•QMWin ?
•Exam
Mini-Summary
•The history of the earth is divided
into geological time periods
• These are defined by characteristic
flora a...
SBC174/SBS110 Week 3
A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils.
C. DNA & learning from DNA.
Why is X? Why does ?
Two types of answer:
Proximate explanations: mechanisms responsible for the trait.
(generally within ...
Some examples
•Why do waxwings migrate South in winter?
•Proximate: a mechanism in their brains senses days are
getting sh...
SBC174/SBS110 Week 3
A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils.
C. DNA & learning from DNA.
Fossils & Fossilization
1. How fossilization works. Some examples of fossils.
2. Dating fossils.
3. What we can learn from...
Geological context
Three broad classes of rock:
•Sedimentary rocks: formed by particles
(mineral or organic) gradually set...
Fossils: only in sedimentary rocks (deposited on oceanic
shorelines, lake beds, flood plains...)
Weathering or erosion can ...
Fossilization
•Two main types:
•Permineralization
• “Natural cast” process
•Fossilization is rare & only in sediment...
•A...
Fossil formation at
Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
...
Fossil preservation
•Hard part like shells, bones and teeth are usually all that remain
•Soft tissues fossils are rare
Why are fossils rare?
•Fossils don’t form often:
•Predators, scavengers, insects consume corpses
•Bacteria and fungi decom...
Recent continental
movements...
TETHYS
SEA
LAURASIA
GONDWANA
EquatorTriassic 200
Mya
Pangaea - single
supercontinent
Why are fossils rare?
•Fossils don’t form often:
•Predators, scavengers, insects consume corpses
•Bacteria and fungi decom...
A few examples...
Aquatic reptile; not a dinosaur. But same time (Mesozoic Era).
A typical fossil skeleton.
Plesiosaur fossil
Parts of head, and anvil/brush
of Akmonistion zangerli, shark
from Carboniferous of
Scotland
More typical…
Belemnites
•very abundant during Mezosoic
Ammonites
http://www.bbc.co.uk/
nature/life/
Ammonite#p00bkt26
Ammonites
Ammonite
Nautilus
Feathers, like soft tissue, are rarely preserved.
But here imprinted in the rock.
Archaeopteryx - late Jurassic (150Mya)
“Fuzzy Raptor” (a dromaeosaur)
The earliest Eutherian Mammal?
Lower Cretaceous of China, 125 Mya
Eomaia scansoria
Ji et al., (2002) Nature
416, 816-822
A...
Leptictidium tobieni
Paleogene (Messel Shales, Germany)
Soft tissues + gut contents are
preserved
Bipedal (extinct) mammal.
Dinosaur footprint
•At the time, this footprint of a dinosaur pressed into soft mud and
became preserved in the now harden...
Fossilized tracks at
Laetoli (Tanzania)
Footprints preserved in
volcanic ash from: 3 hominids
(Australopithecus afarensis)...
Fossil Ichthyosaur giving birth
•Such special preservations can inform us about the reproductive
pattern in this species (...
Fossil Eggs
Information on development and social/reproductive behavior
INSECT IN AMBER
• This mosquito was imbedded in tree sap that subsequently
hardened into amber, preserving the insect with...
Neanderthal skull from
Iraq
(≈50,000 years old)
Very rarely, DNA can
be extracted and
sequenced from such
sub-fossils
Some animals get trapped in ice
Fossils & Fossilization
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?
Dating methods
• Absolute - the item itself is dated
• Relative - strata above (younger) and below (older)
are dated and t...
Principles of
radiometric dating
Dating methods
Stratigraphy
As sediment collects, deeper layers are compacted by the ones
above until they harden and become rock.
Deeper...
Index (Zone) Fossils
•Here, Locality 3 has no layer B (wasn’t formed or eroded).
•Index fossils: diagnostic fossil species...
Fossils & Fossilization
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?
What can we learn?
Fossils can sometimes directly or indirectly tell us a great
deal about the behavior of an organism, or...
Interpreting fossils
•Careful interpretation: helps make sense of fossilized remains
•Analysis of hard parts can tell some...
Hallucigenia sparsa (Cambrian Period)
From the Burgess Shale (Canada). Example of a soft bodied
animal fossil, also very o...
Now re-interpreted as an
Onychophoran ("velvet worm")
© BBC - Life in the Undergrowth
…or do they? (discovered fossilised melanosomes)
Colors don’t fossilize...
Fossils - Summary
• Fossils form in sedimentary rock
• Fossilization is a rare process
• Usually, only the hard parts like...
SBC174/SBS110 Week 3
A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils.
C. DNA & learning from DNA.
DNA in evolution
•Species relationships previously based on:
•bone structures
•morphologies
•development
•behavior
•ecolog...
1. DNA sequences change
DNA mutations occur all the time.
Reasons:
•mistakes in DNA replication or recombination
•mutagens...
Types of mutations
•Small: replacement, insertion, deletion. E.g.:
•Big: inversions, duplications, deletions
original: TGC...
