This document describes a modified CTAB method for quick extraction of genomic DNA from rice seeds/grains and leaves. The method was optimized to extract high quality DNA suitable for PCR analysis using rice microsatellite primers. The method involves soaking rice tissues in extraction buffer, homogenizing, phenol-chloroform extraction, chloroform extraction, precipitation with isopropanol and washing with ethanol. DNA yields of 1.2-1.8 μg/ml were obtained from different rice tissues. The extracted DNA showed clear bands when run on agarose gel and gave good amplification with SSR primers, demonstrating it is suitable for downstream PCR applications. This protocol provides a simple, cost-effective and high-throughput method for rice DNA extraction.
Detection of Genetic variation in tissue culture clones of date palm using IS...IJSRD
Date palm is a plant having high nutritional value and long life (yielding up to 100 years). Phoenix dactylifera requires 2-5 males for pollination of 100 females’ plant depending up on genetic and environment factors. Therefore paternity variation expected to very low according to PCR based techniques, Even though we have tried to find out genetic variation among tissue culture cloned plant. Tissue culture technique can be used for genetic improvement of date palm. The main purpose of this study was to evaluate the genetic variation in the tissue culture clones of date palm by using ISSR primers among mother and it’s two clones. The plant DNA was extracted and subjected to detection of genetic variation in two groups of date palm using ISSR primers. In this study ISSR primers produced monomorphic bands within group-1 and group-2. Genetic variation in tissue culture clones of date palm was not detecte by UBC primer series.
To study of the genetic variations among the Azospirillum lipoferu isolates u...ijsrd.com
Among free-living microorganisms, which can be practically used in agriculture, bacteria from the Azospirillum genus as well as other endophytes are nowadays thought of as the most active component of associative dinitrogen fixation. The investigation was carried out to study the characterization of Azospirillum lipoferu found in the soils of the ten agro-climatic zones which Karnataka, is classified. By using RAPD markers, 75 bands were scored out of which 78.6 % were found to be polymorphic. Statistical analysis of RAPD data enabled the classification of 10 Azospirillum isolates into two major groups. . In this, the cluster analysis based on 75 RAPD bands revealed that the ten A. lipoferu isolates examined clustered at a linkage distance of about 40 units on the dendrogram. There was no correlation between RAPD and geographical origin of isolates.
Detection of Genetic variation in tissue culture clones of date palm using IS...IJSRD
Date palm is a plant having high nutritional value and long life (yielding up to 100 years). Phoenix dactylifera requires 2-5 males for pollination of 100 females’ plant depending up on genetic and environment factors. Therefore paternity variation expected to very low according to PCR based techniques, Even though we have tried to find out genetic variation among tissue culture cloned plant. Tissue culture technique can be used for genetic improvement of date palm. The main purpose of this study was to evaluate the genetic variation in the tissue culture clones of date palm by using ISSR primers among mother and it’s two clones. The plant DNA was extracted and subjected to detection of genetic variation in two groups of date palm using ISSR primers. In this study ISSR primers produced monomorphic bands within group-1 and group-2. Genetic variation in tissue culture clones of date palm was not detecte by UBC primer series.
To study of the genetic variations among the Azospirillum lipoferu isolates u...ijsrd.com
Among free-living microorganisms, which can be practically used in agriculture, bacteria from the Azospirillum genus as well as other endophytes are nowadays thought of as the most active component of associative dinitrogen fixation. The investigation was carried out to study the characterization of Azospirillum lipoferu found in the soils of the ten agro-climatic zones which Karnataka, is classified. By using RAPD markers, 75 bands were scored out of which 78.6 % were found to be polymorphic. Statistical analysis of RAPD data enabled the classification of 10 Azospirillum isolates into two major groups. . In this, the cluster analysis based on 75 RAPD bands revealed that the ten A. lipoferu isolates examined clustered at a linkage distance of about 40 units on the dendrogram. There was no correlation between RAPD and geographical origin of isolates.
Assessment of genetic fidelity of in vitro propagated clones of Celastrus pan...iosrjce
Celastrus paniculatus Willd belonging to the family Celastaceae is an endangered Indian medicinal
plant having high pharmaceutical application. The objective of the present investigation was to assess the the
clonal fidelity of in vitro propagated clones of Celastrus paniculatus with the field grown mother plant to
confirm their true to type nature. Micropropagation is an alternative method for the large scale production of
endangered medicinal plants. The genetic stability of in vitro raised clones of celastrus paniculatus were
assessed by using RAPD analysis. Genomic DNA was isolated from healthy and fresh leaves of both mother
plant and in vitro raised plants of Celastrus paniculatus by using CTAB method. Based on the reproducibility of
the primers, 15 RAPD primers were selected for the present investigation. The selected primers gave rise to a
total of 75 scorable bands with an average of 5.1 bands ranging from 300-2700 bp. The number of bands varied
from three (OPQ-07, OPA-13) to seven (OPC-20, OPN-16). Randomly selected 10 micropropagated plants
from each culture period was used. Amplification pattern was electrophoresed in 1.5% TBE, revealing that all
the bands produced by micropropagated plants were monomorphic and similar to that of the field grown plant.
