avg. Electricity bill ………….(Rs/month), Ave. phone bill ………….(Rs/month) Other costs………………..(Rs/month) In which form do you sell? •Fresh ii) Dry iii) After processing iv) other ( Specify) _______ To whom do you sell? i) Hakim ii) Medicinal companies iii) export iv) Consumer v) other (Specify) _______ Per kg selling price of these plants? i) ______________ ii) _____________ iii) ______________ iv) ____________ v) _______ If other business is also carried out, what is % of medicinal plant to total business ……….. What is your perception about the population of these plants? •Increasing ii) Decreasing iii) Same If decreasing, give reasons; Is it your full time job? Yes _______, No _______ if No Then what is your other Business (Job)? (Specify) _______ Income from other business______________ (Rs/month) What problems you face during Selling/Purchasing etc? (Specify) What solutions you suggest to resolve these problems? (Specify)
  • 17. Questionnaire For Hakim (The herbal medicine practitioner) Name_____________Village_____________Tehsils_____________District__________ ______ Age_______ (Years) Hikmat Experience________ (Years) Schooling Years_______ What type of plants you Purchase from local market (top 5)? i) _________________ ii) ______________ iii) _____________ iv) ________ v) ________ Source? •Collector ii) Shopkeeper/Retailer iii) Other (Specify) _________________ What price per kg you pay for different plants (Top 5)? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______ Quantity of plants ( kg) used per month? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______ Price of one unit of medicine you charge from customer? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______ Most common diseases cured by these plants? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
  • 18. Ownership of shop? Yes……………..No……………, if No then rent of shop…………./month No. of employees ………….. Salaries of employees ……………….. (Rs/month) Chowkidar charges …………..(Rs/month) Avg. Electricity bill ………….(Rs/month), Ave. phone bill ………….(Rs/month) Other costs………………..(Rs/month) Total sale of shop (Income of Hikmat)…………………….(Rs/month) What problems you face during Selling/Purchasing of these local medicinal plants? (Specify) What solutions you suggest to resolve these problems? (Specify)
  • 19. Visit to Northern Area Date News Headlines 4 April,At least 14 people were killed and over 50 others injured in sectarian violence in Gilgit-Baltistan region of northern Pakistan 2012 9 April,PAF evacuates 120 foreigners trapped in Giglit-Baltistan curfew The Northern region included 2012 16 Aug, DIG Gilgit Ali Sher confirmed the attack on passengers and killing of about 20 Gilgit-Baltistan. passengers in the attack of armed terrorists near at Gilgit. 2012 17 Aug, [News] Killing People of Giglit-Baltistan – Another Dark Day 2012 This is the second time in a span of three months, Armed terrorist of Taliban killed 43 people from Gilgit-Baltistan on the basis of sectarian affiliations. 18 Aug, Two truck drivers killed in Chalt Hunza Nagar 2012 Switched to Swat Valley due 23 Aug, 2012 Gilgit Under Curfew:Gilgit (Monitoring Desk): In the post FC man killing and reported abductions of Truck drivers in various parts of Giglit-Baltistan, and due to the tense environment the law enforcement agencies have imposed an unannounced curfew in Giglit-City. It has caused sever problem form many to Security reasons as the people who where visiting for many important official and business related tasks to the Capital City of Gilgit. contact person in GB did not 28 Aug, 2012 Two men including a policeman were killed and another was injured in shootings in the restive town of Gilgit on Saturday. recommend the visit at that 28 Aug, 2012 Criminals running toward GB: Interior Minister Rehman Malik 07 Sep, Aug 16: Terrorists ambushed four buses, pulled out the passengers and shot 2012 at least 19 of them dead in the Babusar Top area of Mansehra district on time. Thursday. “More than 50 terrorists wearing commando uniform intercepted a convoy going from Rawalpindi to Gilgit-Baltistan before 7am, hauled off passengers from four vans, identified them through their national identity cards and shot 19 of them dead,” District Coordination Officer Dr Amber Ali Khan said 07 Sep, Gilgit Baltistan Legislative Assembly in a unanimous resolution on Tuesday 2012 condemned the recent terrorist attacks killing innocent people 12 Dec, Terror attacks increased in GB:Advocate Yawar was seriously injured at 2012 Domail locality, after attacked by a hand-grenade 12 Dec, 2012 Violence in Gilgit: two killed several injured
