Essay About Biology Lab

Essay about Biology Lab
IB SL Biology Lab
Molecular Biology:
Transformation and Electrophoresis
Christina Qi
2/16/07
Aim:
How can a plasmid be engineered to include a foreign piece of DNA and how does gel
electrophoresis separate DNA molecules present in a mixture?
Hypothesis:
If the pGLO plasmid is inserted into competent Escherichia coli cells, then the transformed bacteria
will be resistant to ampicillin and will glow green under UV light. If samples of DNA are cut using
certain restriction enxymes and separated using gel electrophoresis, then the smaller the DNA
fragment cut, the greater the distance it will travel in the gel.
Variables: The control plates used in transformation are the LB and second LB/Amp plates marked
... Show more content on Helpwriting.net ...
The LB/Amp/ara, and one of the LB/Amp plates marked with a "+" are the experimental plates.
The LB and second LB/Amp plates marked with a "–" are the controls.
7. Following 10 minutes of incubation on ice, "heat shock" the bacterial cells. Remove tubes from
the ice and immediately immerse them in the 42° C water for 50 seconds. Return the tubes
immediately to the ice for 2 minutes.
8. Use a sterile transfer pipette to add 250 μl of Luria broth (LB) to the tubes. Gently tap the tube
with a finger to mix, and set the tubes in the cup (without the ice) at room temperature for 10
minutes to recover.
9. Use a sterile transfer pipette to add 100 μl of cell suspension from the "+" culture tube onto your
LB/Amp/ara and LB/Amp plates. Then, using a new sterile transfer pipette, add 100 μl of cell
suspension from the "–" culture tube onto your LB/Amp and LB plates. Remember to only open the
lid enough to get the tip of the pipette inside to deposit the 100 μl to prevent possible contamination
of the culture by bacteria in the air.
10. Using a new inoculation loops, immediately spread the cells over the surface of the plates.
Use one loop to streak the two positive plates. Use a second loop to streak the two negative plates.
To streak, lift the plate lid only enough to get the loop inside, move the loop through the culture and

the over the surface of the agar as evenly as possible.
11. Invert the plates and
... Get more on HelpWriting.net ...

Gun Restrictions
"More than just an end to war, we want an end to the beginnings of all wars." At the time, President
Theodore Roosevelt was referring to actual war, however saying this quote in the present can mean
something different. Our country is currently at war with gun control; sadly this war is not like the
rest because we can't fight this war with violence. The lack of restrictions on who can purchase a
gun is making America an unsafe country for people of all ages; however, this issue can still be
fixed through the use of public awareness and reaching out to the society. Although our country does
have some restrictions as to who can buy a gun, there are no laws that require private sellers to have
restrictions or run background checks on the people ... Show more content on Helpwriting.net ...
There are constantly events that happen in the United States that support increasing gun control. In
fact, protests for gun control have been, and are still being, held all over the country that support
restrictions on who should be able to purchase a firearm. Just recently there was a protest on gun
control that was commonly known as the Parkland March on Our Lives protest. The protest was
held by the students, adults, and children of America who felt that they needed to do something to
halt the numerous shootings that have occurred due to lack of gun control. This shows that people
all around the country recognize it as an issue and are fighting to put it to an end. If protesting isn't
your cup of tea, you could also try writing a letter to the legislators of your state. It's always
important to remember that our country is a democracy; every voice has say in what happens.
Everybody has a voice in this society, what is important is that we use

DUI Restrictions
Nevada and California's criminal justice systems take DUI charges seriously, and so do the defense
lawyers at Laub and Laub Attorneys at Law. They want you to stay sober and safe on the road, and
be aware of what happens if you are convicted of DUI in either state. In Nevada, your driver's
license will be revoked for a first offense DUI if you have a blood alcohol content of 0.08% or more.
For commercial licenses, the limit is 0.04%. In addition to losing your license, you must: Do 48
hours of community service or spend two days or more in jail, and Pay a fine between $400 and
$1,000 plus fees Pay a chemical testing fee of $60 Pay a $100 DUI fee Attend a Victim Impact Panel
presentation Complete a court–ordered alcohol/drug awareness class or counseling sessions ... Show
more content on Helpwriting.net ...
They work hard to get DUI charges dismissed, or reduced to charges that save your license, your
job, and your money. If you have to go to trial, count on these defense lawyers to fight to the end for
a "not guilty" verdict. Whether you face DUI charges in Nevada or California, get Laub and Laub
Attorneys at Law to help you. In Nevada, call (775) 333–5282 for their Reno office, and (775) 883–
5282 for their Carson City office. In California, call (530) 587–5282 for their Truckee office. Visit
their website, like them on Facebook, and follow them on

Crime Scene Samples With Gel Electrophoresis
Comparing Suspect DNA to Crime Scene Samples with Gel Electrophoresis
Christopher Davis
Lab Partners: Jessica Roubert and Aishat Alimi
TA: Tam–Anh Phan
BSC 2010L
Section: 033
November 1, 2014 Materials and Methods
Restriction Enzyme Digest and Preparation of the DNA Samples
Four microcentrifuge tubes were placed in a rack, labeled and numbered, in order to identify the
group and the DNA/restriction enzyme that it held. Each of the tubes initially received 10
microliters of reaction buffer. There were two samples of suspect DNA provided along with two
restriction enzymes (EcoRI and HindIII). Tubes labeled 1 and 2 received 15 μL of DNA from
suspect one while tubes 3 and 4 received 15 μL of DNA from suspect two. Following that, 15 μL of
Enzyme 1 (EcoRI) were added to tubes 1 and 3, and 15 μL of Enzyme 2 (HindIII) were added to
tubes 2 and 4. (Table 1). The tubes were then gently tapped on the counter to mix the DNA and
enzyme solution followed by incubation at 37°C for 45 minutes. After incubation, 5 μL of 10x gel
loading dye were added to each of the four tubes of suspect DNA. The tubes were then placed on ice
while the gel was under preparation.
Casting, Preparing, and Staining the Gel
To prepare the 0.8% w/v gel, a solution of 50 mL of 1x TBE Buffer was added to a flask containing
0.4g of agarose. The solution was carefully swirled around to mix the contents and then covered
with clear plastic wrap to be heated in the microwave for 1 minute. Once the solution

Restriction Site Mapping Of Î› Phage Dna
FIFE COLLEGE
Restriction Site Mapping in λ Phage DNA
Daniel Richards
0612924
Table of Contents
Introduction 3
Aims and Objectives 7
Methods 8
Results 13
Discussion 14
Sources of Error 15
Conclusion 16
References 17
Introduction
Lambda phage, also known as enterobacteria phage λ, is a bacteriophage that infects Escherichia
coli. The lambda phage has the capability to reside in the genome of its host through lysogeny or to
enter a lytic phase, during which it lyses the cell to produce offspring.[1] The phage consists of a
capsid, a tail and tail fibres with the head containing the phage 's double–strand linear DNA genome.
The genome contains 48,490 base pairs with 12–base single strand segments at both 5 ' ends.
However the cos site circularizes the DNA in the host cytoplasm, therefore in its circular form is
48,502 base pairs in length. The lytic cycle is the life cycle that more commonly occurs after most
infections. It begins with the attachment of the phage to the host cell allowing it to inject its DNA
into the cell. Following this nucleic acid from the phage is replicated causing the phage 's genes to
be expressed which allows for the production of phage proteins. These proteins are then assembled
into phage particles which are released when the cell undergoes lysis. This lysis is mediated by
genes S, R, Rz and Rz, these genes are shown in the diagram below, which work together to break
down the cell wall of the host bacterium. Whilst this mode of