No polymorphism was detected by RAPD analysis.
S M Masiul Azam, Md Shahidul Islam, Parvin Shahanaz, Md Shafiqur Rahman and Sarder Md Shahriar Alam. “Molecular Characterization of Brassica Cultivars through RAPD Markers” United International Journal for Research & Technology (UIJRT) 1.3 (2019): 41-45.
An improved method for RNA extraction from woody legume species Acacia koa A....Premier Publishers
It is difficult to extract high-quality RNA of sufficient quantity from the stem tissues of tree legumes, such as Acacia koa and Leucaena leucocephala, because they contain high amounts of phenolic compounds and polysaccharides. The objective of this study was to develop an improved protocol that produces high-quality RNA from the stem tissues of these tree legumes. We developed a modified method that utilizes a lysis buffer containing a mixture of two commercially available reagents, RLT buffer from Qiagen RNeasy Kit and Fruit-mate™ from Takara. Comparison of the modified method with four other RNA extraction methods (Qiagen RNeasy, Fruit-mate™, TRIzol, and cetyltrimethylammonium bromide (CTAB)) showed that the modified method was far superior to the other methods. The extracted RNA produced reproducible DNA products in reverse transcription-polymerase chain reaction (RT-PCR). This improved protocol is rapid and easy, and it will facilitate genetic studies of A. koa, L. leucocephala, and other woody plants.
Genetic diversity in pea germplasm using RAPD MarkersShujaul Mulk Khan
Selection of the genotypes using plasmid assisted technology provides an efficient and useful tool for elaborating genetic relationships among genotypes. In present study, 48 Pea (Pisum sativum var sativum L.) genotypes obtained from different sources were analyzed through 20 RAPD, DNA markers for assessment of intraspecific DNA variations. Results revealed that significant variations were present in minor bands. Major bands also showed significant diversity. Considerable variations were also recorded in density of some common bands. Maximum and minimum genetic diversity i.e., 80% and 20% was found among 08 and 23 comparisons, respectively from banding profile. These variations can be
used further for enhancing variability, a prerequisite for crop breeding. Phylogenetic clustering (through dendrogram analysis) of genotypes revealed that genetic diversity is independent of origin of genotypes. Forty eight genotypes of pea clustered in three main groups A, B and C comprising 23, 5 and 20 genotypes, respectively. Group A1 and C1 included the most distantly related genotypes and hence can be recommended for breeding to obtain genetically diverse segregating populations.
The International Journal of Engineering and Science (IJES)theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
Phylotype Analysis of Ralstonia Solanacearum Causing Bacterial wilt in Eggpla...ijtsrd
Eggplant is prone to attack by several pests including bacteria, fungi, nematodes and insects. In this study, we have analyzed phylotype of bacterial wilt Ralstonia solanacearum infection in eggplant plants collected from Bhubaneswar Orissa in India. Bacterial wilt symptomatic five plant samples were collected from brinjal field in Bhubaneswar in 2016. The samples were macerated in sterile distilled water and grown on Kelman's triphenyltetrazolium chloride TZC agar media. Total genomic DNA of the bacterium were extracted and subjected to PCR amplification using the R. solanacearum specific universal primer pair 759 760. An expected single 280 bp fragment amplified in all the samples confirmed the identity of these as Ralstonia. To reconfirmed isolate of bacterium, the amplicon was sequenced in sequencer. In NCBI blast, the nucleotide sequence was 100 similar with Ralstonia solanacearum strain RS lpxC DOB 1 AB910593 and the sequence was submitted in NCBI database under Acc. No. KY393266. To determined phylotype of strain used specific multiplex PCR with phylotype specific primers Nmult 21F1 2, Nmult 22InF, Nmult 23AF, Nmult 22RR revealed that all the five infected samples belonged to phylotype I as a 144 bp amplicon were observed in agarose gel. On the basis of above finding concluded that the bacterial wilt infected eggplant collected from Bhubaneswar was Ralostonia solanacearum, Phylotype I. Rakesh Kumar | Ramachandran, E. | Koteshwar Yadav "Phylotype Analysis of Ralstonia Solanacearum Causing Bacterial wilt in Eggplants in Orissa in India" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-3 , April 2019, URL: https://www.ijtsrd.com/papers/ijtsrd21580.pdf
ABSTRACT: The Study was undertaken with an objective to develop a protocol for micropropagation of Pongamia pinnata pierre through shoot apex segments shoot of 0.5 to 1.0 cm were collected and used as a explant. The treatment of 1.0 NaOCl (Sodium hypochloride) (W/v) solution 1 minute to 10 minute time duration. These treated explant washed trice with double distilled water and cultured in MS (Murashige and skoog) medium. In this experiment auxin 2, 4-D, NAA and cytokinin BAP, Kinetin were used for optimization of maximum callus induction.