What happens to a mutation?
•Most point mutations are neutral: no effect.
•Some are very deleterious;
See population genet...
2. DNA clarifies evolutionary
relationships between species
Human: GATTACA
Peacock: GATTGCA
Amoeba: GGCTCCA
Human
Peacock
A...
Linnaeus 1735 classification of animals
Molecular clock
•Basic hypothesis: more differences - more time has passed
•Allows relative timing
•Allows “absolute timin...
Carl Woese in 1977
An issue with sequence
phylogenies
•Can be ambiguous if not enough information.
Ambiguities in mutations
ancestral
sequence
species 1. species 2. What happened
•Can be ambiguous if not enough information.
An issue with sequence
phylogenies
•Whole genome sequencing is now dirt cheap...
This changes
everything.454
Illumina
Solid...
Any lab can
sequence
anything!
With enough data...
Artiodactyla
Cetartiodactyla
Cetacea
Cows are more
closely related to
whales than to
horses
Bat echolocation
Teeling 2002
Echolocation
Evolved twice!
Flight
Ancient DNA
Ancient DNA
Hair sequencing
Ancient DNA: below 2km of icecriterion
many pu
abundanc
as is typ
efficiently
low-leve
due to D
Appr
the John
signed to
ti...
Their presence indicates a northern boreal for-
est ecosystem rather than today’s Arctic environ-
ment. The other groups i...
Consensus with fossil record?
Molecular evolution analysis:
•Earliest placental mammals (ie. eutherians)
•body mass >1kg; lifespan >25years
Genomic Evid...
3. DNA sequence clarifies current
relationships
Three-spined stickleback
Gasterosteus aculeatus
Bill Cresko et al; David Kingsley et al
Example 1.
Independent
colonization events
less than 10,000
years ago
in Saltwater:
in Freshwater:
The freshwater populations, despit...
RAD = Restriction-site Associated DNA sequencing
each locus sequenced
5–10 times per fish.
Bill Cresko et al;
The freshwate...
Differentiation between populations (FST)
Saltwater
vs.
Saltwater
Population Genomics i
Freshwater
vs.
Freshwater
Figure 6...
Nine identified regions
• Identified regions include:
• 31 that likely to affect morphology or osmoregulation
• some previou...
Little fire ant Wasmannia
DNA identifies family relationships
Fournier et al 2005
reproduction (that is, by ameiotic parthenogenesis). In 33 of the 34
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabit...
reproduction (that is, by ameiotic parthenogenesis). In 33 of th
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting ...
Species-interactions via DNA
sequencing
Screening mammal
biodiversity using
DNA from leeches
Ida Bærholm Schnell1,2,†,
Phi...
Conservation
DNA: Summary
1. DNA sequences change
2. Past relationships between species
3. Current relationships
http://www.slideshare....
Evolution lectures 5&6  - Week3 - September 2013
Evolution lectures 5&6  - Week3 - September 2013
Evolution lectures 5&6  - Week3 - September 2013
Evolution lectures 5&6  - Week3 - September 2013
Evolution lectures 5&6  - Week3 - September 2013
Evolution lectures 5&6  - Week3 - September 2013
Evolution lectures 5&6  - Week3 - September 2013
Upcoming SlideShare
Loading in …5
×

Evolution lectures 5&6 - Week3 - September 2013

1,974 views
1,850 views

Published on

Queen Mary U London
SBC174/SBS110 Evolution lectures from October 7th.

All images are © their respective owners.

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,974
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
91
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Evolution lectures 5&6 - Week3 - September 2013

  1. 1. •QMWin ? •Exam
  2. 2. Mini-Summary •The history of the earth is divided into geological time periods • These are defined by characteristic flora and fauna •Large-scale changes in biodiversity were triggered by slow and rapid environmental change Pg K -Pg (KT) T r-J P-T r Late D O -S Today
  3. 3. SBC174/SBS110 Week 3 A. Proximate vs Ultimate? B. Fossilization & learning from Fossils. C. DNA & learning from DNA.
  4. 4. Why is X? Why does ? Two types of answer: Proximate explanations: mechanisms responsible for the trait. (generally within the lifetime of an organism) Ultimate explanations: fitness consequences of the trait. (generally over many generations)
  5. 5. Some examples •Why do waxwings migrate South in winter? •Proximate: a mechanism in their brains senses days are getting shorter/colder •Ultimate: Those migrating South have been better at surviving the winter. •Why do human babies cry? •Proximate explanations: cold? hunger? wants attention? high level of a stress hormone? neural signal for pain? •Ultimate: babies that don’t cry when they need help are less likely to survive.
  6. 6. SBC174/SBS110 Week 3 A. Proximate vs Ultimate? B. Fossilization & learning from Fossils. C. DNA & learning from DNA.