Immigration Restrictions
I currently stand as the President's immigration advisor. He has come to me because many American
individuals are concerned with the current state of immigration and he is worried he will lose a large
number of voters if he does not make a statement on the issue soon. It is my job to inform the
president objectively on immigration and let him know whether immigration restrictions should be
imposed, or if immigration policies should stay the same or be loosened. The future of American
immigration is counting on me. In American history, immigration started as when immigrants to
leave their homeland for the reason that diseases, lack opportunities, and given freedom so forth.
Throughout the decades, immigration has been thought of as somewhat ... Show more content on
Helpwriting.net ...
In the Declaration of Independence stated that, "We hold these truths to be self–evident, that all men
are created equal, that they are endowed by their Creator with certain unalienable Rights, that
among these are Life, Liberty and the pursuit of Happiness" which means immigrants deserves to
same opportunities and equality as Americans. Thus, it would go against our nation's principles and
the United States Constitution. All in all, it affects.
Some people may argue that immigrants take jobs away from U.S. Citizens but truly it does not. The
reason for this is because most Americans would not want to obtain a job that is minimum wage. As
oppose, immigrants who especially come to the United States are more willing to work under worse
conditions and lower wages. All in all, imposing more restrictions on immigrants would be an
abysmal idea that specifically immigrants who work in America are trying to have better lives.
Therefore, the obvious conclusion is immigration should not be restricted because it goes against the
Declaration of Independence and contributes to our nation's economy for numerous

Antibody Binding of Antigens
############################## Part 1 #################################3 Antibody
binding of antigens represents a critical part of the adaptive immune system's ability to identify and
eliminate invading pathogens. The antibodies are able to do so due to the binding of their antigen–
binding domains to specific epitopes along an antigen's surface. These epitopes can exist in linear,
structural, and posttranslationally modified forms that vary between pathogens. The characterization
of these epitopes is important because they can provide potential targets for vaccines. Thus, study of
the interaction between antibody and epitope is needed. This will require the production of
antibodies to test against a wide array of antigens; however, since the binding of epitopes is the main
focus, only the Fab region of the antibody is required because it contains the antigen–binding region
(Murphy 2011). Therefore, we seek to describe how to clone just the Fab fragments, characterize
their functionality for binding, and map the epitopes they bind. In order to clone just the Fab
fragments of antibodies, specific primers are required to direct cloning of the portions of the
antibody heavy and light chains that coincide with the Fab region; however, before primers can be
designed for such an experiment, it is important to have the DNA, or in this case cDNA, that is to be
cloned. This

Plasmid Lab Report
Introduction In this investigation pUC19 plasmids were used as the vector due to its small size of
2686bp, high uptake efficiency by the host and fast replication time. Important features of this
plasmid include the origin of replication and multiple cloning sites (MCS). The origin of replication
allows the plasmid to replicate inside the host bacterium. The MCS is located within the lacZ gene
and contains unique sites for the Xbal & EcoRI restirction enzymes to cut and produce sticky ends
for the CIH–1 gene to bind to. Furthermore, the pUC19 plasmid also contains an ampiccilin
resistance gene so only transforemed E.coli are able to remain viable when spread on the agar plates
that also has the addition of ampiccilin. The lacZ gene encodes the β–galactosidase enzyme which
aids in indentifying the recombinant E.coli from the non recombinant cells (Coventry University
2016). The addition of 5–bromo–4–chloro–3–indoyl–β–thiogalactoside (X–gal) in the agar mix acts
as an artifical substrate for the enzyme so it produces blue E.coli colonies when hydrolised by the β–
galactosidase meaning those specific colonies do not contain the plasmid with the CIH–1 insert (non
recombinant E.coli) (Coventry University 2016). Isopropyl–β–D–thiogalactoside (IPTG) an artifical
transcription inducer of the lacZ gene is also added into the agar mix, binding to the repressor gene
and inactivating it. Therefore when the CIH–1 gene is incorporated within the plasmid MCS and
inserted into the E.coli

1.3.1 response Essay
Activity 1.3.1: Student Response Sheet
PART A– Restriction Enzymes
Restriction enzymes are a tool that allows us to pinpoint human identity down to single differences
in our DNA. Work through the following simulation so you can see these molecular scissors in
action.
Find out more about restriction enzymes by viewing the animation and reading the article listed
below.
DolanDNALearningCenter: Restriction Enzymes
http://www.dnalc.org/ddnalc/resources/restriction.html
Access Excellence Classic Collection: Restriction Enzymes Background Paper
http://www.accessexcellence.org/AE/AEC/CC/restriction.php
1. From what organism are restriction enzymes derived? What role do these enzymes play in this
natural host?Phages. Enzymes ... Show more content on Helpwriting.net ...
Beneath each strand indicate the number of fragments that would be created and also the size of
each fragment (in base pairs). Some of the pieces will have bases overhanging the edge. Use only
the bases that are paired up when completing your count. For example, for a piece that looks like
ATTCAACCC
GTTGGGAA
the size of the fragment would be listed as 6 base pairs (6bp).
Person 1:
GGAATTAAGCTTATTG–AATTCTTATAG–AATTCGGGGCCCAAGCTTATG–AATTCAATT
CCTTAATTCGAATAACTTAA–GAATATCTTAA–GCCCCGGGTTCGAATACTTAA–GTTAA
Number of restriction fragments (pieces of DNA after digestion): ___4
Size of restriction fragments (in bp) – listed from largest to smallest
16;7;17;5
______________________________________________________________________

Person 2:
CCATATAG–AATTCAAGCTTAAG–AATTCGGGGGAACGTTG–AATTCAATTAATTGGG
GGTATATCTTAA–GTTCGAATTCTTAA–GCCCCCTTGCAACTTAA–GTTAATTAACCC
Number of restriction fragments (pieces of DNA after digestion): ___4______
Size of restriction fragments (in bp) – listed from largest to smallest
________8;10;13;12______________________________________________________________
PART B: Gel Electrophoresis of Restriction Fragments
After you have reviewed the principles of electrophoresis, use what you know to complete the
following:
–
+
2. Place a large"+" on the end of the gel diagram where the positive electrode would go. Place a
large