Shoot apex explant culturing callus induction maximum callus is produced when MS medium with 3.0 mg/l, 2, 4-D and BAP 0.5 mg/l, the optimized physical condition has to be maintain throughout the experiment. In this study about 30 to 35% mature sotmatic embryos germinated after sub culture from shoot apex. Different concentration and combination of NAA, IAA, IBA and BAP were used to inducted rooting on MS based medium. When the hight in vitro shoot, were reached up to 8 cm with healthy shooted roots, the plants were ready for hardening. The complete protocol for somatic embryogenesis, shoot induction, root induction up to hardening.
COMPARATIVE STUDY OF CAPSAICIN FROM IN VITRO CULTIVATED AND NATURALLY CULTIVA...Dr Dama
COMPARATIVE STUDY OF CAPSAICIN FROM IN VITRO CULTIVATED AND NATURALLY CULTIVATED CAPSICUM FRUITS EXTRACTS
*Vinchurkar A.S., *Sonawane S. R., *Sherkhane S.S., *Mane P. P., *Valsange A.B. and *Dama L. B.
Genetic Variability for Antioxidant Activity and Total Phenolic Content in Fo...CrimsonpublishersNTNF
Total phenolic content and antioxidant activity were evaluated in 139 diverse genotypes of four pulse crops including 54 genotypes of chickpea (Cicer arietinum), 37 lentil (Lens culinaris), 21 pigeonpea (Cajanus cajan), and 26 blackgram (Vigna mungo). Results indicate significant genotypic variation (p < 0.01) for total phenolic content (TPC) as well as antioxidant activity (AOA). Amongst the four major pulse crops tested, maximum mean phenolic content was recorded in blackgram genotypes (7.01mg GAE/g), followed by lentil (3.46mg GAE/g), pigeonpea (3.32mg GAE/g) and chickpea (2.30mg GAE/g). In general, the Mediterranean landraces of lentil had higher phenolic content as compared to the other lentil varieties and breeding lines. Amongst the chickpea genotypes the phenolic content ranged from 0.40 to 5.63mg GAE/g and comparatively higher value for phenolic content was recorded in desi types (2.67mg GAE/g) as compared to the Kabuli types (1.05mg GAE/g). The antioxidant activity (AOA) was assayed in mature dry seeds utilizing DPPH (2,2-Diphenyl-1-picryl hydrazyl) radical scavenging assay which ranged from 1.73 to 19.14μmole Trolox/g tissue. As observed for TPC, highest AOA was also recorded in blackgram genotypes (19.14μmole Trolox/g tissue), followed by pigeonpea (2.72μmole Trolox/g tissue), chickpea (2.05μmole Trolox/g tissue) and lentil (1.73μmole Trolox/g tissue). Highly significant genotypic as well as phenotypic correlation (p<0.01) was recorded between phenolic content and antioxidant activity in chickpea, lentil as well as blackgram (rG values ranging from 0.268 to 0.850 and rP from 0.253 to 0.817), however, surprisingly the values were non-significant in case of pigeonpea. Strongest genotypic correlation was recorded in chickpea (rG=0.850), followed by lentil (rG =0.744), and blackgram (rG =0.268). High broad-sense heritability (h2bs) (0.89 to 0.97) for phenol content was recorded which indicates that substantial portion of total variation for phenolic content is due to genetic effects.
Piccola Cucina is regarded as the best restaurant in Brooklyn and as the best Italian restaurant in NYC. We offer authentic Italian cuisine with a Sicilian touch that elevates the entire fine dining experience. We’re the first result when someone searches for where to eat in Brooklyn or the best restaurant near me.
Assessment of genetic fidelity of in vitro propagated clones of Celastrus pan...iosrjce
Celastrus paniculatus Willd belonging to the family Celastaceae is an endangered Indian medicinal
plant having high pharmaceutical application. The objective of the present investigation was to assess the the
clonal fidelity of in vitro propagated clones of Celastrus paniculatus with the field grown mother plant to
confirm their true to type nature. Micropropagation is an alternative method for the large scale production of
endangered medicinal plants. The genetic stability of in vitro raised clones of celastrus paniculatus were
assessed by using RAPD analysis. Genomic DNA was isolated from healthy and fresh leaves of both mother
plant and in vitro raised plants of Celastrus paniculatus by using CTAB method. Based on the reproducibility of
the primers, 15 RAPD primers were selected for the present investigation. The selected primers gave rise to a
total of 75 scorable bands with an average of 5.1 bands ranging from 300-2700 bp. The number of bands varied
from three (OPQ-07, OPA-13) to seven (OPC-20, OPN-16). Randomly selected 10 micropropagated plants
from each culture period was used. Amplification pattern was electrophoresed in 1.5% TBE, revealing that all
the bands produced by micropropagated plants were monomorphic and similar to that of the field grown plant.