  7. 7. Fossils & Fossilization 1. How fossilization works. Some examples of fossils. 2. Dating fossils. 3. What we can learn from fossils? y . wurm {@} qmul . ac .uk
  8. 8. Geological context Three broad classes of rock: •Sedimentary rocks: formed by particles (mineral or organic) gradually settling out of solution, then compacting to form rock •Igneous rocks: formed by the cooling of magma •Metamorphic rocks: modification of existing rocks under high pressure and heat
  9. 9. Fossils: only in sedimentary rocks (deposited on oceanic shorelines, lake beds, flood plains...) Weathering or erosion can expose the older layers
  10. 10. Fossilization •Two main types: •Permineralization • “Natural cast” process •Fossilization is rare & only in sediment... •Ancient material also occurs: •in amber •by mummification •in ice
  11. 11. Fossil formation at Sterkfontein Limestone deposits were laid down 2.5 billion years ago when the area was a shallow sea. Caves eventually form below the surface. ‘Pot holes’ form between the surface and the caves. Debris, including animals, fall in! Compaction and cementing with water and limestone produces “Breccia”.
  12. 12. Fossil preservation •Hard part like shells, bones and teeth are usually all that remain •Soft tissues fossils are rare
  13. 13. Why are fossils rare? •Fossils don’t form often: •Predators, scavengers, insects consume corpses •Bacteria and fungi decompose remains •Even faster in tropics (acid soil, warm, humid...) •Best locations for fossil formation:: •arid deserts, deep water (with low O2)
  14. 14. Recent continental movements... TETHYS SEA LAURASIA GONDWANA EquatorTriassic 200 Mya Pangaea - single supercontinent
  15. 15. Why are fossils rare? •Fossils don’t form often: •Predators, scavengers, insects consume corpses •Bacteria and fungi decompose remains •Even faster in tropics (acid soil, warm, humid...) •Best locations for fossil formation: •arid deserts, deep water (with low O2), cold •Fossils can be lost: •mountains: lots of erosion •Metamorphosis and subduction of rocks destroys fossils •Most are still buried rather than exposed at the surface
  16. 16. A few examples...
  17. 17. Aquatic reptile; not a dinosaur. But same time (Mesozoic Era). A typical fossil skeleton. Plesiosaur fossil
  18. 18. Parts of head, and anvil/brush of Akmonistion zangerli, shark from Carboniferous of Scotland More typical…
  19. 19. Belemnites •very abundant during Mezosoic
  20. 20. Ammonites http://www.bbc.co.uk/ nature/life/ Ammonite#p00bkt26
  21. 21. Ammonites Ammonite Nautilus
  22. 22. Feathers, like soft tissue, are rarely preserved. But here imprinted in the rock. Archaeopteryx - late Jurassic (150Mya)
  23. 23. “Fuzzy Raptor” (a dromaeosaur)
  24. 24. The earliest Eutherian Mammal? Lower Cretaceous of China, 125 Mya Eomaia scansoria Ji et al., (2002) Nature 416, 816-822 A climbing mammal from a lake shore environment
  25. 25. Leptictidium tobieni Paleogene (Messel Shales, Germany) Soft tissues + gut contents are preserved Bipedal (extinct) mammal.
  26. 26. Dinosaur footprint •At the time, this footprint of a dinosaur pressed into soft mud and became preserved in the now hardened rock. Can inform us on locomotion.
  27. 27. Fossilized tracks at Laetoli (Tanzania) Footprints preserved in volcanic ash from: 3 hominids (Australopithecus afarensis) Numerous other mammals
  28. 28. Fossil Ichthyosaur giving birth •Such special preservations can inform us about the reproductive pattern in this species (live birth) .
  29. 29. Fossil Eggs Information on development and social/reproductive behavior
  30. 30. INSECT IN AMBER • This mosquito was imbedded in tree sap that subsequently hardened into amber, preserving the insect within.
  31. 31. Neanderthal skull from Iraq (≈50,000 years old) Very rarely, DNA can be extracted and sequenced from such sub-fossils
  32. 32. Some animals get trapped in ice
  33. 33. Fossils & Fossilization 1. How fossilization happens & some examples. 2. Dating fossils 3. What we can learn from fossils?
  34. 34. Dating methods • Absolute - the item itself is dated • Relative - strata above (younger) and below (older) are dated and the item expressed relative to these Best method depends on context & age.
  35. 35. Principles of radiometric dating
  36. 36. Dating methods
  37. 37. Stratigraphy As sediment collects, deeper layers are compacted by the ones above until they harden and become rock. Deeper Fossils are older than those above. Thus positions within the rock layers gives fossils a chronological age.
  38. 38. Index (Zone) Fossils •Here, Locality 3 has no layer B (wasn’t formed or eroded). •Index fossils: diagnostic fossil species that help dating new finds
  39. 39. Fossils & Fossilization 1. How fossilization happens & some examples. 2. Dating fossils 3. What we can learn from fossils?