Methods Of Restriction Mapping Site Essay
Discussion
In this experiment two methods of restriction mapping site were used i.e. double digestion method
and the comparison of fragment pattern to a known sequence. In the double digestion method, the
fragments produced by the enzyme Hind III andXhoI independently and concurrently were
compared so that it can produce an estimation of relative postion of cleavage site
The drawback of restriction mapping is that the technique cannot be directly used for eukaroyotes
because of difficulties associated with inheritance
With the help of restriction endonucleases
In tube A only lamda DNA was added, as there was no restriction endonucleases added, it would not
be able to recognise the specific sequence of bases within within the genome and would not be able
to break the covalent bond in the sugar–pjosphate backbone at particular with or near the sequence,
therefore no restriction fragment will be generated.
In tube B , Hind III restriction enzymes was added ,as Hind III is homodemeric protein it will be
able to locate the palindromic sequence of restriction site 5'...AAGCTT...'3 in lamda DNA, which
will then allow the restriction endonuclease HindIII to chop between adenine nucleotide and the
sugar phosphate. Thus, generating number of sticky ends restriction fragments as seen on the image
above.
As conspicuous from the image of gel electropherisis tube B, different fragments has different
migration rates, this is because DNA has phosphate group and it is

Lsc Restrictions
Since 1974 the Legal Services Corporation has worked to ensure access to legal assistance for low–
income persons, and safeguard America's fundamental value of equal justice under the law. As the
costs of legal services continue to rise and the justice gap–– wherein 80 percent of the civil legal
need of low–income Americans goes unmet–– continues to widen, LSC remains the single largest
funder of civil legal aid in the nation. Nevertheless, since 1981 the Heritage Foundation has called
for the elimination of LSC in their Mandate for Leadership book series affirming the following
arguments:
LSC violates restrictions set in the annual appropriations language which prohibits political
participation and involvement
Legal services would work more effectively if handled by local and state governments
Access to equal justice is not a responsibility of the federal government
This paper will briefly disprove each argument set out by the Heritage Foundation, who has not
released original research on LSC in twenty years, and further affirm the federal government's
responsibility to fund civil ... Show more content on Helpwriting.net ...
LSC funds are distributed systemically among states based on the number of individuals living
below the poverty line of each service area. While there are some restrictions on how grantees can
use these funds, as independent organizations they have considerable freedom to determine the
specific needs of their service areas and how exactly to address them. Grantees are in close, direct
contact with the populations they serve and in many cases LSC funds merely allow them to perform
daily functions to the greatest impact. LSC funds provide a flexibility not often allowed in the use of
state and private funds (which are often tied to specific projects), and they are vital to the efficient
execution of legal service

Ap Bio Lab Report
The first agarose gel provided insight into whether or not Zassy's genomic DNA had been cut by the
Sal I HF (NEB) restriction enzyme. As seen in Figure 1, Zassy's cut DNA, in lane 3 left clear
fragments between the 3 kb and 0.5 kb areas. Zassy's uncut DNA, in lane 2, left a clear and bright
band above the 10 kb marker. Therefore, the gel confirmed that Zassy's DNA was successfully cut
with Sal I because there was a significant difference the cut and uncut DNA that was run through the
gel. There was an additional lane of cut DNA because another student adopted Zassy in the early
stages of this experiment. Nevertheless, the clear distinction between lanes 2 and 3 allowed the
experiment to continue on to purification of the DNA.
In an effort to ... Show more content on Helpwriting.net ...
The fragments that were analyzed by Muck were found to be functional matches to an RNA ligase
and a queuine tRNA–ribosyltransferase (NCBI). Both of these functional matches were to the phage
SamuelLPlaqson (NCBI).
By the end of this experiment, the research objective had been achieved. Zassy was successfully
characterized and analyzed using molecular cloning techniques. According to PhagesDB, there are
55 documented K1 bacteriophages. PhagesDB also shows that a majority of the bacteriophage found
on Gonzaga University's campus have been identified as being part of the K cluster. In addition,
both Urkel and SamuelLPlaqson were found on Gonzaga's campus.
The expenditures needed to sequence Zassy would most likely heavily outweigh the information
gained from sequencing. Therefore, while Zassy could potentially provide insight into the K1 cluster
family, sequencing Zassy's entire genome would be waste of resources. Zassy had a very high
similarity to both Urkel and SamuelLPlaqson, consequently it is unlikely that there is significance
difference between Zassy and other known

The Discovery Of Restriction Enzymes
The discovery of restriction enzymes took place over about a decade and is accredited to biologists
Warner Arber, Hamilton Smith and Daniel Nathans. Although they were not working together
directly, they followed each other's work closely and made invaluable contributions to the discovery
and understanding of restriction enzymes in rapid succession. They were on the verge of a
breakthrough that would revolutionize the analysis and manipulation of genetics, spawning
invaluable technology that is still improving to this day.
In the year 1960 biologist Werner Arber was leading a research team studying the effects of
radiation on microorganisms at the University of Geneva, Switzerland when a startling phenomenon
sidetracked him. He was attempting to infect e Coli with a bacteriophage known as phage lambda
when he observed that the virus was not spreading hardly at all (Arber, 1978). Arbers initial impulse
was that this was an example of host–controlled modification, a phenomenon observed by biologists
Joe Bertani and Jean Weilge seven years earlier. The term generally refers to the non–genetic
modification of a virus by a cell. Knowing what was going on was not sufficient for Arber and he
immediately began searching for the reason why (Arber 1978). During his period of research it was
eventually shown that bacteria have evolved a defense against infectious, viral invaders called
bacteriophages. The defense mechanism was an enzyme he found whose purpose is to degrade or
modify

Restriction Digest
Restriction enzymes are able to cut polypeptide chains at specific sites. Restriction digest is the
process of using several different restriction enzymes to cut DNA into small pieces that can be
sequenced. You are then able to line up the overlap in the different sequences to determine the
complete sequence of the DNA. Restriction enzyme sites are used to make maps of DNA.
Restriction enzymes provide a critical tool for molecular biologist to predictable fragment a given
DNA molecule, which allows them to analyze the structure and features in fine detail.
In the 1960s Stuart Linn and Werner Arber found both modification enzyme and restriction
nucleases in extracts of E. coli strain B. This explained why sometimes when E. coli was transfected
... Show more content on Helpwriting.net ...
An important part of this is which enzymes will work in the same buffer. Using multiple restriction
enzymes is necessary because without multiple enzymes it would impossible to determine the
specific sequence of the DNA strand. Once you have determine which restriction enzymes you want
to use, you will then set up the digest. You will need several 1.5 mL tubes (at least 7 tubes if you are
using 3 enzymes). In each tube you need to add some of your DNA sample. You will then add
different combination of restriction enzymes to each tube. The typical order of combination of
enzymes would be 3 tubes that have one enzyme each, 3 tubes that have 2 enzymes each and one
tube that has all the enzymes. It is necessary to have different combinations of the restriction
enzymes so that you get a better idea of how the enzymes cut in relation to each other. Then you will
add buffer, BSA, and water. Once the tubes are mixed they have to be incubated so that the
restriction enzymes have time to cut the DNA into fragments. After the incubation the tubes of DNA
fragments are ran through a gel electrophoresis, which allows you to visualize the results of the