No polymorphism was detected by RAPD analysis.
S M Masiul Azam, Md Shahidul Islam, Parvin Shahanaz, Md Shafiqur Rahman and Sarder Md Shahriar Alam. “Molecular Characterization of Brassica Cultivars through RAPD Markers” United International Journal for Research & Technology (UIJRT) 1.3 (2019): 41-45.
An improved method for RNA extraction from woody legume species Acacia koa A....Premier Publishers
It is difficult to extract high-quality RNA of sufficient quantity from the stem tissues of tree legumes, such as Acacia koa and Leucaena leucocephala, because they contain high amounts of phenolic compounds and polysaccharides. The objective of this study was to develop an improved protocol that produces high-quality RNA from the stem tissues of these tree legumes. We developed a modified method that utilizes a lysis buffer containing a mixture of two commercially available reagents, RLT buffer from Qiagen RNeasy Kit and Fruit-mate™ from Takara. Comparison of the modified method with four other RNA extraction methods (Qiagen RNeasy, Fruit-mate™, TRIzol, and cetyltrimethylammonium bromide (CTAB)) showed that the modified method was far superior to the other methods. The extracted RNA produced reproducible DNA products in reverse transcription-polymerase chain reaction (RT-PCR). This improved protocol is rapid and easy, and it will facilitate genetic studies of A. koa, L. leucocephala, and other woody plants.
Genetic diversity in pea germplasm using RAPD MarkersShujaul Mulk Khan
Selection of the genotypes using plasmid assisted technology provides an efficient and useful tool for elaborating genetic relationships among genotypes. In present study, 48 Pea (Pisum sativum var sativum L.) genotypes obtained from different sources were analyzed through 20 RAPD, DNA markers for assessment of intraspecific DNA variations. Results revealed that significant variations were present in minor bands. Major bands also showed significant diversity. Considerable variations were also recorded in density of some common bands. Maximum and minimum genetic diversity i.e., 80% and 20% was found among 08 and 23 comparisons, respectively from banding profile. These variations can be
used further for enhancing variability, a prerequisite for crop breeding. Phylogenetic clustering (through dendrogram analysis) of genotypes revealed that genetic diversity is independent of origin of genotypes. Forty eight genotypes of pea clustered in three main groups A, B and C comprising 23, 5 and 20 genotypes, respectively. Group A1 and C1 included the most distantly related genotypes and hence can be recommended for breeding to obtain genetically diverse segregating populations.
The International Journal of Engineering and Science (IJES)theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
Phylotype Analysis of Ralstonia Solanacearum Causing Bacterial wilt in Eggpla...ijtsrd
Eggplant is prone to attack by several pests including bacteria, fungi, nematodes and insects. In this study, we have analyzed phylotype of bacterial wilt Ralstonia solanacearum infection in eggplant plants collected from Bhubaneswar Orissa in India. Bacterial wilt symptomatic five plant samples were collected from brinjal field in Bhubaneswar in 2016. The samples were macerated in sterile distilled water and grown on Kelman's triphenyltetrazolium chloride TZC agar media. Total genomic DNA of the bacterium were extracted and subjected to PCR amplification using the R. solanacearum specific universal primer pair 759 760. An expected single 280 bp fragment amplified in all the samples confirmed the identity of these as Ralstonia. To reconfirmed isolate of bacterium, the amplicon was sequenced in sequencer. In NCBI blast, the nucleotide sequence was 100 similar with Ralstonia solanacearum strain RS lpxC DOB 1 AB910593 and the sequence was submitted in NCBI database under Acc. No. KY393266. To determined phylotype of strain used specific multiplex PCR with phylotype specific primers Nmult 21F1 2, Nmult 22InF, Nmult 23AF, Nmult 22RR revealed that all the five infected samples belonged to phylotype I as a 144 bp amplicon were observed in agarose gel. On the basis of above finding concluded that the bacterial wilt infected eggplant collected from Bhubaneswar was Ralostonia solanacearum, Phylotype I. Rakesh Kumar | Ramachandran, E. | Koteshwar Yadav "Phylotype Analysis of Ralstonia Solanacearum Causing Bacterial wilt in Eggplants in Orissa in India" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-3 , April 2019, URL: https://www.ijtsrd.com/papers/ijtsrd21580.pdf
ABSTRACT: The Study was undertaken with an objective to develop a protocol for micropropagation of Pongamia pinnata pierre through shoot apex segments shoot of 0.5 to 1.0 cm were collected and used as a explant. The treatment of 1.0 NaOCl (Sodium hypochloride) (W/v) solution 1 minute to 10 minute time duration. These treated explant washed trice with double distilled water and cultured in MS (Murashige and skoog) medium. In this experiment auxin 2, 4-D, NAA and cytokinin BAP, Kinetin were used for optimization of maximum callus induction.