  40. 40. What can we learn? Fossils can sometimes directly or indirectly tell us a great deal about the behavior of an organism, or its lifestyle
  41. 41. Interpreting fossils •Careful interpretation: helps make sense of fossilized remains •Analysis of hard parts can tell something about soft anatomy (e.g where muscles are (.e.g muscle scars). •Geology: --> environment (freshwater/marine/swamp)) •Infer from living organisms & relatives.
  42. 42. Hallucigenia sparsa (Cambrian Period) From the Burgess Shale (Canada). Example of a soft bodied animal fossil, also very old!
  43. 43. Now re-interpreted as an Onychophoran ("velvet worm") © BBC - Life in the Undergrowth
  44. 44. …or do they? (discovered fossilised melanosomes) Colors don’t fossilize...
  45. 45. Fossils - Summary • Fossils form in sedimentary rock • Fossilization is a rare process • Usually, only the hard parts like bone, teeth, exoskeletons and shells are preserved • Fossils of different ages occur in different strata, and “index fossils” can be used to cross-reference between different geographic locations •Careful interpretation is required.
  46. 46. SBC174/SBS110 Week 3 A. Proximate vs Ultimate? B. Fossilization & learning from Fossils. C. DNA & learning from DNA.
  47. 47. DNA in evolution •Species relationships previously based on: •bone structures •morphologies •development •behavior •ecological niche •.... 1. DNA sequences change 2. Evolutionary relationships 3.Current evolutionary contexts DNA holds lots of additional information:
  48. 48. 1. DNA sequences change DNA mutations occur all the time. Reasons: •mistakes in DNA replication or recombination •mutagens (radiation, chemicals) •viruses •transposons Inherited: only if in germ line. Not inherited from soma.
  49. 49. Types of mutations •Small: replacement, insertion, deletion. E.g.: •Big: inversions, duplications, deletions original: TGCAGATAGAGAGAGAGAGAGAGCAGAT new : TGCAGATAGAGAGAGAGAGCAGAT Polymerase slippage in satellite original: GATTACAGATTACA new : GATTACATATTACA Point mutation Mutations are the source of genetic, inheritable variation
  50. 50. What happens to a mutation? •Most point mutations are neutral: no effect. •Some are very deleterious; See population genetics lectures & practical •--> selection eliminates or fixes them •--> Genetic drift, hitchhiking... (--> elimination or fixation) Some increase fitness. Eg. antennapedia (hox gene) mutation:
  51. 51. 2. DNA clarifies evolutionary relationships between species Human: GATTACA Peacock: GATTGCA Amoeba: GGCTCCA Human Peacock Amoeba See practical!
  52. 52. Linnaeus 1735 classification of animals
  53. 53. Molecular clock •Basic hypothesis: more differences - more time has passed •Allows relative timing •Allows “absolute timing” •But: •rate of differentiation differs: • between lineages •between contexts • small amounts of data: unreliable Time Geneticchange
  54. 54. Carl Woese in 1977
  55. 55. An issue with sequence phylogenies •Can be ambiguous if not enough information.
  56. 56. Ambiguities in mutations ancestral sequence species 1. species 2. What happened
  57. 57. •Can be ambiguous if not enough information. An issue with sequence phylogenies •Whole genome sequencing is now dirt cheap! No longer a problem! (for establishing relationships in past 200-400 million years...) •Used to be expensive. •Mitochondrial gene vs. nuclear gene. Several genes?
  58. 58. This changes everything.454 Illumina Solid... Any lab can sequence anything!
  59. 59. With enough data...
  60. 60. Artiodactyla Cetartiodactyla Cetacea Cows are more closely related to whales than to horses
  61. 61. Bat echolocation Teeling 2002 Echolocation Evolved twice! Flight
  62. 62. Ancient DNA
  63. 63. Ancient DNA Hair sequencing
  64. 64. Ancient DNA: below 2km of icecriterion many pu abundanc as is typ efficiently low-leve due to D Appr the John signed to tion and the order genus Sa sistent w more tha Arctic en plant div ilar to t which co ceae), pu sales), an by confir Glacier s trol, show ably reco In co sample, t that coul Fig. 1. Sample location and core schematics. (A) Map showing the locations of the Dye 3 (65°11'N, 45°50'W) and GRIP (72°34'N, 37°37'W) drilling sites and the Kap København Formation (82°22'N, REPORTS