The Methods Of The Electrophoresis
In Figure 1, the photograph shows how each of our samples ran in the agarose gel. We can see
different bands in different wells, meaning that the enzymes were working and that the plasmid has
been cut in different patters according to the reaction. Before starting measuring the distances and
doing the calculations, it is noticeable that the bands of the ladder were not very well separated.
Therefore, it will not be accurate to rely on those bands to make the standard curve and determine
the sample fragment sizes. The unclear ladder band could be a result of different factors, including
the amount of time the gel was running for, the components of the buffer, the gel concentration or
even the voltage and current conducted. Therefore, we can say that the digestion had worked, since
we are able to see different fragments in the samples, but the electrophoresis was not very successful
as the ladder bands were not separated very well, in addition to their general blurriness. As shown in
Figure 2, and relying on the alternative gel used, the distance traveled by each ladder band was
measured and matched with a specific base pairs number as known, and a standard curve gathering
all these data was generated. The main purpose of making the standard curve is to determine the
equation of the trendline and define a relationship between each distance traveled with a specific
base pairs size to be applied on the rest of the bands. Using X values of the distance measured by
each band in

Creating A Genomic Library Of The Bacteria Aliivibrio...
Bio 219 Sec: 061
Group 3: Karmaker, Bianca; Mandalaywala, Aditi; Naik, Manali; Nanda, Eshan
Introduction
Within a genome, there is a vast sequence of DNA that may be studied. The resulting goal of this
study is to create a genomic library of the bacteria Aliivibrio Fischeri. We will be achieving this
purpose by making Escherichia Coli luminescence through the use of the lux operon. In the process
of understanding the genomic library of A. Fischeri bacteria, we will be creating a restriction map of
the restriction sites in the plasmids containing a lux.
In this study we will be working with a marine symbiont bacteria known as A. Fischeri (Bose et al.,
2008). A. Fischeri is a type of organism that is gram negative and rod–shaped. The term gram
negative bacteria indicates that A. Fischeri consist of an external LPS layer also known as
lipopolysaccharide. This type of bacteria also consist of a single layer cell wall constructed of
peptidoglycan while gram positive bacteria consist of a multi–layered peptidoglycan cell wall. This
organism is found in marine environments and is known to live in symbiosis with numerous other
marine organisms (Bose et al., 2008). A. Fischeri have bioluminescent properties that come from the
organism 's chromosomal DNA. Specifically the lux operon within the chromosomal DNA is what
encodes for bioluminescence. Bioluminescence has taken place in almost all deep sea marine
organisms because it is a mechanism that deals with oxidative stresses.

Restriction Enzymes Lab Report
Restricting digestion in DNA
This is a commonly used technique for molecular cloning and is also used to quickly check the
identity of a plasmid. Restriction enzyme digestion uses naturally occurring enzymes that cleave the
DNA. There are many different restriction enzymes allowing us to target a variety of DNA
sequences. The materials needed include; DNA (the amount you cut depends on your application;
diagnostic digests normally includes 500ng of DNA and molecular cloning often involves 1–3μg of
DNA. The total reaction volume usually varies from 10–50μL yet depends on the application and by
the volume of DNA to be cut). Restriction Enzyme (depends on what DNA sequence is used and
where you want it to be cut). Reaction buffer BSA (not always needed) dH2O up to the total volume
The method/ protocol has 6 steps these go as followed;
Select the restriction enzymes you will be using to digest your plasmid. To determine which
restricted enzyme will cut your DNA sequence and where they will cut the sequence, you must use a
sequence analysis program.
You must determine the appropriate reaction buffer, you will be able to find this out by reading the
instructions for the enzyme you are using.
In a 1.5mL tube combine all the materials (stated above). A normal digestion restriction will include
1μg DNA, 1μL of each ... Show more content on Helpwriting.net ...
fingerprints). The key to understanding PCR is to know that every human, animal, plant, parasite,
bacterium and virus contains genetic material such as DNA (or RNA) that are unique to their species
and to the individual member of that species. If a sample contains segments of DNA or RNA, PCR
can be used to amplify and make many more identical copies of these unique sequences so they can
then be used to determine the identity of the source (a specific

Restrictions In Hodgkiss
Content–neutral restrictions must be narrowly tailored to advance a significant government interest,
but the restrictions must also leave open ample alternative channels for communication. Ward, 491
U.S. at 791. Therefore, a restriction may be narrowly tailored to advance a significant government
interest, but only if other alternative channels for communication are available. Id. This Court's
opinion in Hodgkiss provides insight into the alternative channels analysis. In Hodgkiss, the
ordinance forbade all attachments of notices, posters, and signs to public structures. State v.
Hodgkiss, 132 N.H. 376, 384 (1989). This Court found the ordinance was not overbroad because the
government had a significant interest in remedying the visual pollution

Usage Of Restriction Enzymes Of Dna Fingerprinting
Usage of Restriction Enzymes in DNA Fingerprinting Analysis
Jaclyn Napoli
October 30, 2014
Cellular Processes Lab
BSC 2010L.905
Lab Partner: Jessi Grillo
Material and Methods
To start off the experiment, 4 microtest tubes were labeled reaction tube 1 through 4. Using a
micropipette, 10 microliters, ul, of Enzyme Reaction Buffer was dispensed into each of the 4 labeled
reaction tubes. In reaction tubes 1 and 2, 15 ul of suspect 1's DNA was added. Reaction tube 1 had
15 ul of Enzyme 1 added to it, and reaction tube 2 had 15 ul of Enzyme 2 added to it. 15 ul of
suspect 2's DNA as added to reaction tubes 3 and 4. In reaction tube 3, 15 ul of Enzyme 1 was
added. Then, in reaction tube 4, 15 ul of Enzyme 2 was added. Finally, 2 more microtest tubes were
labeled as crime scene samples. The samples contained DNA from the crime scene and each the
tubes had either Enzyme 1 or Enzyme 2 added to it. The microtest tubes were then capped and
tapped lightly to allow the ingredients to mix. The reaction tubes were submerged in a 37°C, ice
water, for 45 minutes. Once complete, 5 ul of 10x gel loading solution was added to all 6 of the
microtest tubes. Refer to Table 1 for a quick overview.
Table 1 Summary for Restriction Enzyme Digestion Process. While the tubes were being cooled, a
casting gel was made. The cast was made by combining 0.5 grams, g, of agarose and 50 milliliters,
ml, of TBE buffer into a 250 ml flask. The TA added ethidium bromide to the solution to allow

Hunting Restrictions
If you are an avid gamesmen, you will enjoy participating in a guided hunt. Known as an outfitter, a
hired hunting guide who is knowledgeable about the region and the types of game to hunt. Outfitters
know all the hunting laws, rules and regulations for hunting any specific type of game, plus are up to
date on all hunting restrictions.
Hiring a good outfitter is very important to the success of your hunt. The right guide can provide
you with a memorable hunting experience, but a bad outfitter can present you with more problems
than they are worth. Here are some good pointers to use when searching for the best outfitter to lead
you on your guided hunt.
Set a Plan
The first thing to consider is to never schedule your guided hunt on an impulse. ... Show more
content on Helpwriting.net ...
Best advice is to keep a notebook for your trip. In it you can not only have a page of outfitter names,
marking off some as you go when you uncover unappealing information, plus a section for questions
to ask.
Be extensive with your question list. If you are not an accomplished hunter, then any guide you
speak with should show you patience and consideration by answering any question, no matter how
silly it might seem. When an outfitter seems reluctant to answer your questions, or begins to show
impatience with you, that's a red flag to cross that individual off your list.
So, if you're planning a hunting excursion that you want to be as enjoyable as possible, plus be
successful, consider booking a guided hunt. Selecting the best outfitter for your hunt can be the
difference–maker between a good hunt, and a bad one. Follow the suggestions covered here and
you'll stand an excellent chance of hiring out a successful