  • 20. Visit to Swat  Collection, Photography and Preservation of Medicinal Plants  More than 50 fresh medicinal plants were collected from the Swat valley  About 35 dry Medicinal Plant Parts were also collected  Special thanks to Dr Hassan Sher for providing help
  • 21. Diagrammatic Representation of Medicinal Plants’ Flow in the Swat Valley Picker/ Collectors Shopkeeper Middlemen Consumers Pansaars Traders Pharma and other Hakeems Export Industries
  • 22. List of Medicinal Plants (in Dry Form) collected from Swat valley Sr. No Name Parts Collected 1 Buntal (Impatiens glandulifera) Seeds 2 Khakshir Seeds 3 Onion Seeds 4 Rehan Seeds 5 Tudari Surkh Seeds 6 Kehoon Seeds 7 Methi Seeds 8 Serala Seeds 9 Smaq dana Seeds 10 Kasoos Seeds 11 Curfus Seeds 12 Persosha Weeds 13 Aconitum heterophyllum Weeds 14 Guchi (Mushroom) Weeds 15 Anjabaar Weeds 16 Kakora Weeds 17 Kabab e khaddan Weeds 18 Berg e Bensa Weeds 19 Dar e hild/ Darishk/ Zarishka/ Kornay Weeds 20 Ephedra Weeds 21 Damasa Weeds 22 Gidder tobacco Weeds 23 Gul e banafsha Weeds 24 Noor Alum/ Shakakal Weeds 25 Zakhm e hayat Weeds 26 Gul e Tesu Weeds 27 Discoria Weeds 28 Mamekh Weeds 29 Mater Jer (Roots) Weeds 30 Mushk e Bala/ Asaroon Weeds 31 Kuth Weeds 32 Ratan Jo Weeds 33 Mushk e bala Weeds 34 Afsateeen/ Arae Weeds 35 Materikeria Weeds
  • 24. Visit to desert area (Cholistan desert)  Yazman, Channer Pir and Derawer fort were visited  About 50 medicinal plants were collected Special thanks to Cholistan Institute of Desert Studies for providing help during the visit
  • 25. Medicinal Plants collection from the Cholistan desert
  • 26. Seeds of medicinal plants collected from the Cholistan desert S. No. Botanical Name Common Name 1 Acacia ampliceps 2 Acacia nilotica 3 Capparis decidua Karir 4 Cenchrus biflorus 5 Cenchrus ciliaris 6 Cymbopogon jwarancusa Khawi 7 Ficus benghalensis 8 Ficus religiosa 9 Panicum turgidum 10 Sporobolus violadas 11 Vetiveria zizanioides Dhaman
  • 27. Medicinal Plants (Fresh) collected from the Cholistan Desert Sr No Botanical Name Common Name Medicinal Use, if known 1 Suaeda fruticosa Kali Lani 2 Salsola foetida Lani 3 Haloxylon salicornicum Lana 4 Crotalaria burhia Chag 5 Haloxylon recurvum Khar Treatment of intestinal ulcer 6 Fagonia cretica Dhamasha 7 Dipterygium glaucum Thuma 8 Cenchrus prorate Durban 9 Leptadenia pyrotechnica Khip 10 Calotropis procera Ak Against inflammation, snake bite, digestive tract infections, etc 11 Cymbopogon jwarancusa Khavi To treat cough and as blood purifier 12 Capparis decidua Karir Against rheumatism, pain and wounds 13 Aerva javanica Bui-Kaltan Against diarrhea and haematuria in cattle 14 Tamarix dioica Lai 15 Calligonum polygonoides Phog 16 Prosopis cineraria Jandi/Kandi Treatment of rheumatism in animals
  • 28. • The local collectors provide the desert medicinal plants to the wholesale dealers and hakims at a very cost because of lack of awareness about the importance of medicinal plants. • No market is available for the sale/purchase of medicinal plants. • No policy by the Provisional or Federal Government exists regarding Pricing, Selling, Purchasing, Marketing, Distribution, Export and Sustainability of medicinal plants found naturally in Cholistan desert. • Cholistan Institute of Desert Studies (CIDS) has taken some initiative to make the farmers, collectors and Hakims aware of the importance of the medicinal plants.
  • 30. Visit to the market of medicinal plants in Lahore  Central Market of Pakistan for selling/purchase/ export of the Medicinal Plants  Usually peoples were reluctant to answers, they were afraid because they were considering as tax officer  After detailed introduction and showing the visiting cards and ID card, some of them agreed and Few gave information due to references  Suspicions prevailing in the market  A few plants have been discovered recently with antidiabetic and/or anticancer potential. Price is up to Rs. 4000/kg, but are exported without acknowledging their real value; there is no export policy.