  65. 65. Their presence indicates a northern boreal for- est ecosystem rather than today’s Arctic environ- ment. The other groups identified, including Asteraceae, Fabaceae, and Poaceae, are mainly Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice samples. For each taxon (assigned to order, family, or genus level), the genetic markers (rbcL, trnL, or COI), the number of clone sequences supporting the identification, and the probability support (in percentage) are shown. Sequences have been deposited in GenBank under accession numbers EF588917 to EF588969, except for seven sequences less than 50 bp in size that are shown below. Their taxon identifications are indicated by symbols. Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%) JEG sample Rosales rbcL 3 90–99 Malpighiales rbcL trnL 2 5 99–100 99–100 Salicaceae rbcL trnL 2 4 99–100 100 Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91 Dye 3 sample Coniferales rbcL trnL 44 27 97–100 100 Pinaceae* rbcL trnL 20 25 100 100 Picea Pinus† rbcL trnL 20 17 99–100 90–99 Taxaceae‡ rbcL trnL 23 2 91–98 100 Poales§ rbcL trnL 67 17 99–100 97–100 Poaceae§ rbcL trnL 67 13 99–100 100 Asterales rbcL trnL 18 27 90–100 100 Asteraceae rbcL trnL 2 27 91 100 Fabales rbcL trnL 10 3 99–100 99 Fabaceae rbcL trnL 10 3 99–100 99 Fagales rbcL trnL 10 12 95–99 100 Betulaceae rbcL trnL 8 11 93–97 98–100 Alnus rbcL trnL 7 9 91–95 98–100 Lepidoptera COI 12 97–99 *Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. Env_3, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA- TAGGAAGGG. †Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG- GAACAATAATTTTATTTTCTAGAAAAGG. §Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT. surface (m.b.s.)] indicating the depth of the cores and the positions of the Dye 3, GRIP, and JEG samples analyzed for DNA, DNA/amino acid racemization/luminescence (underlined), and 10 Be/36 Cl (italic). The control GRIP samples are not shown. The lengths (in meters) of the silty sections are also shown. 6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org12 Ancient Biomolecules from Deep Ice Cores Reveal a Forested Southern Greenland Eske Willerslev,1 * Enrico Cappellini,2 Wouter Boomsma,3 Rasmus Nielsen,4 Martin B. Hebsgaard,1 Tina B. Brand,1 Michael Hofreiter,5 Michael Bunce,6,7 Hendrik N. Poinar,7 Dorthe Dahl-Jensen,8 Sigfus Johnsen,8 Jørgen Peder Steffensen,8 Ole Bennike,9 Jean-Luc Schwenninger,10 Roger Nathan,10 Simon Armitage,11 Cees-Jan de Hoog,12 Vasily Alfimov,13 Marcus Christl,13 Juerg Beer,14 Raimund Muscheler,15 Joel Barker,16 Martin Sharp,16 Kirsty E. H. Penkman,2 James Haile,17 Pierre Taberlet,18 M. Thomas P. Gilbert,1 Antonella Casoli,19 Elisa Campani,19 Matthew J. Collins2 It is difficult to obtain fossil data from the 10% of Earth’s terrestrial surface that is covered by thick glaciers and ice sheets, and hence, knowledge of the paleoenvironments of these regions has remained limited. We show that DNA and amino acids from buried organisms can be recovered from the basal sections of deep ice cores, enabling reconstructions of past flora and fauna. We show that high-altitude southern Greenland, currently lying below more than 2 kilometers of ice, was inhabited by a diverse array of conifer trees and insects within the past million years. The results provide direct evidence in support of a forested southern Greenland and suggest that many deep ice cores may contain genetic records of paleoenvironments in their basal sections. T he environmental histories of high-latitude regions such as Greenland and Antarctica are poorly understood because much of the fossil evidence is hidden below kilometer- thick ice sheets (1–3). We test the idea that the basal sections of deep ice cores can act as archives for ancient biomolecules. The samples studied come from the basal impurity-rich (silty) ice sections of the 2-km- long Dye 3 core from south-central Greenland (4), the 3-km-long Greenland Ice Core Project (GRIP) core from the summit of the Greenland ice sheet (5), and the Late Holocene John Evans Glacier on Ellesmere Island, Nunavut, northern Canada (Fig. 1). The last-mentioned sample was included as a control to test for potential exotic DNA because the glacier has recently overridden a land surface with a known vegetation cover (6). As an additional test for long-distance atmospheric dispersal of DNA, we included face of the froze control for pote have entered the cracks or during Polymerase chain the plasmid DNA tracts of the outer interior, confirmi had not penetrate Using PCR, w short amplicons the chloroplast D trnL intron from from the Dye 3 a samples. From D amplicons of inv subunit I (COI) m Attempts to repr the GRIP silty ice Formation sedime results are consis mization data d vation of biomol Evans Glacier s because these sa younger (John E sample (Fig. 1A, DNA from the fiv and Pleistocene i samples from the (volumes: 100 g the samples studi of vertebrate mtD A previous stu parisons of short sequences by me ment Search Tool tion likely (15). 1 Centre for Ancient Genetics, University of Copenhagen, Denmark. 2 BioArch, Departments of Biology and Archaeology, University of York, UK. 3 Bioinformatics Centre, University of Copenhagen, Denmark. 4 Centre for Comparative Genomics, University of Copenhagen, Denmark. 5 Max Planck Institute for Evolutionary Anthropology, Germany. 6 Murdoch University Willerslev 2007 Spruce Pine Birch Legumes Butterflies Daisies/Sunflower Grasses
  66. 66. Consensus with fossil record?
