Fossilization & what DNA can tell us.

1. Mini-Summary

2. Mini-Summary
• The history of the earth is divided
into geological time periods

3. Mini-Summary
• The history of the earth is divided
into geological time periods
• These are defined by characteristic
flora and fauna

4. Mini-Summary
• The history of the earth is divided
into geological time periods
• These are defined by characteristic
flora and fauna
• Large-scale changes in biodiversity
were triggered by slow and rapid
environmental change
Pg
r
T
P-
T)
(K
g
-P
-S
J
r-
K
D
O
T
te
La
d ay
To

5. Lecture 5: Fossils
1. How fossilization works. Some examples of fossils.
2. Dating fossils.
3. What we can learn from fossils?
y . wurm {@} qmul . ac .uk

6. Geological context

7. Geological context
Three broad classes of rock:

8. Geological context
Three broad classes of rock:
•Sedimentary rocks: formed by particles
(mineral or organic) gradually settling out of solution,
then compacting to form rock

9. Geological context
Three broad classes of rock:
•Sedimentary rocks: formed by particles
(mineral or organic) gradually settling out of solution,
then compacting to form rock
•Igneous rocks: formed by the cooling of magma

10. Geological context
Three broad classes of rock:
•Sedimentary rocks: formed by particles
(mineral or organic) gradually settling out of solution,
then compacting to form rock
•Igneous rocks: formed by the cooling of magma
•Metamorphic rocks: modification of existing
rocks under high pressure and heat

12. Fossils: only in sedimentary rocks (deposited on oceanic
shorelines, lake beds, flood plains...)

13. Fossils: only in sedimentary rocks (deposited on oceanic
shorelines, lake beds, flood plains...)
Weathering or erosion can expose the older layers

14. Fossilization

15. Fossilization
• Permineralization

16. Fossilization
• Permineralization
• “Natural cast” process

17. Fossilization
• Permineralization
• “Natural cast” process
• Fossilization is rare & only in sediment...

18. Fossilization
• Permineralization
• “Natural cast” process
• Fossilization is rare & only in sediment...
• Ancient material also occurs:
• in amber
• by mummification
• in ice

19. Fossil formation at Sterkfontein

20. Fossil formation at Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.

21. Fossil formation at Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
Caves eventually form below the
surface.

22. Fossil formation at Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
Caves eventually form below the
surface.
‘Pot holes’ form between the
surface and the caves.

23. Fossil formation at Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
Caves eventually form below the
surface.
‘Pot holes’ form between the
surface and the caves.
Debris, including animals, fall in!

24. Fossil formation at Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
Caves eventually form below the
surface.
‘Pot holes’ form between the
surface and the caves.
Debris, including animals, fall in!
Compaction and cementing with
water and limestone produces
“Breccia”.

25. Fossil preservation
• Hard part like shells, bones and teeth are usually all that remain
• Soft tissues fossils are rare

26. Why are fossils rare?

27. Why are fossils rare?
• Fossils don’t form often:

28. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses

29. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains

30. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)

31. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)

32. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation::

33. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation::
• arid deserts, deep water (with low O2)

34. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation::
• arid deserts, deep water (with low O2)

35. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation::
• arid deserts, deep water (with low O2)
•

37. Why are fossils rare?

38. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold

39. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold
• Fossils can be lost:

40. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold
• Fossils can be lost:
• mountains: lots of erosion

41. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold
• Fossils can be lost:
• mountains: lots of erosion
• Metamorphosis and subduction of rocks destroys fossils

42. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold
• Fossils can be lost:
• mountains: lots of erosion
• Metamorphosis and subduction of rocks destroys fossils

43. Why are fossils rare?
• Fossils don’t form often:
• Predators, scavengers, insects consume corpses
• Bacteria and fungi decompose remains
• Even faster in tropics (acid soil, warm, humid...)
• Best locations for fossil formation:
• arid deserts, deep water (with low O2), cold
• Fossils can be lost:
• mountains: lots of erosion
• Metamorphosis and subduction of rocks destroys fossils
• Most are still buried rather than exposed at the surface

44. A few examples...

45. Plesiosaur fossil
Aquatic reptile; not a dinosaur. But same time (Mesozoic Era).
A typical fossil skeleton.

46. More typical…
Parts of head, and anvil/brush of Akmonistion zangerli, shark from
Carboniferous of Scotland

48. Ammonites
Nautilus
Ammonite

49. Archaeopteryx - late Jurassic (150Mya)
Feathers, like soft tissue, are rarely preserved.
But here imprinted in the rock.