  • 31. An overview of visit to Medicinal Plant Market in Lahore Wholesalers Name Name of plants (they Locality of M. Comments deal) Plants 1.Shakoor Sahib Banafsha, Reetha, Swat Valley > No Adulteration in Swat Traders (Papar Market) Brooza, Koor, > Adulteration is here Bhman Surkh, Puth >If we go there (e,g in Swat, etc) our bargaining Patri, Malathi, etc. power becomes weak 2.Mr. Naeem Banafsha Jungles/ Mountains > Majority of the traders about 150 in are (Paper Mandi) working in Akbari Mandi while only 35-40 in Papar Mandi 3.Mr Asif 6-7 Major Plants From Local market >Incredible margins exist due to lack of price (Papar Mandi) and resell to Policy Retailer/ Processor 4.Mr. Shahbaz Matar Jarri (Doodh From different > In Akbari Mandi genuine traders of M. Plants (Akbari Mandi) Bacha), Asheesh Localities are only 25-30 (Out of 150); Rest are doing mix business of karyana and medicinal plants > There is no export policy or price system > Hamdard, Marhaba, Ajmal, Hakeems, etc purchase to use 5.Wahab Traders 5-6 Medicinal Plants Export from local D-S based price system (Akbar Mandi) market as well as from Swat
  • 32. DNA Barcoding  Discriminatory power  Low intra-species variability  Species level genetic variability  Short sequence length: 400-800  Universality
  • 33. Collection of Specimens (Leaves, roots, shoots or flowers of medicinal plants) DNA isolation Omitted step; replaced with an advanced method: Phire Plant Direct PCR kit (Thermo Scientific) Amplification of selected (ITS2 of nuclear genome; matK, psbA-trnH, rbcL of DNA regions by PCR cpDNA) Sequencing of amplified (Sanger Method) products Sequencing matching & (BLAST and Reference database of NCBI) alignment Species identification (various bioinfomatics tools) & Phylogenetic study
  • 34. DNA Barcoding and Conservation of Plant Biodiversity  A standardized library of barcodes will enable - identification of rare, native or invasive, endangered species - systematic and conservation-based studies - track ancient divergences between basal lineages - trace organism's evolutionary history and systematic/taxonomic relationships  Authentication of the status of our biodiversity  Adulterated herbal medicinal materials  Establish the evolutionary links of the plant species that are missing at the moment
  • 35. DNA barcoding analysis  Primers designing and optimization of PCR conditions  Selection of four genes ITS, rbcL, trnH-psbA, and matK Primers’ detail used for DNA barcoding studies Amplicon length S. No. Primer Name Sequence (bp) 1. ITS 5F 5′GGAAGTAAAAGTCGTAACAAGG 700 2. ITS 4R 5′TCCTCCGCTTATTGATATGC 700 3. rbcL 1f 5′ATGTCACCACAAACAGAAAC 750 4. rbcL 724r 5′TCGCATGTACCTGCAGTAGC 750 5. trnH-psbA psbAF 5′GTTATGCATGAACGTAATGCTC 400-600 6. trnH-psbA trnH2 5′CGCGCATGGTGGATTCACAATCC 400-600 7. matK 390F 5′CGATCTATTCATTCAATATTTC 850 8. matK 1326R 5′TCTAGCACACGAAAGTCGAAGT 850
  • 36. PCR conditions for different regions of DNA from the Plants PCR reaction Cycling Protocol 3 step protocol Component 25 µL reaction Cycle step Cycles Temp. Time Initial 98 ˚C 5 min H2 O 9.5 µL 1 denaturation Denaturation 98 ˚C 5 sec Phire plant PCR buffer 12.5 µL Annealing Variable* 1 min 30 Extension 72 ˚C 1 min Primer F and Primer R 1.3 µL each Final Extension 72 ˚C 7 min DNA polymerase 0.5 µL 1 Seed sample 0.5 mm punch *Annealing temperatures: ITS 51 oC, rbcL 56 oC, trnH-psbA 55 oC, matK 52 oC Agarose gel for amplified fragments after PCR. Lane 1 ITS, Lane 2 rbcL, Lane 3 DNA ladder, Lane 5 trnH-psbA, Lane 7 matK1
  • 37. Conclusions ~100 plants collected and preserved from both the regions; another visit will be made to the desert area during March (best season) for further collection of the plants and in May to the Swat valley. No valid price system for the sale/purchase of the medicinal plants was found in the main markets. Wholesalers buy the medicinal plants from different collectors at a very low rate and sell in bulk amount at higher rates to the bigger markets. The PCR based method for DNA barcoding is optimized and ready to be applied on the medicinal plants.
  • 38. Conclusion….continued It was noted that the local people could not exploit the medicinal plants due to the following reasons: • Lack of awareness regarding time of harvesting of the medicinal plants • Roots and/or shoots that are grazed and collected for medicinal purpose are a threat for their regeneration • Lack of skills for using medicinal plants as economic opportunity • Lack of knowledge about the marketing of available medicinal plants species
  • 39. Conclusion….continued • Poor management of medicinal plants such as uncontrolled and unsystematic grazing, improper harvesting and mismanagement • Pickers suffer the problems including low price paid by dealers, lack of appropriate tools and equipments, etc., as well as no proper market for sale.
  • 40. Work in progress/future work  Identification of the unidentified plants by a taxonomist  Amplification of the desired DNA sequences from the collected medicinal plants followed by sequencing and phylogenetic analysis  Detailed socio-economic analyses of the regions with respect to the medicinal plants  Biochemical analysis on selected plants of both the regions to assess their real economic importance and value  Organization of awareness workshops in both the regions  Development of policy guidelines for implementation in the regions for conservation of medicinal plants and improving economic condition of the local people
  • 41. Documentation of medicinal plants on molecular basis is necessary for conservation of biodiversity, and to provide ownership of the important plants to the respective region, ultimately leading to improve the socio-economic condition of the neglected communities