  67. 67. Molecular evolution analysis: •Earliest placental mammals (ie. eutherians) •body mass >1kg; lifespan >25years Genomic Evidence for Large, Long-Lived Ancestors to Placental Mammals J. Romiguier,1 V. Ranwez,1,2 E.J.P. Douzery,1 and N. Galtier*,1 1 CNRS, Universite´ Montpellier 2, UMR 5554, ISEM, Montpellier, France 2 Montpellier SupAgro, UMR 1334, AGAP, Montpellier, France *Corresponding author: E-mail: nicolas.galtier@univ-montp2.fr. Associate editor: Naruya Saitou Abstract It is widely assumed that our mammalian ancestors, which lived in the Cretaceous era, were tiny animals that su asteroid impacts in shelters and evolved into modern forms after dinosaurs went extinct, 65 Ma. The small size of m mammalian fossils essentially supports this view. Paleontology, however, is not conclusive regarding the ance mammals, because Cretaceous and Paleocene fossils are not easily linked to modern lineages. Here, we use full-ge estimate the longevity and body mass of early placental mammals. Analyzing 36 fully sequenced mammalian reconstruct two aspects of the ancestral genome dynamics, namely GC-content evolution and nonsynonymous o ous rate ratio. Linking these molecular evolutionary processes to life-history traits in modern species, we estim placental mammals had a life span above 25 years and a body mass above 1kg. This is similar to current primates, c or carnivores, but markedly different from mice or shrews, challenging the dominant view about mammali evolution. Our results imply that long-lived mammals existed in the Cretaceous era and were the most successfu opening new perspectives about the conditions for survival to the Cretaceous–Tertiary crisis. Key words: phylogeny, GC-content, dN/dS ratio, GC-biased gene conversion, placentalia, fossils. Mol Biol Evol 2013 ie. very different from “mouse-like” Eomaia scansoria What common ancestor of placental mammals radiated after K-T (Cretaceous-Palogene) extinction?
  68. 68. 3. DNA sequence clarifies current relationships
  69. 69. Three-spined stickleback Gasterosteus aculeatus Bill Cresko et al; David Kingsley et al Example 1.
  70. 70. Independent colonization events less than 10,000 years ago in Saltwater: in Freshwater: The freshwater populations, despite their younger age, ar divergent both from the oceanic ancestral populations and each other, consistent with our supposition that they rep independent colonizations from the ancestral oceanic popu These results are remarkably similar to results obtained pre from some of these same populations using a small num microsatellite and mtDNA markers [55]. This combinat large amounts of genetic variation and overall low-to-mo differentiation between populations, coupled with recent and phenotypic evolution in the freshwater populations, prese ideal situation for identifying genomic regions that have resp to various kinds of natural selection. Patterns of genetic diversity distributed across the genome To assess genome-wide patterns we examined mean nuc diversity (p) and heterozygosity (H) using a Gaussian smoothing function across each linkage group (Figure 4 and S1). Although the overall mean diversity and heterozygosity are 0.00336 and 0.00187, respectively, values vary widely the genome. Nucleotide diversity within genomic regions from 0.0003 to over 0.01, whereas heterozygosity values from 0.0001 to 0.0083. This variation in diversity acro genome provides important clues to the evolutionary pr that are maintaining genetic diversity. For example, expected (p) and observed (H) heterozygosity largely corre they differ at a few genomic regions (e.g., on Linkage Grou Genomic regions that exhibit significantly (p,1025 ) low le diversity and heterozygosity (e.g. on LG II and V, Fig and Figure S1) may be the result of low mutation low recombination rate, purifying or positive selection consistent across populations, or some combination of [9,36,105–107]. F S F F S S = Saltwater F = Freshwater Bill Cresko et al; Different amounts of armor plating
  71. 71. RAD = Restriction-site Associated DNA sequencing each locus sequenced 5–10 times per fish. Bill Cresko et al; The freshwater populations, despite their younger age, are more divergent both from the oceanic ancestral populations and from each other, consistent with our supposition that they represent independent colonizations from the ancestral oceanic population. These results are remarkably similar to results obtained previously from some of these same populations using a small number of microsatellite and mtDNA markers [55]. This combination of large amounts of genetic variation and overall low-to-moderate differentiation between populations, coupled with recent and rapid phenotypic evolution in the freshwater populations, presents an ideal situation for identifying genomic regions that have responded to various kinds of natural selection. Patterns of genetic diversity distributed across the genome To assess genome-wide patterns we examined mean nucleotide diversity (p) and heterozygosity (H) using a Gaussian kernel smoothing function across each linkage group (Figure 4 and Figure S1). Although the overall mean diversity and heterozygosity values are 0.00336 and 0.00187, respectively, values vary widely across the genome. Nucleotide diversity within genomic regions ranges from 0.0003 to over 0.01, whereas heterozygosity values range from 0.0001 to 0.0083. This