50. “Fuzzy Raptor” (a dromaeosaur)
A rare example of a
feathered dinosaur

51. The earliest Eutherian Mammal?
Lower Cretaceous of China, 125 Mya
Eomaia scansoria
Ji et al., (2002) Nature
416, 816-822
A climbing mammal from
a lake shore environment

52. Leptictidium tobieni
Eocene (Messel Shales, Germany)
Soft tissues AND gut contents are
preserved

53. Dinosaur footprint
• Atthe time, this footprint of a dinosaur pressed into soft mud and
became preserved in the now hardened rock. Can inform us on
locomotion.

54. Fossilized tracks at
Laetoli (Tanzania)
Footprints preserved in
volcanic ash from: 3 hominids
(Australopithecus afarensis)
Numerous other mammals

55. Fossilized tracks at
Laetoli (Tanzania)
Footprints preserved in
volcanic ash from: 3 hominids
(Australopithecus afarensis)
Numerous other mammals

56. Fossil Ichthyosaur giving birth
• Suchspecial preservations can inform us about the reproductive
pattern in this species (live birth) .

57. Fossil Eggs
Information on development and social/reproductive behavior

58. INSECT IN AMBER
• This
mosquito was imbedded in tree sap that subsequently
hardened into amber, preserving the insect within.

59. Neanderthal skull from
Iraq
(≈50,000 years old)
Very rarely, DNA can
be extracted and
sequenced from such
sub-fossils

60. Some animals get trapped in ice

61. Lecture 5: Fossils
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?

62. Dating methods
• Absolute - the item itself is dated
• Relative - strata above (younger) and below (older)
are dated and the item expressed relative to these
Best method depends on context & age.

63. Principles of
radiometric dating

64. Dating methods

65. Stratigraphy

66. Stratigraphy
As sediment collects, deeper layers are compacted by the ones
above until they harden and become rock.
Deeper Fossils are older than those above.
Thus positions within the rock layers gives fossils a chronological age.

67. Index (Zone) Fossils
•Index fossils: diagnostic fossil species that help dating new finds
•Here, Locality 3 has no layer B (wasn’t formed or eroded).

69. Lecture 5: Fossils
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?

70. • Fossils
can sometimes directly or indirectly tell us a great deal about
the behavior of an organism, or its lifestyle

71. Intepreting fossils
• Careful interpretation: helps make sense of fossilized remains
• Analysis
of hard parts can tell something about soft anatomy (e.g
where muscles are (.e.g muscle scars).
• Geology: --> environmant (freshwater/marine/swamp))
• Infer from living organisms & relatives.

72. Hallucigenia sparsa (Cambrian Period)
From the Burgess Shale (Canada). Example of a soft bodied
animal fossil, also very old!

73. Now re-interpreted as an Onychophoran ("velvet worm")

75. Colors don’t fossilize...

76. Colors don’t fossilize...
…or do they? (discovered fossilised melanosomes)

77. Fossils - Summary

78. Fossils - Summary
• Fossils form in sedimentary rock
• Fossilization is a rare process
• Usually, only the hard parts like bone, teeth, exoskeletons and shells
are preserved
• Fossils of different ages occur in different strata, and “index fossils” can
be used to cross-reference between different geographic locations
• Careful interpretation is required.

80. Lecture 6: What can DNA tell us?

81. Lecture 6: What can DNA tell us?
• Species relationships previously based on:

82. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures

83. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies

84. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development

85. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior

86. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche

87. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche
• ....

88. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche
• ....

89. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche
• ....
• DNA holds lots of additional information:

90. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche
• ....
• DNA holds lots of additional information:
• 2. Evolutionary relationships

91. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche
• ....
• DNA holds lots of additional information:
• 2. Evolutionary relationships
• 3. Current evolutionary contexts

92. Lecture 6: What can DNA tell us?
• Species relationships previously based on:
• bone structures
• morphologies
• development
• behavior
• ecological niche
• ....
1. DNA sequences change
• DNA holds lots of additional information:
• 2. Evolutionary relationships
• 3. Current evolutionary contexts

93. 1. DNA sequences change

94. 1. DNA sequences change
DNA mutations occur all the time.

95. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:

96. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination,

97. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination,
• mutagens (radiation, chemicals),

98. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination,
• mutagens (radiation, chemicals),
• viruses

99. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination,
• mutagens (radiation, chemicals),
• viruses
• transposons

100. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination,
• mutagens (radiation, chemicals),
• viruses
• transposons

101. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
• mistakes in DNA replication or recombination,
• mutagens (radiation, chemicals),
• viruses
• transposons
Inherited: only if in germ line. Not from soma.