Shoot apex explant culturing callus induction maximum callus is produced when MS medium with 3.0 mg/l, 2, 4-D and BAP 0.5 mg/l, the optimized physical condition has to be maintain throughout the experiment. In this study about 30 to 35% mature sotmatic embryos germinated after sub culture from shoot apex. Different concentration and combination of NAA, IAA, IBA and BAP were used to inducted rooting on MS based medium. When the hight in vitro shoot, were reached up to 8 cm with healthy shooted roots, the plants were ready for hardening. The complete protocol for somatic embryogenesis, shoot induction, root induction up to hardening.
COMPARATIVE STUDY OF CAPSAICIN FROM IN VITRO CULTIVATED AND NATURALLY CULTIVA...Dr Dama
COMPARATIVE STUDY OF CAPSAICIN FROM IN VITRO CULTIVATED AND NATURALLY CULTIVATED CAPSICUM FRUITS EXTRACTS
*Vinchurkar A.S., *Sonawane S. R., *Sherkhane S.S., *Mane P. P., *Valsange A.B. and *Dama L. B.
Genetic Variability for Antioxidant Activity and Total Phenolic Content in Fo...CrimsonpublishersNTNF
Total phenolic content and antioxidant activity were evaluated in 139 diverse genotypes of four pulse crops including 54 genotypes of chickpea (Cicer arietinum), 37 lentil (Lens culinaris), 21 pigeonpea (Cajanus cajan), and 26 blackgram (Vigna mungo). Results indicate significant genotypic variation (p < 0.01) for total phenolic content (TPC) as well as antioxidant activity (AOA). Amongst the four major pulse crops tested, maximum mean phenolic content was recorded in blackgram genotypes (7.01mg GAE/g), followed by lentil (3.46mg GAE/g), pigeonpea (3.32mg GAE/g) and chickpea (2.30mg GAE/g). In general, the Mediterranean landraces of lentil had higher phenolic content as compared to the other lentil varieties and breeding lines. Amongst the chickpea genotypes the phenolic content ranged from 0.40 to 5.63mg GAE/g and comparatively higher value for phenolic content was recorded in desi types (2.67mg GAE/g) as compared to the Kabuli types (1.05mg GAE/g). The antioxidant activity (AOA) was assayed in mature dry seeds utilizing DPPH (2,2-Diphenyl-1-picryl hydrazyl) radical scavenging assay which ranged from 1.73 to 19.14μmole Trolox/g tissue. As observed for TPC, highest AOA was also recorded in blackgram genotypes (19.14μmole Trolox/g tissue), followed by pigeonpea (2.72μmole Trolox/g tissue), chickpea (2.05μmole Trolox/g tissue) and lentil (1.73μmole Trolox/g tissue). Highly significant genotypic as well as phenotypic correlation (p<0.01) was recorded between phenolic content and antioxidant activity in chickpea, lentil as well as blackgram (rG values ranging from 0.268 to 0.850 and rP from 0.253 to 0.817), however, surprisingly the values were non-significant in case of pigeonpea. Strongest genotypic correlation was recorded in chickpea (rG=0.850), followed by lentil (rG =0.744), and blackgram (rG =0.268). High broad-sense heritability (h2bs) (0.89 to 0.97) for phenol content was recorded which indicates that substantial portion of total variation for phenolic content is due to genetic effects.
Piccola Cucina is regarded as the best restaurant in Brooklyn and as the best Italian restaurant in NYC. We offer authentic Italian cuisine with a Sicilian touch that elevates the entire fine dining experience. We’re the first result when someone searches for where to eat in Brooklyn or the best restaurant near me.
At Taste Of Middle East, we believe that food is not just about satisfying hunger, it's about experiencing different cultures and traditions. Our restaurant concept is based on selecting famous dishes from Iran, Turkey, Afghanistan, and other Arabic countries to give our customers an authentic taste of the Middle East
Roti Bank Hyderabad: A Beacon of Hope and NourishmentRoti Bank
One of the top cities of India, Hyderabad is the capital of Telangana and home to some of the biggest companies. But the other aspect of the city is a huge chunk of population that is even deprived of the food and shelter. There are many people in Hyderabad that are not having access to
Key Features of The Italian Restaurants.pdfmenafilo317
Filomena, a renowned Italian restaurant, is renowned for its authentic cuisine, warm environment, and exceptional service. Recognized for its homemade pasta, traditional dishes, and extensive wine selection, we provide a true taste of Italy. Its commitment to quality ingredients and classic recipes has made it a adored dining destination for Italian food enthusiasts.