variation in diversity across the genome provides important clues to the evolutionary processes that are maintaining genetic diversity. For example, while expected (p) and observed (H) heterozygosity largely correspond, they differ at a few genomic regions (e.g., on Linkage Group XI). Genomic regions that exhibit significantly (p,1025 ) low levels of diversity and heterozygosity (e.g. on LG II and V, Figure 4 and Figure S1) may be the result of low mutation rate, low recombination rate, purifying or positive selection that is consistent across populations, or some combination of factors [9,36,105–107]. In contrast, other genomic regions, such as those on LG III and XIII (Figure 4), show very high levels of both diversity and Figure 1. Location of oceanic and freshwater populations examined. Threespine stickleback were sampled from three freshwa- Population Genomics in Stickleback F S F F S S = Saltwater F = Freshwater 20 fish per population 45,789 loci genotyped
  72. 72. Differentiation between populations (FST) Saltwater vs. Saltwater Population Genomics i Freshwater vs. Freshwater Figure 6. Genome-wide differentiation among populations. FST across the genome, with colored bars indicating significa (p#1025 , blue; p#1027 , red) and reduced (p#1025 , green) values. Vertical gray shading indicates boundaries of the linkage groups and scaffolds, and gold shading indicates the nine peaks of substantial population differentiation discussed in the text. (A) FST between the populations (RS and RB; note that no regions of FST are significantly elevated or reduced). (B,C,D) Differentiation of each single freshwate from the two oceanic populations, shown as the mean of the two pairwise comparisons (with RS and RB): (B) BP, (C) BL, (D) ML. Colored plot represent regions where both pairwise comparisons exceeded the corresponding significance threshold. (E) Overall population d between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML). doi:10.1371/journal.pgen.1000862.g006 PLoS Genetics | www.plosgenetics.org 8 February 2010 | Volume 6 | Issue 2 Freshwater vs. Saltwater FST bewteen 2 populations: 0 = populations have same alleles in similar frequencies 1 = populations have completely different alleles Bill Cresko et al; David Kingsley et al
  73. 73. Nine identified regions • Identified regions include: • 31 that likely to affect morphology or osmoregulation • some previously identified via crosses; most new • E.g. EDA gene. • “rare” recessive allele (found in 1-5% of ocean individuals) • the “rare” allele went to fixation in all freshwater populations (ie. all individuals homozygous for the rare allele)
  74. 74. Little fire ant Wasmannia DNA identifies family relationships Fournier et al 2005
  75. 75. reproduction (that is, by ameiotic parthenogenesis). In 33 of the 34 nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the same nest shared an identical genotype at each of the 11 loci (Table 1 and Fig. 1). The single exception was nest B-12, in which queens differed at 1 of the 11 loci: four queens were heterozygous at Waur-2164 Table 1 | Genotypes of queens (Q), their mates (M) and workers (w) in one nest (E-3) at each of the 11 microsatellite loci Individual Waur-225 Waur-275 Waur-418 Waur-566 Waur-680 Waur-716 Waur-730 Waur-1166 Waur-2164 Waur-3176 Waur-1gam Queens Q-1 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-2 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-3 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-4 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-5 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-6 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-7 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Q-8 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298 Males M-1 269 107 118 265 187 192 214 95 320 244 282 M-2 269 107 118 265 187 192 214 95 320 244 282 M-3 269 107 118 265 187 192 214 95 320 244 282 M-4 269 107 118 265 187 192 214 95 320 244 282 M-5 269 107 118 265 187 192 214 95 320 244 282 M-6 269 107 118 265 187 192 214 95 320 244 282 M-7 269 107 118 265 187 192 214 95 320 244 282 M-8 269 107 118 265 187 192 214 95 320 244 282 Workers w-1 223 269 115 107 112 118 263 265 171 187 198 192 160 214 95 95 306 320 230 244 298 282 w-2 225 269 115 107 100 118 263 265 171 187 184 192 158 214 95 95 298 320 230 244 288 282 w-3 223 269 105 107 112 118 263 265 171 187 198 192 160 214 97 95 298 320 230 244 298 282 w-4 225 269 115 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 288 282 w-5 223 269 105 107 100 118 263 265 171 187 198 192 158 214 97 95 306 320 230 244 298 282 w-6 225 269 115 107 112 118 263 265 171 187 184 192 160 214 97 95 306 320 230 244 288 282 w-7 223 269 105 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 298 282 w-8 225 269 115 107 112 118 263 265 171 187 184 192 158 214 97 95 298 320 230 244 288 282 The identities of mates were determined by the sperm collected in the queen’s spermathecae. Queens and males’ genotypes illustrate their clonal production, whereas workers’ genotypes are consistent with normal sexual reproduction. Paternal alleles are in italics. NATURE|Vol 435|30 June 2005 LETTERS