102. Types of mutations

103. Types of mutations
• Small: replacement, insertion, deletion. E.g.:

104. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA

105. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
in satellite new : TGCAGATAGAGAGAGAGAGCAGAT

106. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
in satellite new : TGCAGATAGAGAGAGAGAGCAGAT
• Big: inversions, duplications, deletions

107. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
in satellite new : TGCAGATAGAGAGAGAGAGCAGAT
• Big: inversions, duplications, deletions

108. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
in satellite new : TGCAGATAGAGAGAGAGAGCAGAT
• Big: inversions, duplications, deletions

109. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
in satellite new : TGCAGATAGAGAGAGAGAGCAGAT
• Big: inversions, duplications, deletions

110. Types of mutations
• Small: replacement, insertion, deletion. E.g.:
original: GATTACAGATTACA
Point mutation new : GATTACATATTACA
Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
in satellite new : TGCAGATAGAGAGAGAGAGCAGAT
• Big: inversions, duplications, deletions
Mutations are the source of genetic, inheritable variation

111. What happens to a mutation?

112. What happens to a mutation?
• Most point mutations are neutral: no effect.

113. What happens to a mutation?
• Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)

114. What happens to a mutation?
• Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)
• Some are very deleterious;

115. What happens to a mutation?
• Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)
• Some are very deleterious;
Eg. antennapedia (hox gene) mutation:

116. What happens to a mutation?
• Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)
• Some are very deleterious; Some increase fitness.
Eg. antennapedia (hox gene) mutation:

117. What happens to a mutation?
• Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)
• Some are very deleterious; Some increase fitness.
• --> selection eliminates or fixes them
Eg. antennapedia (hox gene) mutation:

118. What happens to a mutation?
• Most point mutations are neutral: no effect.
• --> Genetic drift, hitchhiking... (--> elimination or fixation)
• Some are very deleterious; Some increase fitness.
• --> selection eliminates or fixes them
Eg. antennapedia (hox gene) mutation:
See population genetics lectures & practical

119. 2. DNA clarifies evolutionary relationships

120. 2. DNA clarifies evolutionary relationships
Human: GATTACA

121. 2. DNA clarifies evolutionary relationships
Human: GATTACA
Peacock: GATTGCA

122. 2. DNA clarifies evolutionary relationships
Human: GATTACA
Peacock: GATTGCA
Amoeba: GGCTCCA

123. 2. DNA clarifies evolutionary relationships
Human: GATTACA
Peacock: GATTGCA
Amoeba: GGCTCCA
Amoeba
Human
Peacock

124. 2. DNA clarifies evolutionary relationships
Human: GATTACA
Peacock: GATTGCA
Amoeba: GGCTCCA
Amoeba
Human
Peacock
See practical!

125. Linnaeus 1735 classification of animals

126. Carl Woese in 1977

127. Cows are more closey related to whales than to horses
Cetacea
Artiodactyla
Cetartiodactyla

128. Bat echolocation
Teeling 2002

129. Bat echolocation
Evolved twice!
Teeling 2002

130. Molecular clocks: another dating system
Stochastic clock

131. Molecular clocks: another dating system
Genetic change
Stochastic clock
Metronomic
clock
Time

132. Molecular clocks: another dating system
Genetic change
Stochastic clock
Metronomic
clock
Mutations may
accumulate
with time at
different rates
Time

133. Ancient DNA

134. Ancient DNA: below 2km of ice

135. Ancient DNA: below 2km of ice
REPORTS
criterion
many pu
abundanc
as is typ
efficiently
low-leve
due to D
Appr
the John
signed to
tion and
the order
genus Sa
sistent w
more tha
Arctic en
plant div
ilar to t
which co
ceae), pu
sales), an
by confir
Glacier s
trol, show
ably reco
In co
Fig. 1. Sample location and core schematics. (A) Map showing the locations of the Dye 3 (65°11'N, sample, t
45°50'W) and GRIP (72°34'N, 37°37'W) drilling sites and the Kap København Formation (82°22'N, that coul