Ang Chong Yi Navigating Singaporean Flavors: A Journey from Cultural Heritage...Ang Chong Yi
In the heart of Singapore, where tradition meets modernity, He embarks on a culinary adventure that transcends borders. His mission? Ang Chong Yi Exploring the Cultural Heritage and Identity in Singaporean Cuisine. To explore the rich tapestry of flavours that define Singaporean cuisine while embracing innovative plant-based approaches. Join us as we follow his footsteps through bustling markets, hidden hawker stalls, and vibrant street corners.
Ang Chong Yi Navigating Singaporean Flavors: A Journey from Cultural Heritage...
seed DNA extraction.pdf
1. See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/335061141
A Modified CTAB Method for Quick Extraction of Genomic DNA from Rice
Seed/Grain/Leaves for PCR Analysis
Article · October 2016
CITATIONS
6
READS
1,297
2 authors:
Some of the authors of this publication are also working on these related projects:
Development of hybrid rice View project
Molecular profiling of aerobic rice View project
Bibha Rani
Rajendra Agricultural University
9 PUBLICATIONS 43 CITATIONS
SEE PROFILE
V. K. Sharma
Rajendra Agricultural University
98 PUBLICATIONS 330 CITATIONS
SEE PROFILE
All content following this page was uploaded by V. K. Sharma on 09 August 2019.
The user has requested enhancement of the downloaded file.
3. www.ijsrm.humanjournals.com
Citation: Bibha Rani et al. Ijsrm.Human, 2016; Vol. 4 (4): 254-260.
255
INTRODUCTION
The most severe problem with rice is that the mean minimum temperature of 120
C for 30 days
after seeding is critical and temperature below 120
C resulted in high risk of crop failure due to
poor germination, poor seedling growth or insufficient seedlings (Sipaseuth et.al.2007). In case
of germination failure, DNA extracted directly from endosperm tissues can be effectively used in
genotyping, genetic purity testing and seed quality evaluation (Mutou et. al. 2014). Pure and
rapid DNA extraction is pre-requisite step for the most advanced techniques such as genetic
mapping, DNA fingerprinting, marker assisted selection etc. DNA isolation from rice grains can
be very time consuming and difficult procedure. However, PCR-based techniques for molecular
analysis requires efficient recovery of good quality and quantity of DNA. The CTAB based
method and its modifications have been used to obtain good quality of DNA for PCR-based
downstream applications (Yari et.al.2013, Chuan 2010, Ahmadikhak 2010).
DNA-based molecular markers have been used extensively to assess the genetic diversity in most
crop species. Condit and Hubbell (1991) were among the first to report that SSRs occur
abundantly in plant species. SSR or microsatellite markers consist of di-, tri-, or oligonucleotide
tandem repeats and are distributed throughout the eukaryotic genome (Struss and Plieske, 1998).
Due to high efficiency, reproducibility, easy-to-use, co-dominance nature and high degree of
polymorphism, or simple sequence repeats (SSRs) are widely used as molecular markers for
fingerprinting germplasm to assess genetic diversity, pedigree analysis, evolutionary studies and
genome mapping. (Yang et.al., 1994; Garland et.al. 1999). Hence, the aim of this work was to
standardize a DNA isolation protocol for rice seeds/grains which would be simple, cost-effective,
a high throughput, be suitable for PCR, and needs a few plant tissues without using liquid
nitrogen. The protocol was also tested for several tissues of rice (seeds, grains, leaves of rice
seedlings and leaves from vegetative stage) for their DNA yield.
MATERIALS AND METHODS
Plant material: Good healthy seeds of three selected genotypes i.e. NDRK 11-6, CR2218-64-1-
327-4-1 and CR 2814-2-4-3-1-1-1 were used in this study. The genotypes were collected from
CSSRI, Karnal, India.
4. www.ijsrm.humanjournals.com
Citation: Bibha Rani et al. Ijsrm.Human, 2016; Vol. 4 (4): 254-260.