Restriction Enzyme Digestion Lab Report
Materials and Methods
Restriction Enzyme Digestion – The experiment was begun after putting on gloves to avoid any
chemical contact with the skin. Four microtest tubes were obtained, and each of them was labeled to
contain the different enzymes or suspect DNA. Two of the microtest tubes were used for suspect one
and the two different restriction enzymes, while two other microtest tubes were labeled for suspect
two and the two restriction enzymes. After labeling the tubes, the contents that were at the bottom
were taken out by slightly tapping them. Then to begin setting up the enzyme reactions, a
micropipette was used to obtain 10 μL of the reaction buffer which was added to each of the four
test tubes. The buffer is important because it carries the electrical current from the power supply in
the gel. After the reaction buffer was in each, the microtest tubes were individually filled with their
specific enzymes and DNA, shown in summary through Table 1.1 below. The restriction enzymes
are used to cleave the DNA at specific ... Show more content on Helpwriting.net ...
The use of gel electrophoresis to separate DNA fragments by size and charge can be used in genetic
testing, like paternity or maternity tests. This method could allow the DNA of the child to be
accurately compared with the DNA fragments and banding patterns of one of the parents. This can
allow one to determine the biological parents of a child. Another important use of DNA
fingerprinting is the diagnosis of many inherited diseases. The DNA fingerprint of a person can
allow doctors to determine if they carry an inherited disease through comparison of the band
patterns, and if they are diagnosed, a treatment for the disease can be provided early on. DNA
fingerprinting is extremely useful and essential in the improvement of lives through the medical
field, as well as its other uses in solving crimes and cases of biological

Restrictions On Technology
Should Children have Restrictions on Technology? With all of the technological advances and
improvements that we see each and every year, it is no wonder that technology has become as
popular as it is. From phones and computers to game consuls that can follow your movement, it is
becoming more and more popular with each new generation. But between the big fancy OLED
screens or the fancy gadgets that give us little personal assistants, what good is it actually doing for
us? Or even for our children? If we take a step back and look at the world from a different
perspective what would we see? 20 years ago we would see people interacting with each other.
Neighborhood kids playing soccer in the street, old friends meeting up once a week for ... Show
more content on Helpwriting.net ...
Too much of something is never good. Some would say that children should have restrictions on
technology to give them their best chance at having great social skills, good brain development and
their chance at just being a kid in the real world. When a child stares at a tablet, computer or even a
TV it slows down their development. In 2013, The Millennium Cohort Study, a long–term study
group in Britain, did a study on 19,000 children born in 2000 and 2001
(http://www.cls.ioe.ac.uk/page.aspx?sitesectionid=851) and found that those who watched three
hours or more of movies, television and video games per day are more likely to conduct problems,
emotional symptoms and related problems by the time they were 7. This is when we start to realize
that there are three main problems with allowing kids to have access to excessive amounts of
technology. Children start to lack personal interaction with others, the lack of imagination, and last
but not least is the lack of time for soothing busy brains. Developing personal interaction with
others, such as communication and social skills, at a young age is key. As a child, it is easy to get
away with not having to socialize or communicate because your parents will do it for you. As an
adult though, everywhere you go you will likely communicate with someone. Most jobs need
communication skills and some social skills. When I talk about communication and social skills I'm
not just talking about being Mrs. Social, friendly to

Fluid Restrictions
One intervention that is commonly associated with edema patients is a fluid restriction. The
rationale behind a fluid restriction is to decrease fluid intake, hence decreasing fluid volume excess
and the subsequent weight gain (Simon, 2014). The patient was placed on a 1.2L fluid restriction,
which included tea and liquid foods such as custard. However once placing the patient on the fluid
restriction, she found it difficult to cope and she was constantly thirsty. The sensation of the patient
constantly feeling thirsty was a result of low cardiac output and increased activation of
neurohormonal systems of the renin–angiotensin–aldosterone system that stimulates the thirst centre
in the hypothalamus. Secondly, the diuretic therapy of furosemide

Restriction Enzyme Mapping Of A Plasmid
BCH30003– Advanced Biochemistry LAB#1
Name: Tanbeer Kaur
Partner: Jamila N
Due date: 27/03/2015
Restriction Enzyme mapping of a plasmid
Aim
To isolate cloned recombinant plasmid pAB2 from a bacterium culture known as E. coli, the
plasmid contained a virus called baculovirus and an enzyme called restriction endonuclease was
used to cut the circular plasmid DNA. The enzyme was used to determine which fragment was
cloned from the baculovirus. The aim is to remove the plasmid pAB2 from E. coli and correlate the
enzyme restriction endonuclease for cutting of the circular plasmid DNA, therefore this gives the
ability to determine which fragment has been cloned.
Introduction:
Recombinant plasmid pAB2 was isolated from a culture of E. coli, this contained an insert of
baculovirus. The restriction enzyme called restriction endonuclease was used to cut the circular
plasmid DNA, allowing us to identify which fragment has successfully been cloned from the insert
of baculovirus. The agarose gel electrophoresis was performed using Gelled in order to utilize the
DNA in gel, this binds to the DNA and fluoresces under UV light.
The restriction enzymes are known to belong to a wide class of enzymes which are classified as
nucleases. There are exonnucleases and endonucleases, the endonucleases are also known as
restriction enzymes which cut the DNA molecules at a certain point by recognition of 6 base pair
sequence. DNA cloning depends on the restriction enzyme digest to allow the DNA to

Pregnancy Restrictions
Other restrictions
During the time of pregnancy, they never allow a woman to visit the temples of gods and goddesses
who are believed to be malevolent in nature. She is only allowed to go in front of the gods and
goddesses who are benevolent in nature. They believe that if the pregnant woman worships the
deities who are revered as peaceful, the child would get the same qualities. In their society, a
pregnant woman is strictly prohibited to go even nearer to the graveyard as it might cause
miscarriage. She is also restricted to go alone outside during night. If there is a dire need to go, she
is to keep a piece of iron with her for protection from the evils spirits. She always avoids foods and
other materials from outsiders during the ... Show more content on Helpwriting.net ...
These days a woman should sleep in straight position. If she disobeys the restrictions it will causes
bad affects on the newborn baby's physical structure. The new born baby might be a deaf, one–eyed,
ugly, blind, nose–clipt, dump, lamp, born–blind, squint–eyed etc after born. 1.7. Sleeping habits
After five month, a pregnant woman is restricted to sleep keeping the face upward. The experienced
women teach her how to sleep in one–sided manner, which gives more relaxation to the child in the
womb and the mother feels comfort in such sleeping posture. 1.8. Bathing
During pregnancy, a pregnant woman never forgets to take bath because it is believed that bathing
helps to keep the baby cool in womb and mother's body as well. However, she does not have any
fixed time to take bath in the daytime but she should not take bath after sunset because it is too cold
for the mother and is not good for both mother and child.
1.9. Hygiene and sanitation facilities for the pregnant women
They do not take any special care for the pregnant women in relation to hygiene and sanitation. Like
normal people, a pregnant woman also drinks water from the tube–well, open–well and river. A
pregnant woman also uses same open field for latrine and toilet and takes bath in the nearest river.
However, after sunset her husband escorts her if she is to go outside for toilet to the