136. also shown. Asteraceae, Fabaceae, and Poaceae, are mainly
Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice are shown. Sequences have been deposited in GenBank under accession
samples. For each taxon (assigned to order, family, or genus level), the numbers EF588917 to EF588969, except for seven sequences less than 50
genetic markers (rbcL, trnL, or COI), the number of clone sequences bp in size that are shown below. Their taxon identifications are indicated
supporting the identification, and the probability support (in percentage) by symbols.
Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%)
JEG sample
Rosales rbcL 3 90–99
Malpighiales rbcL 2 99–100 Salicaceae rbcL 2 99–100
trnL 5 99–100 trnL 4 100
Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91
Dye 3 sample
Coniferales rbcL 44 97–100 Pinaceae* rbcL 20 100 Picea rbcL 20 99–100
trnL 27 100 trnL 25 100 Pinus† trnL 17 90–99
Taxaceae‡ rbcL 23 91–98
trnL 2 100
Poales§ rbcL 67 99–100 Poaceae§ rbcL 67 99–100
trnL 17 97–100 trnL 13 100
Asterales rbcL 18 90–100 Asteraceae rbcL 2 91
trnL 27 100 trnL 27 100
Fabales rbcL 10 99–100 Fabaceae rbcL 10 99–100
trnL 3 99 trnL 3 99
Fagales rbcL 10 95–99 Betulaceae rbcL 8 93–97 Alnus rbcL 7 91–95
trnL 12 100 trnL 11 98–100 trnL 9 98–100
Lepidoptera COI 12 97–99
*Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. Env_3, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA-
TAGGAAGGG. †Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG-
GAACAATAATTTTATTTTCTAGAAAAGG. §Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT.
12 6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org
Willerslev 2007

137. also shown. Asteraceae, Fabaceae, and Poaceae, are mainly
Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice are shown. Sequences have been deposited in GenBank under accession
samples. For each taxon (assigned to order, family, or genus level), the numbers EF588917 to EF588969, except for seven sequences less than 50
genetic markers (rbcL, trnL, or COI), the number of clone sequences bp in size that are shown below. Their taxon identifications are indicated
supporting the identification, and the probability support (in percentage) by symbols.
Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%)
JEG sample
Rosales rbcL 3 90–99
Malpighiales rbcL 2 99–100 Salicaceae rbcL 2 99–100
trnL 5 99–100 trnL 4 100
Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91
Dye 3 sample
Coniferales rbcL 44 97–100 Pinaceae* rbcL 20 100 Picea rbcL 20 99–100
trnL 27 100 trnL 25 100 Pinus† trnL 17 90–99
Taxaceae‡ rbcL 23 91–98
trnL 2 100
Poales§ rbcL 67 99–100 Poaceae§ rbcL 67 99–100
trnL 17 97–100 trnL 13 100
Asterales rbcL 18 90–100 Asteraceae rbcL 2 91
trnL 27 100 trnL 27 100
Fabales rbcL 10 23. L. 99–100R. Hacker, G. Hirth, P. B. Kelemen,
Mehl, B. Fabaceae rbcL 10 99–100
R. L. Rudnick, Ed. (Elsevier-Pergamon, Oxford, 2003), Supporting Online Ma
trnL 3 J. Geophys. Res. 108, 10.1029/2002JB002233
99 trnL 3 vol. 3, pp. 593–659.
99 www.sciencemag.org/cgi/co
(2003). 27. T. V. Gerya, D. A. Yuen, Earth Planet. Sci. Lett. 212, 47 SOM Text
Fagales rbcL R. Jicha, Betulaceae rbcL
10 24. B.95–99 D. W. Scholl, B. S. Singer, G. M. Yogodzinski, 8 (2003).93–97 Alnus rbcL 7 Figs. S1 and S2
91–95
trnL 12 S. M. 100 Geology 34, 661 (2006).
Kay, trnL 1128. 98–100 trnL
We thank M. Long, E. Kneller, and C. Conrad for 9 References98–100
Lepidoptera COI 12 25. C.-T. Lee, X. Cheng, U. Horodyskyj, Contrib. Min. Petrol.
97–99 conversations that motivated this work. Funding was
151, 222 (2006). provided by NSF grants EAR-9910899, EAR-0125919, and 13 February 2007; accepte
*Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. Env_3,A.trnL Greene, in The Crust,
26. P. B. Kelemen, K. Hanghøj, R. ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA-
EAR-0509882. 10.1126/science.1141269
TAGGAAGGG. †Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG-
GAACAATAATTTTATTTTCTAGAAAAGG. §Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT.
12 Ancient Biomolecules from
6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org
face of the frozen c
control for potentia
have entered the inte
Deep Ice Cores Reveal a Forested cracks or during th
Polymerase chain r
Southern Greenland Willerslev 2007
the plasmid DNA w
tracts of the outer ice
1 2 3 4 interior, confirming