256
Genomic DNA extraction:
25 rice seeds/grains or 3.7 mg of green leaves are washed with distilled water and soaked in 3ml
of extraction buffer ( 8% CTAB, 8% PVP, 1.4 M NaCl, 0.1M Tris (pH 8), 25Mm EDTA) with
15 µl β-mercaptoethanol for 45 minutes in sterilized mortar pestle (soaking is not required for
leaves). Mortar pestle with soaked seeds is now transfer in -20 for 5 minutes to harden the seed
tissue for crushing. Soaked seeds are homogenized in mortar pestle till tissue disintegrates (small
pieces of leaves were homogenized with plastic pestle in 2ml test tubes). Then homogenate is
transferred in 2ml centrifuged tubes (600 microlitre homogenate in each tube). 600 microlitre
phenol:chloroform (1:1) is added, mix well by inversion and centrifuge at 13000 rpm for 6
minutes. The supernatant is transferred into another 2 ml centrifuge tubes and 600 microliters of
chloroform:isoamyl alcohol (24:1) is added and centrifuged at 13000 rpm for 6 minutes.
Supernatant is transferred into 1.5 ml tubes and 700 microlitre ice chilled isopropanol is added
and mix it by inversion and leave for 10 minutes and centrifuge at 12000 rpm for 10 minutes.
Supernatant are now washed with 70% ethanol. Air dry the pellet for 1 hour and dissolve it in TE
buffer (pH 8). RNase treatment is given for 30 minutes at 370
C. Now the DNA is used for PCR
analysis.
DNA Quantification and visualization:
The concentration of DNA obtained (ng/µl) by this protocol was determined on
spectrophotometer. The purity level for all the genotypes under investigation were assessed by
measuring optical density at A260 and A280 by UV spectrophotometer. Samples were subjected to
electrophoresis in 0.5X TBE buffer for 45 minutes at 80V. 6 µl of isolated genomic DNA was
loaded on 0.8% agarose gel stained with ethidium bromide (7µl/100ml of gel) to check DNA
quality. The gels were photographed under gel documentation system (BIO-RAD). (table2)
PCR and product analysis:
Amplification reaction was carried out in a thermal cycler (Eppendorf) with 15µl of PCR
reaction mixture containing 2µl 10X PCR buffer, 0.15µl 5 u/µl taq, 0.15µl 50mM Mgcl2,0.5 µl
2mM dNTPs, 2µl DNA, 1µl of each forward and reverse rice microsatellite primers at a
concentration of 10 pmol/µl. The thermal cycling conditions for the first cycle were 940
C for 4
5. www.ijsrm.humanjournals.com
Citation: Bibha Rani et al. Ijsrm.Human, 2016; Vol. 4 (4): 254-260.
257
min and Ta for 1 min. For the next 30 cycles, the temperature regime was 940
C for 1 min, Ta for
1 min and 720
C for 2 min. The final extension was at 720
C for 5 min. The amplified products
were resolved in 1.8% agarose gel and documented in gel documentation system. A total of 6
SSR (RM 493, RM 1108, RM 25519, RM 10764, RM10864, RM 10748) primers have been used
for assessment of PCR amplification of isolated genomic DNA of rice seed/grain by discussed
protocol.
L 1 2 3 4 5 6 7 8 9
Primers Genotypes
NDRK 11-6 CR2218-64-1-327-4-1 CR 2814-2-4-3-1-1-1
RM 493 Lane 1 Lane 2 Lane 3
RM 11008 Lane 4 Lane 5 Lane 6
RM 25519 Lane 7 Lane 8 Lane 9
Fig1: PCR amplified product with SSR primers RM493, RM11008, RM25519
L 1 2 3 4 5 6 7 8 9
Primers Genotypes
NDRK 11-6 CR2218-64-1-327-4-1 CR 2814-2-4-3-1-1-1
RM 10864 Lane 1 Lane 2 Lane 3
RM 10764 Lane 4 Lane 5 Lane 6
RM 10748 Lane 7 Lane 8 Lane 9
Fig 2: PCR amplified products with SSR primers RM10864, RM10764, RM10748
50 bp
6. www.ijsrm.humanjournals.com
Citation: Bibha Rani et al. Ijsrm.Human, 2016; Vol. 4 (4): 254-260.
258
Table 1: List of 6 SSR primers used for validation of amplification by PCR of isolated
genomic DNA.
Sr.
No.
Primers
Repeat
motifs
Sequence
Annealing
temperature
Ch.
No.
1. RM493 (CTT)9
TAGCTCCAACAGGATCGACC(F)
GTACGTAAACGCGGAAGGTG(R)
58 1
2. RM11008 (TTC)12
TTTGGATGGTCATTAGCCTCTGG(F)
ATCAACCTTGCATGCTGTCTTCC(R)
58 1
3. RM25519 (TA)42
GGTGATTAATTACTGGTCGGAAGG(F)
GCTGGTTTGATCGGAATTACAGG(R)
58
10
4. RM10864 (GT)27
GAGGTGAGTGAGACTTGACAGTGC(F)
GCTCATCATCCAACCACAGTCC(R)
60 1
5. RM10764 (AT)28
AGATGTCGCCTGATCTTGCATCG(F)
GATCGACCAGGTTGCATTAACAGC(R)
60 1
6. RM10748 (AG)14
CATCGGTGACCACCTTCTCC(F)
CCTGTCATCTATCTCCCTCAAGC(R)
60 1
7. www.ijsrm.humanjournals.com
Citation: Bibha Rani et al. Ijsrm.Human, 2016; Vol. 4 (4): 254-260.