Restriction In Texas
In Texas, there are many laws that place restrictions on the challenge of abortion. According to the
Oxford Dictionary, abortion is defined as "the deliberate termination of a human pregnancy, most
often performed during the first 28 weeks of pregnancy." Currently, with the Texas Senate Bill 5
declaring unconstitutional, there are fewer rules on abortion. However, many women cannot have
abortions due to procedural and procedural restrictions.
Abortion has occurred throughout history, dating since 1550 B.C. with written evidence of the
cessation of the Greeks, Egyptians, Romans, Cambodians, and many others countries in the modern
world, according to Wikipedia, the History of Abortion. Some methods of abortion include hard
labor and herbal medicine. ... Show more content on Helpwriting.net ...
Beginning in the mid–nineteenth century, illegal abortion efforts differed between states. Medical
procedures at this time are very dangerous and high mortality. Texas and many other states have a
legal illicit abortion except for maternity life–threatening (History of abortion). In 1973, the case of
the Supreme Court, Roe vs. Wade, concludes that it is the mother's choice when it comes to children
and abortion has been legalized nationally. After Roe vs. Wade, there were a lot of riots and even
hospital bombings (History of abortion). Then, in 1977, Hyde passed, prohibiting low–income
mothers from paying for abortion with Medicaid unless their lives are in danger; they are raped, or
pregnant as a result of the incest. By the end of 1991, a law was passed that prohibited doctors and
councils in federal–sponsored clinics to advise or refer patients to abortion (history of abortion). A
year later, the Supreme Court case, the Pennsylvania Parenthood Casey's Pennsylvania Parenthood
Plan, allowed states to impose restrictions on abortion, as long as the restrictions did not place an
"excessive burden" for women (history of

Vibrio Fischeri Is A Bacterium That Served As The Model...
Vibrio fischeri is a Gram–negative bacterium that served as the model organism in this experiment.
We isolated only the luxAB portion of the entire lux operon and inserted it into the pGEM vector
plasmid to transcribe the luciferase enzyme required for bioluminescence. Within the lux operon,
luxAB is responsible for producing subunits that form luciferase, which oxidizes the aldehyde made
by luxCDE into the reduced flavin–mononucleotide FMNH2 and results in the production of light
known as bioluminescence[6]. The luxI gene that is also present on the operon produces the
"autoinducer which interacts with a regulator, LuxR, [and] activates transcription of the lux operon
at high–cell density" to induce bioluminescence[4]. This interaction between the products of luxI
and luxR is known as quorum sensing and serves as an evolutionary purpose in the symbiotic
relationship with Euprymna scolopes, a type of squid that contains the light organ where the bacteria
resides[6].
In the first portion of the experiment, Vibrio fischeri chromosomal DNA was isolated by lysing the
bacterial membranes and removing the proteins and lipids. Addition of a lysozyme solution breaks
down the peptidoglycan layer in Gram–negative bacteria and proteinase K/SDS degrades the
proteins and disrupt the membranes. Liquid–liquid extraction using Tris–buffered phenol permits
separation of proteins and lipids from the DNA into the organic layer. It is also essential that the
isolated DNA is pure and free of

Sublease Restrictions
California property owners and developers should be well aware of the requirements in place for
real estate tenants and rental repairs. There are sublease restrictions, prohibitions on key money,
prohibitions against rent control, regulations on the use of eviction notices, etc.
Sublease Restrictions:
Any commercial lease that requires a tenant obtain approval from the landlord before they sublet the
property, or rent the another individual or family for the duration of their agreed upon lease, carries
the implication that the landlord cannot withhold consent to sublease without a valid reason.
According to Section 1995.260 of the California Civil Code places the burden of proving the
landlord is acting unreasonably regarding a refusal to approve a sublease request on the commercial
tenant. Any tenant who requests that their landlord explain their refusal in writing may be allowed to
use the landlord's failure to respond in writing as proof that the landlord was in violation of the law.
No Key Money:
"Key Money" is a phrase that is used to denote bribes and other similar forms of under the table
payments to landlords in exchange for renting a property. Landlords and their representatives are
prohibited from accepting or requiring "key money" from commercial tenants or prospective
commercial tenants as a condition to ... Show more content on Helpwriting.net ...
This activity is prohibited by California law (in relation to commercial real estate). According to
Section 1954.25 of the California Civil Code, commercial rent control would not encourage a
competitive environment for businesses and could provide one business with an unfair advantage
over another. Under Section 1954.27 of the California Civil Code, public entities are not allowed to
enact or enforce any form of commercial rent control. Commercial landlords are allowed to enter
into a capped rental agreement with public agencies

Age Restrictions
When determining the age of responsibility we come across instances where the age restrictions
don't necessarily apply to all people or just don't make sense. Instances where the age restrictions
could be doing more harm than good. Your age does not show your previous experiences with
certain situations, so why does it determine so much of your life? Sure, age can determine many
things correctly and be useful in some cases, but it sometimes it is wrong to assume that someone
can't be responsible or mature enough to do a certain activity or to have a certain right that others
with probably a lower level of maturity can just becuase they are older. Justin McNaull, who works
for his local police force in Virginia, was twenty– three when he wanted ... Show more content on
Helpwriting.net ...
If the age restriction is causing more problems than it would if it were to be lowered or raised, we
should do something about it to change or improve it. One example would be when Illinois state
Representative, John D'amico, introduced legislation to raise the driving age in his state from
sixteen years old to eighteen. " I couldn't get Southern Illinois to agree to it" D'amico said. Instead
he proposed a Graduated Driver's License which caused an immediate impact, dropping the number
of adolescents who got in car crashes. In 2007 in Illinois, 155 adolescents died in automobile
accidents. In 2008, that number dropped to 92 adolescents. (Greenblatt 26) This situation shows a
perfect example of where raising the age restriction would not have helped but neither could have
leaving the set age alone. D'amico and the government saw the problem and decided to do
something appropriate to help better the

Restriction Enzyme Lab Report
A restriction enzyme is enzymes that cut a DNA molecule at a particular place or a restriction site.
The recognition site is specific sequence of nucleotide bases, which are about four to eight base
pairs of length. The aim of this experiment was to find out which out of the two specimen had DNA
that matched those found at the crime scene. The results of this experiment can be used to indicate
who was at the crime scene. We used the P20 micropipette to put the ingredients of the crime scene
to setup up the procedure. They included the reaction buffer which kept neutral when putting them
in the tubes, then DNA of each suspect put in their individual tubes. The enzymes were then added
to the tubes. We then waited for the mixtures to get frozen ... Show more content on Helpwriting.net
...
For example if a guy finds out that his ex–girlfriend has his child he can have a paternity test done to
make sure he is the father and will give him his answers. It can also be used to validate human
remains if they don't know who is the remains belong to. For example, if they find bones or teeth,
they can do DNA testing and compare with other people in their family to see if it is a match. There
was an accident with a Mexican pop star name Jenni Rivera in a plane crash. They had to use DNA
testing to make sure that the body was her body since her body was now in parts. DNA is useful for
it can solve crimes and help people know who their parents