138. Ancient DNA

139. Ancient DNA
Hair sequencing

141. Consensus with fossil record?

142. Genomic Evidence for Large, Long-Lived Ancestors to
Placental Mammals
J. Romiguier,1 V. Ranwez,1,2 E.J.P. Douzery,1 and N. Galtier*,1
1
´
CNRS, Universite Montpellier 2, UMR 5554, ISEM, Montpellier, France
2
Montpellier SupAgro, UMR 1334, AGAP, Montpellier, France
*Corresponding author: E-mail: nicolas.galtier@univ-montp2.fr.
Associate editor: Naruya Saitou
Abstract
It is widely assumed that our mammalian ancestors, which lived in the Cretaceous era, were tiny animals that survived m
asteroid impacts in shelters and evolved into modern forms after dinosaurs went extinct, 65 Ma. The small size of most Me
mammalian fossils essentially supports this view. Paleontology, however, is not conclusive regarding the ancestry of
mammals, because Cretaceous and Paleocene fossils are not easily linked to modern lineages. Here, we use full-genome d
estimate the longevity and body mass of early placental mammals. Analyzing 36 fully sequenced mammalian genom
reconstruct two aspects of the ancestral genome dynamics, namely GC-content evolution and nonsynonymous over syn
ous rate ratio. Linking these molecular evolutionary processes to life-history traits in modern species, we estimate tha
placental mammals had a life span above 25 years and a body mass above 1 kg. This is similar to current primates, cetartiod
or carnivores, but markedly different from mice or shrews, challenging the dominant view about mammalian orig
evolution. Our results imply that long-lived mammals existed in the Cretaceous era and were the most successful in evo
opening new perspectives about the conditions for survival to the Cretaceous–Tertiary crisis.

143. An issue with sequence
phylogenies
• Can be ambiguous if not enough information.

144. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

145. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

146. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

147. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

148. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

149. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

150. Ambiguities in mutations
ancestral
species 1. species 2. What happened
sequence

151. An issue with sequence
phylogenies
• Can be ambiguous if not enough information.

152. An issue with sequence
phylogenies
• Can be ambiguous if not enough information.
• Used to be expensive.

153. An issue with sequence
phylogenies
• Can be ambiguous if not enough information.
• Used to be expensive.
• Mitochondrial gene vs. nuclear gene. Several genes?

154. An issue with sequence
phylogenies
• Can be ambiguous if not enough information.
• Used to be expensive.
• Mitochondrial gene vs. nuclear gene. Several genes?
• Whole genome sequencing is now dirt cheap! No longer a problem!
(for establishing relationships in past 200-400 million years...)

155. 3. DNA sequence clarifies current
evolutionary contexts

156. Three-spined stickleback
Example 1.
Gasterosteus aculeatus
Different amounts of
armor plating
Bill Cresko et al; David Kingsley et al

157. Three-spined stickleback
Example 1.
Gasterosteus aculeatus
in Saltwater:
Different amounts of
armor plating in Freshwater:
Bill Cresko et al; David Kingsley et al

158. F Independent
The freshwater populations, despite their younger age, ar
divergent both from the oceanic ancestral populations and
colonization events
each other, consistent with our supposition that they rep
F independent colonizations from the ancestral oceanic popu
These results are remarkably similar to results obtained pre
from some of these same populations using a small num
F
less than 10,000
microsatellite and mtDNA markers [55]. This combinat
large amounts of genetic variation and overall low-to-mo
S differentiation between populations, coupled with recent and
years ago
phenotypic evolution in the freshwater populations, prese
ideal situation for identifying genomic regions that have resp
S to various kinds of natural selection.
Patterns of genetic diversity distributed across the
genome
To assess genome-wide patterns we examined mean nuc
diversity (p) and heterozygosity (H) using a Gaussian
in Saltwater:
smoothing function across each linkage group (Figure 4 and
S1). Although the overall mean diversity and heterozygosity
are 0.00336 and 0.00187, respectively, values vary widely
the genome. Nucleotide diversity within genomic regions
from 0.0003 to over 0.01, whereas heterozygosity values
from 0.0001 to 0.0083. This variation in diversity acro
genome provides important clues to the evolutionary pr
that are maintaining genetic diversity. For example,
in Freshwater:
expected (p) and observed (H) heterozygosity largely corre
F = Freshwater they differ at a few genomic regions (e.g., on Linkage Grou
Genomic regions that exhibit significantly (p,1025) low le
S = Saltwater diversity and heterozygosity (e.g. on LG II and V, Fig
and Figure S1) may be the result of low mutation
low recombination rate, purifying or positive selection
consistent across populations, or some combination of
Bill Cresko et al; [9,36,105–107].