  76. 76. reproduction (that is, by ameiotic parthenogenesis). In 33 of th nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the s nest shared an identical genotype at each of the 11 loci (Table 1 Fig. 1). The single exception was nest B-12, in which queens diff at 1 of the 11 loci: four queens were heterozygous at Waur-2 and the remaining three queens were homozygous for one of two alleles. This variation probably reflects a mutation or recom nation event in one queen followed by clonal reproduction wi the nest. The history of this genetic change could be reconstru from the genotypes of queens collected in neighbouring nests (Fi and 2). Nine queens from two neighbouring nests (B-11 and B had the same genotype as the four heterozygous queens for lo Waur-2164, indicating that the mutation or recombination e probably was from a heterozygote to a homozygote queen. The t homozygote queens from nest B-12 had a unique genotype in population, which further supports this interpretation. A comparison between nests supports the view of restricted fem gene flow, with budding being the main mode of colony format Within three of the five sites of collection (A, C and D) all queens the same genotype at the 11 loci (Fig. 2). In one of the two other (B), all queens from 8 of the 17 nests also had an identical genot whereas in the other site (E) the queen genotypes were different in three nests sampled. Taken together, these data indicate that que belonging to the same lineage of clonally produced individ frequently head closely located nests. Moreover, genetic diffe tiation between sites was very strong, with a single occurrenc genotypes shared between sites (the eight queens of nest E-3 genotypes identical to the most common genotype found at site showing that gene flow by females is extremely restricted. In stark contrast to reproductive females, the genotypic anal revealed that workers are produced by normal sexual reproduc (Table 1). Over all 31 queenright nests, each of the 248 genoty workers had, at seven or more loci, one allele that was absen queens of their nest. Moreover, the 232 workers from the 29 nes which the sperm in the queen’s spermathecae was successf Figure 2 | Neighbour-joining dendrogram of the genetic (allele-shared) distances between queens (Q), gynes (G) and male sperms (M) collected mate with their brothers inside the nest, and yet maintain heterozygosity in the queen and worker castes over an unlimited number of generations. Surprisingly, the heterozygosity level of new queens is completely independent of the genealogical link between the mother queen and her mate in this species, as there is no mixing of the paternal and maternal lineages. By two other ant sp hovia emeryi [2 study, it is like also translates sib mating on t estingly, W. aur studies have s derive from a characterized b single male ge and a single ma is also compati a single mated Interestingly lay male eggs th least two poten being clonally p genome could [21]. Indeed, o one parental ge as the parasito the waterfrog h lenta [33,34], a Formica [35,36 paternal genom one. The altern lay anucleated fertilized [37]. which eggs will gynes workers males queen mate Figure 2. Clonal reproduction in queens and males. The figure summarizes the reproduction system of P. longicornis in the study population. Maternal (light) and paternal (dark) chromosomes are displayed. Contribution to the genome of the offspring is indicated by arrows (dashed arrow represents the mother laying haploid eggs with no actual contribution to the genome). 2680 M. Pearcy et al. Sib mating without inbreeding on Jrspb.royalsocietypublishing.orgDownloaded from
  77. 77. Species-interactions via DNA sequencing Screening mammal biodiversity using DNA from leeches Ida Bærholm Schnell1,2,†, Philip Francis Thomsen2,†, Nicholas Wilkinson3, Morten Rasmussen2, Lars R.D. Jensen1, Eske Willerslev2, Mads F. Bertelsen1, and M. Thomas P. Gilbert2,* With nearly one quarter of mammalian species threatened, an accurate description of their distribution and conservation status is needed [1]. Correspondences in the medical leech (Hirudo medicinalis) viruses remain detectable in the blood meal for up to 27 weeks, indicating viral nucleic acid survival [4,5]. To examine whether PCR amplifiable mammalian DNA persists in ingested blood, we fed 26 medical leeches (Hirudo spp.) freshly drawn goat (Capra hircus) blood (Supplemental information) then sequentially killed them over 141 days. Following extraction of total DNA, a goat-specific quantitative PCR assay demonstrated mitochondrial DNA (mtDNA) survival in all leeches, thus persistence of goat DNA, for at least 4 months (Figure 1A; Supplemental information). We subsequently applied the method to monitor terrestrial mammal biodiversity in a challenging environment. Haemadipsa spp. leeches were collected in a densely forested biotope in the Central Annamite region ow w to n n in on. x 586. s al . Magazine R263 Figure 1. Monitoring mammals with leeches. (A) Survival of mtDNA in goat blood ingested by Hirudo medicinalis over time, relative to fres drawn sample (100%, ca. 2.4E+09 mtDNA copies/gram blood). Mitochondrial DNA remain detectable in all fed leeches, with a minimum observed level at 1.6E+04 mtDNA/gram blo ingested. The line shows a simple exponential decay model, p < 0.001, R2 = 0.43 (Supplemen information). (B) Vietnamese field site location and examples of mammals identified in Ha
  78. 78. Conservation
  79. 79. DNA: Summary 1. DNA sequences change 2. Past relationships between species 3. Current relationships http://www.slideshare.net/yannickwurm/

×