Restriction Digest Involves The Uses Of Restriction Enzymes
Restriction Analysis
Hayley Keller
Biochemistry Laboratory: BIOL 2324
TA: Manasa Madasu
Date Performed: July 14th, 2015
Date Due: July 21st, 2015 Introduction:
Restriction digest involves the use of restriction enzymes (also known as restriction endonucleases)
to locate specific base pair sequences in DNA. These enzymes cut, or cleave, DNA only at their
designated sequence, which is referred to as a recognition sequence. While there are four different
types of restriction enzymes (1), the only type that was worked with in the following experiment
were type II restriction enzymes (2). These enzymes have recognition sites that are mostly
palindromic and usually consist of around four to eight base pairs. They also require only
magnesium (Mg2+) as a cofactor to operate. Cofactors are molecules that bind to enzymes in order
to activate them (3). Additionally, they cut DNA only at, or very near to, their specified restriction
site, unlike other types, which cleave at various distances from their recognition site (1). The
restriction enzymes that will be used in following experiment are Hind III, PVU II, and Bgl I (2).
Hind III recognizes and cuts DNA at the sequence AAGCTT. It is isolated from Haemophilus
influenzae (4), which is a bacteria that is the cause of several diseases, including pneumonia, and
meningitis. (5) When Hind III is used to cleave DNA, the end result will have "sticky ends," which
means that there will be a few unpaired nucleotide bases on each end of

Restrictions On Homeless
Restrictions on Homeless in Fort Lauderdale Florida In the city of Fort Lauderdale, Florida, feeding
the Homeless has made it more difficult for them to survive on their own. The law does not benefit
the homeless in regards to keeping them off the streets, and preventing them from becoming future
criminals. Restrictions on feeding the homeless should be reconsidered because it is not helping
them to survive on their own. One bad mistake or mistakes can leave someone in becoming
homeless. If the government did not want the homeless people on the streets, then they should
decide on a more reasonable solution to prevent homelessness from happening before hand. In order
for a law to work, majority of the population has to benefit from it without

Restrictions In The Bible
LOVING OUR NEIGHBORS MAY MEAN TAKING STEPS TO PROTECT THEM FROM
DANGER
A friend and godly brother whom I respect asked for comment from Christians as to whether
President Trump's executive orders temporarily limiting immigration from certain areas is in
keeping with biblical principle. His view was that these restrictions are in opposition to what we
find in the Bible. Since I often hear it said (or implied) that love for others means it is wrong to be
selective as to whom we allow in the country, I wanted to address this issue and answer my friend's
question. If you're interested, here is my answer:
I'm not sure why you think it's opposite to what is in the Bible. First of all, the restrictions are very
similar to what previous administrations have put in place, including those under ... Show more
content on Helpwriting.net ...
It has happened here in the US with Somalian refugees, and others. So the point of these kinds of
restrictions is to allow time for an assessment of how we are vetting applicants in order to make
whatever changes need to be made to better ensure we are not opening the door for those seeking to
do harm. To me, this seems highly sensible, morally responsible, and commendable. Often we hear
it said that the obligation to "love your neighbor" means that it is wrong to restrict ––even
temporarily (?) –– those who may enter the country. But I would argue the opposite. Love for
neighbor means not recklessly exposing our neighbors to those who may have the intention of
harming them. That is why we have always limited who may enter the country. I would argue that
love for neighbor means not being reckless about exposing them to possible danger, but instead
being careful to protect them from those who might be seeking to harm them. This is not opposite to
what we find in God's word, but precisely what we find in Scripture. Even if people think the policy
is misguided, there is no reason

Pdqs 1-14 How Do Restriction Enzymes Work
Ch 20 PDQs 1–14
How do restriction enzymes work?
After recognizing the restriction sites, the restriction enzymes cut off the DNA strands at these
points, leaving sticky ends on the original DNA fragment. The restriction enzymes can also travel to
other cells to cut off DNA sequences, the sequences that can match the bases of the original
sequence. The sticky end will find other sticky end to form a new recombined DNA sequence,
obeying the law of base–pairing.
Explain the significance of sticky ends and why they were given that name.
To form recombinant DNA, sticky ends are required. With each sticky end having only one strand, it
can form hydrogen bonds with the bases of the complementary sequence. The sticky ends will also
function in ... Show more content on Helpwriting.net ...
How does gel electrophoresis work? What properties of the DNA does it utilize?
Using the electric current, scientists pass the DNA through gel, and as smaller molecules get through
gel quicker than those of bigger sizes, DNA molecules get separated according the sizes of the
molecules. We utilize the property that large molecules move slower, and DNA is slightly negatively
charged(due to phosphate groups), so it will move to the positive pole of the gel.
Where will the smallest fragments of DNA be found on a gel after it runs? Where will the largest
fragments be found? How is the size of a particular fragment determined?
Smallest will be found near the positive pole of the gel, as DNA is moving towards the positive pole,
and small ones move faster. The large fragments will be found near upper half towards the positive
pole, because the bigger size determines its slower speed moving towards the pole. Restriction
fragment analysis, which specifies the DNA sequences, determines the size of the DNA

Gun Restrictions
For many years, the government has been left undecided about the controversies of gun control with
the lingering fact that tighter gun restrictions could threaten the rights of United States citizens.
About 52% of Americans are against stricter gun laws since taking action will not help criminal
record(Mendoza). Others choose to believe that guns are the reason for violence, meanwhile,
abolishing rights will not positively influence this issue because of the Second Amendment and
availability of guns. A majority of the attempts to restrict firearm use have been unsuccessful, such
as the Brady Act and Federal Gun Control Act. The government has not realized that guns remain a
right as a part of the Second Amendment and play an immense role in ... Show more content on
Helpwriting.net ...
In the article, "Pro/Con: Gun Legislation", the author claims, "These numbers, like staggering 30,00
men, women, and children are killed in gun–related deaths each year in the United States, are also
clearly reflected by the studies results"(Bitto). That is to say, gun law supporters believe that many
of the deaths that occur in the US only happen as a result of the ability to obtain a firearm. In fact,
this is false since a massive amount of the petitions for gun–holding are denied each year. Gun
control laws are already so restrictive that if they were to completely disable people from buying
guns, there would be no self–protection. In Matt Doeden's book, "Gun Control: Preventing Violence
or Crushing Constitutional Rights?", he writes, "Senator Rafus King of New York fell into the camp
that supported gun control. In 1790 he argued before the U.S. Senate 'that it was dangerous to put
arms into the hands of the frontier people for their defense, lest they should use them against the
United States"(Doeden 17). In other words, the senator of New York believes that giving people the
opportunity to have a firearm will only lead them to use them against the government. In a realistic
view, most people solely desire a firearm for recreational purposes or self–defense, not to revolt
against this country. As mentioned, most criminals get their guns in