159. RAD = Restriction-site Associated DNA sequencing Population Genomics in Stickleback
The freshwater populations, despite their younger age, are more
F divergent both from the oceanic ancestral populations and from
each other, consistent with our supposition that they represent
F independent colonizations from the ancestral oceanic population.
These results are remarkably similar to results obtained previously
F from some of these same populations using a small number of
microsatellite and mtDNA markers [55]. This combination of
large amounts of genetic variation and overall low-to-moderate
S differentiation between populations, coupled with recent and rapid
20 fish per population
phenotypic evolution in the freshwater populations, presents an
ideal situation for identifying genomic regions that have responded
S to various kinds of natural selection.
Patterns of genetic diversity distributed across the
45,789 SNPs identified
genome
To assess genome-wide patterns we examined mean nucleotide
diversity (p) and heterozygosity (H) using a Gaussian kernel
smoothing function across each linkage group (Figure 4 and Figure
S1). Although the overall mean diversity and heterozygosity values
each locus sequenced
are 0.00336 and 0.00187, respectively, values vary widely across
the genome. Nucleotide diversity within genomic regions ranges
from 0.0003 to over 0.01, whereas heterozygosity values range
F = Freshwater
5–10 times per fish.
from 0.0001 to 0.0083. This variation in diversity across the
genome provides important clues to the evolutionary processes
that are maintaining genetic diversity. For example, while
expected (p) and observed (H) heterozygosity largely correspond,
S = Saltwater
they differ at a few genomic regions (e.g., on Linkage Group XI).
Genomic regions that exhibit significantly (p,1025) low levels of
diversity and heterozygosity (e.g. on LG II and V, Figure 4
and Figure S1) may be the result of low mutation rate,
low recombination rate, purifying or positive selection that is
consistent across populations, or some combination of factors
[9,36,105–107].
Figure 1. Location of oceanic and freshwater populations In contrast, other genomic regions, such as those on LG III and
Bill Cresko et Threespine stickleback were sampled from three freshwa-
examined. al; XIII (Figure 4), show very high levels of both diversity and

160. Differentiation between populations (FST) Population Genomics i
Saltwater
vs.
Saltwater
FST bewteen 2 populations: 0 = populations have same alleles in similar frequencies
1 = populations have completely different alleles
Bill Cresko et al; David Kingsley et al

161. Differentiation between populations (FST) Population Genomics i
Saltwater
vs.
Saltwater
Freshwater
vs.
Freshwater
Figure 6. Genome-wide differentiation among populations. FST across the genome, with colored bars indicating significa
(p#1025, blue; p#1027, red) and reduced (p#1025, green) values. Vertical gray shading indicates boundaries of the linkage groups and
scaffolds, and gold shading indicates the nine peaks of substantial population differentiation discussed in the text. (A) FST between the
populations (RS and RB; note that no regions of FST are significantly elevated or reduced). (B,C,D) Differentiation of each single freshwate
from the two oceanic populations, shown as the mean of the two pairwise comparisons (with RS and RB): (B) BP, (C) BL, (D) ML. Colored
plot represent regions where both pairwise comparisons exceeded the corresponding significance threshold. (E) Overall population d
between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML).
doi:10.1371/journal.pgen.1000862.g006
FST bewteen 2 populations: 0 = populations have same alleles in similar 2010 | Volume 6 | Issue 2
PLoS Genetics | www.plosgenetics.org 8 February
frequencies
1 = populations have completely different alleles
Bill Cresko et al; David Kingsley et al

162. Differentiation between populations (FST) Population Genomics i
Saltwater
vs.
Saltwater
Freshwater
vs.
Freshwater
Freshwater 6.blue; p#10 , red)differentiation among populations. F gray shadinggenome, with coloredofbars linkage groups and
Figure
(p#10 ,
Genome-wide
25 27 25
and reduced (p#10 , green) values. Vertical
across the ST
indicates boundaries the
indicating significa
vs. populations (RS andshading indicates regions ofpeaksare significantlypopulation differentiation discussed in the text.eachFsingle freshwate
scaffolds, and gold
RB; note that no
the nine
F
of substantial
ST elevated or reduced). (B,C,D) Differentiation of
(A) between the
ST
Saltwater representoceanic populations, shown as comparisons the two pairwise comparisonssignificance threshold. (E)(C) BL, (D)population d
from the two
plot regions where both pairwise
the mean of
exceeded the corresponding
(with RS and RB): (B) BP,
Overall
ML. Colored
between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML).
doi:10.1371/journal.pgen.1000862.g006
FST bewteen 2 populations: 0 = populations have same alleles in similar 2010 | Volume 6 | Issue 2
PLoS Genetics | www.plosgenetics.org 8 February
frequencies
1 = populations have completely different alleles
Bill Cresko et al; David Kingsley et al

163. Nine identified regions
• Include 590 genes:
• 31 of these known to or likely to affect morphology or
osmoregulation
• some previously identified via crosses; most new
• finer-scale follow-up required?