259
Table 2: DNA yield from different tissues of rice
Sr. NO. GENOTYPES TISSUE USED
DNA YIELD
OBTAINED IN
MICROGRAM/ml
Remarks
1. NDRK 11-6
Kernel 1.2 The yield of
nuclear DNA
from all the
tissues is great.
Most importantly
the quantity of
DNA from the
seed/grain is
appropriate for
PCR
amplification as
shown in figs.
Dehusked seed 1.45
green fresh
leaves of
seedling stage
1.8
Green leaves of
vegetative stage
1.6
2.
CR2218-64-1-
327-4-1
Kernel 1.2
Dehusked seed 1.42
Green fresh
leaves of
seedling stage
1.8
Green leaves of
vegetative stage
1.6
3.
CR 2814-2-4-3-
1-1-1
Kernel 1.2
Dehusked seed 1.45
Green fresh
leaves of
seedling stage
1.8
Green leaves of
vegetative stage
1.6
8. www.ijsrm.humanjournals.com
Citation: Bibha Rani et al. Ijsrm.Human, 2016; Vol. 4 (4): 254-260.
260
RESULTS AND DISCUSSION
The presented modified CTAB method can isolate DNA from various tissues of rice seeds in a
short duration without using water bath and liquid nitrogen. This protocol isolates DNA of good
quality and PCR compatible from rice grains/seeds. Isolated DNA from seed and other tissues
gave excellent amplification product by using SSR primers. However this protocol gives highest
amount of DNA from green fresh leaves of seedling stage and green leaves of vegetative stage
i.e. 1.8 µl and 1.6 µl respectively (1.8 µg / µl: table), other tissues like kernels and dehusked
seeds also gave good quantity of DNA which is required for the PCR amplification reaction.
ACKNOWLEDGEMENT
The financial assistant provided by University Grant Commission (No.F.16-1878(SC)/2010(SA-
III)) and dept. of Agricultural Biotechnology and Molecular Biology, Rajendra Agricultural
University, Pusa, Samastipur, Bihar.
REFERENCES
1.Ahmed, I., Islam, M., Arshad, W., Mannan, A., Ahmad, W., Mirza, B. (2009) High quality plant DNA extraction
for PCR: an easy approach. J Appl Genet 50:105–107
2.Mutou, C., Tanaka, K. and Ishikawa, R. (2014)DNA extraction from rice endosperm (including a protocol for
extraction of DNA from ancient seed samples. Methods Mol Biol.1099:7-15.
3. Sipaseuth , J. Basnayake , S. Fukai , T.C. Farrell , M. Senthonghae , Sengkeo ,S. Phamixay , B. Linquist , M.
Chanphengsay 2007.Opportunities to increasing dry season rice productivity in low temperature affected areas. Field
Crops Research 102, 87–97.
4.Struss, D., and J. Plieske. 1998. The use of microsatellite markers for detection of genetic diversity in barley
populations. Theor. Appl. Genet. 97:308-315.
5. Condit, R., and S.P. Hubbell. 1991. Abundance and DNA sequence of two base repeat regions in tropical tree
genomes. Genome 34:66-71.
6. Yang, G.P., Maroof, M.A.S., Xu, C.G., Zhang, Q., and Biyashcv, R.M. 1994. Comparative analysis of
microsatellite DNA polymorphism in land races and cultivars of rice. Mol. Gen. 245:187-194.
7. Ahmadikhah, A., 2010 A rapid mini-prep DNA extraction method in rice (Oryza sativa), African Journal of
Biotechnology, 8 (2); 323-327.
8.Yari H., Emami A., Khosravi, H.R.M., and Pourmehdi, S. 2013 Optimization of a Rapid DNA Extraction Protocol
in Rice Focusing on Age of Plant and EDTA Concentration. Journal of Medical and Bioengineering. 2(3); 218-223.
9.Chuan, S., Ying-hong, H., Gang, C., Yu-chun, R., Guan-heng, Z., Zhen-yu, G., Jian L., Pei-na, J., Jiang, H., Long-
biao, G., Qian, Q. and Da-li, Z. 2010 A simple method for preparation of rice genomic DNA. Rice science 17(4);
326-329.
View publication stats
View publication stats