The Restriction Of Abortion
92 percent of all abortions take place in the first trimester. At this point in the pregnancy, the baby's
health depends on the mother to survive. With this said, the baby cannot exist outside of the womb,
therefore it cannot be qualified as a separate entity (Lowen, 2016). If a baby does not qualify as a
separate entity, then it does not have inalienated rights from the Constitution. Hence, abortion is not
murder, and the rights of women should not be restricted. Thus, women deserve to make the
decision to have an abortion, because it is constitutional according to Roe v. Wade, the baby feels no
pain, many cannot financially support a baby, it is a safe procedure, and it empowers women with
regards to their bodies. For that reason, all restrictive ... Show more content on Helpwriting.net ...
Sandra Day O'Conner says "the ability of women to participate equally in the economic and social
life of the nation has been facilitated by their ability to control their reproductive lives" (Hubby,
2016). Women are able to fully participate in society by having a simple choice. Saports, who
participates in the National Abortion Federations explains, "Society benefits when women fully
participate in its society a matter of fairness, equality and human rights" (Hubby, 2016). Abortion
empowers women with a choice that creates a way for them to participate in

Electrophoresis Lab
Analyzing DNA Strands through Electrophoresis Introduction The purpose of the DNA restriction
and electrophoresis lab was to first become familiar with the properties of restriction enzymes and
discover that they, along with agarose gel electrophoresis, are used to characterize DNA molecules.
Restriction enzymes are used to make cuts or join together DNA fragments. The cuts result in either
staggered cleavage, or blunt cleavage. Staggered cleavage results when the breaks are offset. This
cleavage usually results in sticky end being produced because for each DNA end that is produced
there are extensions with unpaired nucleotide bases. Blunt cleavage results when the breaks in the
phosphodiester bonds are right across from each other.
Gel ... Show more content on Helpwriting.net ...
According to data provided in class, the smallest band of Hind III shown on the curve at 2.02 kbp
should have traveled 24 cm. As shown in table a, the band with 2.02 kilo base pairs traveled 20.2
cm. III fragment that contained 23.1 kbp traveled only 7.30mm when it should have traveled 11.0
mm. However, the fragment that had 4.36 kbp should have traveled 18mm when it traveled 19mm.
This shows the enzymes did not cut right where they were supposed to, resulting from not allowing
the fragments to run long enough. An extra half hour or so would have allowed enough time for the
fragments to be cut in the right places. After generating a standard curve shown above in example c,
the EcoR I fragment sizes were estimated. The largest fragment traveled only 6.79mm, and it was
estimated that the fragment was 23.8 kilo base pairs in size. The actual fragment size derived from
the provided restriction map was 21.2 kilo base pairs in size. The second smallest fragment traveled
11.6 mm and it was estimated that the fragment was 6.01 kilo base pairs in length. The actual
fragment was 5.6kpb in size. The majority of the estimated EcoR I fragments were larger than their
actual fragments. This was the result of the Hind III fragments not reaching their end distances in
the gel. Since the standard curve was made from the partially traveled Hind III fragments, the
estimated numbers of EcoR I were off. The creation of a standard curve was a good way to estimate
the DNA fragments sizes, because both the sets of DNA were run at the same time for the same
length of time. If one does not have adequate time to travel as far as it should, neither will the other
sample being run. EcoR I produced fewer bands than predicted by its restriction map because the
smallest band may contain too little DNA to be seen without using a more sensitive dye to
illuminate the

Isolation, Restriction Digestion, And Electrophoresis Of...
Isolation, restriction digestion, and gel electrophoresis of plasmid DNA
Prathyusha Gudapati, BIOL 304, spring 2015.
Abstract
The purpose of the experiment was to isolate plasmid DNA, followed by restriction digestion using
restriction endonucleases and then visualizing the digested fragments after subjecting to gel
electrophoresis. Plasmid DNA (pSP72 DNA) was isolated from Escherichia coli KAM32 (E.coli)
cultures using the QIA prep miniprep kit and then subjected to restriction digestion by EcoRI and
HindIII. The restriction digested DNA was then loaded into the wells of 0.7% agarose gel and
subjected to electrophoresis. It can be concluded from our results that our plasmid DNA isolation
was successful and the restriction digestion results were partially in agreement with our hypothesis.
Introduction
Plasmids are small double stranded circular non chromosomal DNA molecules containing their own
origin of replication. Hence, they are capable of replication independent of the chromosomal DNA
in bacteria. Plasmids present in one or more copies per cell, can carry extra chromosomal DNA from
one cell to another cell and serve as tools to clone and manipulate genes. Plasmids used exclusively
for this purpose are known as vectors. The genes of interest can be inserted into these vector
plasmids creating a recombinant plasmid. Recombinant plasmids can play a significant role in gene
therapy, DNA vaccination, and drug delivery [Rapley, 2000].
We hypothesized that plasmid DNA

Brussels Sprouts
What are your thoughts on Brussels sprouts? Do they taste delicious or bitter? Brussels sprouts
contain a chemical called Phenylthiocarbamide [PTC] which some people recognize as bitter tasting
and others cannot taste, influencing their opinion on the vegetable. The people who can identify the
bitterness are considered to be a taster and therefore most likely have the recessive gene TAS2R38.
However, there are five possible positions within the humans called a single nucleotide
polymorphism (SNP) and three of the five influence bitter taste. Which one are you? To answer this
question we went straight to the lab.
The goal of the first step of the experiment is to isolate DNA from a cheek cell. To collect DNA
from the cheek, the inside of the ... Show more content on Helpwriting.net ...
Though there are other ways that we could identify this particular trait, it was easier and more
beneficial to use a restriction enzyme as it allows us to examine the DNA for a specific sequence of
nucleotides, known as the restriction site. HaeIII cuts the PCR product into two fragments if the
tasting trait is present and leaves the PCR product uncut if the trait is not present. In order to do this,
two groups of amplified DNA are required, one labeled U (for undigested, meaning it didn't receive
HaeIII) and the other labeled as D (for digested, since it had HaeIII). The undigested group served as
the control group so it appeared uncut. We were able to compare this to the digested group which
served as the experimental group, which means that if a person has this gene, then the DNA
sequence will be cut either into two pieces, meaning they're homozygous, or three pieces, meaning
they're heterozygous. Before moving onto part four, the undigested group was iced and the digested
group was be briefly centrifuged, so that the solution could settle at the bottom of the tube. After
centrifuging the digested group, we placed it in a 37° C water bath for 30–60 minutes (30 being the
min. and 60 being the max.) After, the digested group was removed from the water bath and placed
on ice until part

Essay About Biology Lab

Recommended

Recommended

More Related Content

Similar to Essay About Biology Lab

Similar to Essay About Biology Lab (10)

More from Jamie Boyd

More from Jamie Boyd (20)

Recently uploaded

Recently uploaded (20)

Essay About Biology Lab