164. Nine identified regions
• Include 590 genes:
• 31 of these known to or likely to affect morphology or
osmoregulation
• some previously identified via crosses; most new
• finer-scale follow-up required?
• Different regions, different mode of evolution:

165. Nine identified regions
• Include 590 genes:
• 31 of these known to or likely to affect morphology or
osmoregulation
• some previously identified via crosses; most new
• finer-scale follow-up required?
• Differentregions, different mode of evolution:
• hard sweep: the same allele is selected to fixation in all
freshwater populations

166. Nine identified regions
• Include 590 genes:
• 31 of these known to or likely to affect morphology or
osmoregulation
• some previously identified via crosses; most new
• finer-scale follow-up required?
• Different regions, different mode of evolution:
• hard sweep: the same allele is selected to fixation in all
freshwater populations
• soft sweep: a different allele is selected to fixation in each
freshwater population

167. Nine identified regions
• Include 590 genes:
• 31 of these known to or likely to affect morphology or
osmoregulation
• some previously identified via crosses; most new
• finer-scale follow-up required?
• Different regions, different mode of evolution:
• hard sweep: the same allele is selected to fixation in all
freshwater populations
• soft sweep: a different allele is selected to fixation in each
freshwater population
• balancing selection: selection for heterozygosity

168. Little fire ant Wasmannia

169. Little fire ant Wasmannia

170. NATURE|Vol 435|30 June 2005 LETTERS
Table 1 | Genotypes of queens (Q), their mates (M) and workers (w) in one nest (E-3) at each of the 11 microsatellite loci
Individual Waur-225 Waur-275 Waur-418 Waur-566 Waur-680 Waur-716 Waur-730 Waur-1166 Waur-2164 Waur-3176 Waur-1gam
Queens
Q-1 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-2 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-3 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-4 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-5 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-6 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-7 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Q-8 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298
Males
M-1 269 107 118 265 187 192 214 95 320 244 282
M-2 269 107 118 265 187 192 214 95 320 244 282
M-3 269 107 118 265 187 192 214 95 320 244 282
M-4 269 107 118 265 187 192 214 95 320 244 282
M-5 269 107 118 265 187 192 214 95 320 244 282
M-6 269 107 118 265 187 192 214 95 320 244 282
M-7 269 107 118 265 187 192 214 95 320 244 282
M-8 269 107 118 265 187 192 214 95 320 244 282
Workers
w-1 223 269 115 107 112 118 263 265 171 187 198 192 160 214 95 95 306 320 230 244 298 282
w-2 225 269 115 107 100 118 263 265 171 187 184 192 158 214 95 95 298 320 230 244 288 282
w-3 223 269 105 107 112 118 263 265 171 187 198 192 160 214 97 95 298 320 230 244 298 282
w-4 225 269 115 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 288 282
w-5 223 269 105 107 100 118 263 265 171 187 198 192 158 214 97 95 306 320 230 244 298 282
w-6 225 269 115 107 112 118 263 265 171 187 184 192 160 214 97 95 306 320 230 244 288 282
w-7 223 269 105 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 298 282
w-8 225 269 115 107 112 118 263 265 171 187 184 192 158 214 97 95 298 320 230 244 288 282
The identities of mates were determined by the sperm collected in the queen’s spermathecae. Queens and males’ genotypes illustrate their clonal production, whereas workers’ genotypes are
consistent with normal sexual reproduction. Paternal alleles are in italics.
reproduction (that is, by ameiotic parthenogenesis). In 33 of the 34
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the same
nest shared an identical genotype at each of the 11 loci (Table 1 and
Fig. 1). The single exception was nest B-12, in which queens differed
at 1 of the 11 loci: four queens were heterozygous at Waur-2164

