kasp based snp genotyping

1. SNP genotyping (KASP genotyping)
SHIVENDRA KUMAR
Admission no : 1903308003
Class presentation
College Of Basic Science And Humanities
Ph.D (Agri Biotech)
2019

2. Objectives
INTRODUCTION
Materials
Experiments
Contents

3. INTRODUCTION
2. SNP (snips pronounce) creating trait modification
3. Reason of SNP natural and also by mutagen
4. Each variation in case of SNP is 1% out of population
5. It’s a codominant , reproducible and sequence specific marker
1. Single Nucleotide Polymorphism is due to point mutation

5. SNP genotyping platform
•KASP genotyping

6. KASP genotyping
Kompetitive allele specific PCR = KASP
•What is KASP genotyping ?
It is a homogenous, fluorescence-based genotyping and variant of PCR reaction. It is based
on allele-specific oligo-extension and fluorescence resonance energy transfer (fret) for signal
generation.
A bit of smaller number of SNPs, analysis, a uniplex assay like KASP can be used.

7. KASP genotyping
C-TAB based DNA isolation of more
than 400ng/micro lit acceptable

10. KASP GENOTYPING EXPLAINING

11. Material and Method
Material
1. Stripe rust resistant Wheat-Ae.geniculata introgression lines (IL) T598
(TA5601), IL T756 (TA5602) and susceptible cultivar WL711 NN=Non-
Necrotic) were used as parental line
2. BC2F4 and BC2F5 population derived from a cross of ILT598 with
WL711(NN)
3. BC2F3 population derived from a cross of ILT598 with ILT756
Case study 1

12. Experiment No. 1
1. Name of the experiment: Mapping of stripe rust resistance genes in
introgression line T598
2. Treatments: DNA had extracted from BC2F4 mapping population
3. Methodology: Some SNP based markers was already available in
SOAB and also new markers comp121307_c0_seq4 were designed
A. DNA extraction (c-TAB based extraction) and
quantification (Nanodrop based quantification)
B. KASP primer designing
C. KASP genotyping assay

13. KASP primer designing
• Primer designing
• Bioinformatics based investigation of R genes sequence

14. 1. KASP 3 linked to the Lr57/Yr40 genes identified by Tiwari et al
2. SNP-based markers linked to Ae. umbellulata originated, Lr76/Yr70 genes
Data unpublished

15. All polymorphic KASP marker with linkage map
Short arm specific reads for development of short arm specific SNPs from Ae.geniculata
Mapping of Short arm specific reads on short arm of 5A, 5B and 5D (Homoeologous
group) chromosome and on Chinese spring wheat cultivar
Resulted 4538 SNPs were found same allele in 5A, 5B and 5D Chromosome and
different alleles in 5Mg
All 4538 SNPs were mapped on arm specific css Chinese spring group of 5 chromosome.
Thereafter 364 SNPs were identified on short arm of 5Mg

16. Selected 5Mg specific SNPs flanking seq followed by blast against 5Mg assemblies
further narrow down
For SNPs in genic region all 364 SNPs aligned against wheat EST (mapped on 5A, 5B and
5D chromosome)
235 SNPs which showed no variation and having 100bps flanking sequence of SNPs 5A
AND 5Mg contigs
135 ordered 5Mg specific SNPs that showed at least 99% similarities over 100bps
sequence were selected
Further all 235 SNPs containing seq were then mapped on deletion bin mapped wheat
ESTs (5A, 5B & 5D)
They were placed in 7 homoeologous deletion bins of chr 5D

17. Using NBS-LRR encoding genes in flow sorted chromosome 5D sequence of pau 16057
and WL711
Only 9 SNP s were selected from region of deletion bin on 5D chromosome
All 666 contigs blast against 5D assembly
Total of 666 contigs having potential NBS-LRR gene sequences
Using software NLR PARSER a potential NBS LRR gene sequence were fetched
Lr76/Yr70 based KASP primer

18. corresponding to POPSEQ bin 33 having tophits they were used for 33 kasp primer
87 from 666 contigs, got best hits on chromosome 5D

19. KASP primer designed
S. No
SNP markers
developed
Non-progenitor involved in
introgression/genome
introgressed on chromosome
5DS
No. of markers
applied to the F2
population
Number of
polymorphic
markers
Polymorphic KASP markers
1
Lr57/Yr40
(Tiwari et al.
2016)
Aegilops geniculata/UUMM 9 1 KASP3
2
Lr76/Yr70
(Bansal et al
2017)
Aegilops umbellulata/UU 33 7
KASP178, KASP71,
KASP119, KASP217,
KASP221, KASP228,
KASP117
Total 41 8
Result

20. KASP genotyping
KASP genotyping protocol
1. KASP mix : 1.994 microliter/sample
2. DNA: 2 microliter/well
3. Primer concentration: 0.546 microliter/sample
S.No PCR Profile Temperature (degree) Time (Minute)
Stage 1 x
10 cycle
Initial denaturation 95 15
Denaturation 95 0:20
Stage 2 x
10cycle
Annealing 65 1:0
Stage 3 x
30 cycle
s
Denaturation 94 0:20
Final elongation 55 1:0

21. KASP molecular mapping of Comp_121307_c0_seq4 on BC2F4 (T598 X WL711) population

22. Bioinformatics analysis
RSEM-Mapping of raw reads with trinity assembly + edgeR (to identify DEGs)
Filtered out R genes (on the basis of up and down regulation)
Found R-genes IDs and their regulations w.r.to 6 time interval
RNA seq data based assembly of IL T598 and WL711 were available in SOAB. Further
proceeded with this data

23. Reconfirmed all 6 R-genes with Gff file ( Annotation file) to cross check their functions
Done URGI BLAST with all the six R-genes with 5DS chromosome
All 6 R- genes IDs were fetched with spade assembly file ( IL T598, WL711)
A candidate gene were selected on the basis of regular variation in FPKM values
Fetched their FPKM value of six candidates identifies on the base of their FPKM VALUES

24. 0
0.5
1
1.5
2
2.5
0HR 12HR 24HR 48HR 72HR 96HR
COMP121307_C0_SEQ4
T598 WL711
Candidate gene comp_121307_c0_seq4

25.  SNP markers have been developed from the candidate gene
comp_121307_c0_seq4 and were mapped on population to observe its segregation
 Real Time PCR had performed on the parental lines to check their level of
expression of the gene in two parental lines after infection of the disease
S.No Primer Sequence
1 Lr57_cds_kasp1_FAM
GAAGGTGACCAAGTTCATGCTTTTTGGACCTgGCATGGAA
TAAGC
2 Lr57_cds_kasp1_HEX
GAAGGTCGGAGTCAACGGATTTTTTGGACCTgGCATGGA
ATAAGT
3 Lr57_cds_kasp1_COM AGATTCCTGAGCCTTGTTACTTCGG
Candidate R gene : Comp_121307_c0_seq4

26. T756
WL711
T598
Result
All total 65 recombinant were selected for reconfirming and further KASP genotyping for all 65
recombinant

27. Graphical genotyping representation of recombinants in BC2F5 population
B represents IL T598 allele amplification in the markers and resistant reaction to stripe
rust. A represents 5D allele amplification and a susceptible reaction to the rust disease,
H is the segregating score for both marker amplification and phenotype

28. Thank you for your patience