172. reproduction (that is, by ameiotic parthenogenesis). In 33 of th
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the s
nest shared an identical genotype at each of the 11 loci (Table 1
Fig. 1). The single exception was nest B-12, in which queens diff
at 1 of the 11 loci: four queens were heterozygous at Waur-2
and the remaining three queens were homozygous for one of
two alleles. This variation probably reflects a mutation or recom
nation event in one queen followed by clonal reproduction wi
the nest. The history of this genetic change could be reconstru
from the genotypes of queens collected in neighbouring nests (Fi
and 2). Nine queens from two neighbouring nests (B-11 and B
had the same genotype as the four heterozygous queens for lo
Waur-2164, indicating that the mutation or recombination e
probably was from a heterozygote to a homozygote queen. The t
homozygote queens from nest B-12 had a unique genotype in
population, which further supports this interpretation.
A comparison between nests supports the view of restricted fem
gene flow, with budding being the main mode of colony format
Within three of the five sites of collection (A, C and D) all queens
the same genotype at the 11 loci (Fig. 2). In one of the two other
(B), all queens from 8 of the 17 nests also had an identical genot
whereas in the other site (E) the queen genotypes were different in
three nests sampled. Taken together, these data indicate that que
belonging to the same lineage of clonally produced individ
frequently head closely located nests. Moreover, genetic diffe
tiation between sites was very strong, with a single occurrenc
genotypes shared between sites (the eight queens of nest E-3
genotypes identical to the most common genotype found at site
showing that gene flow by females is extremely restricted.
In stark contrast to reproductive females, the genotypic anal
revealed that workers are produced by normal sexual reproduc
(Table 1). Over all 31 queenright nests, each of the 248 genoty
workers had, at seven or more loci, one allele that was absen
Figure 2 | Neighbour-joining dendrogram of the genetic (allele-shared)
queens of their nest. Moreover, the 232 workers from the 29 nes
distances between queens (Q), gynes (G) and male sperms (M) collected which the sperm in the queen’s spermathecae was successf

173. reproduction (that is, by ameiotic parthenogenesis). In 33 of th
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the s
nest shared an identical genotype at each of the 11 loci (Table 1
Fig. 1). The single exception was nest B-12, in which queens diff
at 1 of the 11 loci: four queens were heterozygous at Waur-2
and the remaining three queens were homozygous for one of
two alleles. This variation probably reflects a mutation or recom
nation event in one queen followed by clonal reproduction wi
the nest. The history of this genetic change could be reconstru
from the genotypes of queens collected in neighbouring nests (Fi
Downloaded from rspb.royalsocietypublishing.org on J
and 2). Nine queens from two neighbouring nests (B-11 and B
had2680 same genotypeSib matingfour heterozygous queens for lo
the M. Pearcy et al. as the without inbreeding
Waur-2164, indicating that the mutation or recombination e
probably was from a heterozygote to a homozygote queen. The t two other ant sp
hovia emeryi [2
homozygote queens from nest B-12 had a unique genotypelike study, it is
in
population, which further supports this interpretation. translates also
queen mate
A comparison between nests supports the view of restrictedon t sib mating fem
gene flow, with budding being the main mode of colony format estingly, W aur
.
studies have s
Within three of the five sites of collection (A, C and D) all queens derive from a
the same genotype at the 11 loci (Fig. 2). In one of the two other b characterized
(B), all queens from 8 of the 17 nests also had an identicalmale ge single genot
whereas in the other site (E) the queen genotypes were differentma and a single
is also compati
in
three nests sampled. Taken together, these data indicate that que a single mated
belonging to gynes the same lineage of clonally produced individ
workers males Interestingly
frequently head closely located nests. Moreover, genetic diffe
Figure 2. Clonal reproduction in queens and males. The lay male eggs th
least two poten
tiationthesummarizes the reproduction system ofandlongicornis being clonally p
figure
in
between sites was very strong, P. paternal
study population. Maternal (light)
with a single occurrenc
genotypes shared between sites Contribution to the of nest could
(dark) chromosomes are displayed. (the eight queens genome E-3
genotypes of the offspringthe indicated by arrows genotype found at site
genome identical to is most common (dashed [21]. Indeed, o
arrow represents the mother laying haploid eggs with no one parental ge
showing contribution to the genome).
actual that gene flow by females is extremely restricted. parasitoas the
In stark contrast to reproductive females, the genotypic anal the waterfrog h
revealedwith their brothersare producedand yet maintain lenta [33,34], a
mate that workers inside the nest, by normal sexual reproduc
(Table 1). Over in the generations. worker castes over of theFormica [35,36
heterozygosity
unlimited number
allof queen and
31 queenright nests, each an paternal genom 248 genoty
workers had, at the heterozygosity level of new queens is that was absen
Surprisingly, seven or more loci, one allele one. The altern
Figure 2 | Neighbour-joining dendrogram of the genetic (allele-shared)
queens of their nest. Moreover, the 232link between lay anucleated
completely independent of the genealogical workers from the 29 nes
distances between queens (Q), gynes (G) and male sperms (M) collected which mother queen and her mate in this species, as there was successf
the the sperm in the queen’s spermathecae fertilized [37].
is no mixing of the paternal and maternal lineages. By which eggs will

174. Conservation

175. Summary

176. Summary
• 1. DNA sequences change

177. Summary
• 1. DNA sequences change
• 2. Evolutionary relationships

178. Summary
• 1. DNA sequences change
• 2. Evolutionary relationships
• 3. Current evolutionary contexts