SlideShare a Scribd company logo
1 of 23
HORIZON DISCOVERY
An Introduction To CRISPR
Genome Editing
Chris Thorne, PhD | Commercial Marketing Manager
2
Disclaimer
2
• This Presentation does not constitute or form any part of an offer to sell, or invitation to purchase or apply for or enter into any contract or make
any other commitment whatsoever in relation to, securities. Although reasonable care has been taken to ensure that the facts stated in this
Presentation are accurate and that the opinions expressed are fair and reasonable, the contents of this Presentation have not been formally
verified by Horizon Discovery plc (the “Company”) or any other person. Accordingly, no representation or warranty, expressed or implied, is made
as to the fairness, accuracy, completeness or correctness of the information and opinions contained in this Presentation and no reliance should be
placed on such information or opinions. Further, the information in this Presentation is not complete and is subject to updating, revision, further
verification and amendment. Neither the Company, nor any of its subsidiaries, nor any of its respective members, directors, officers or employees
nor any other person accepts any liability whatsoever for any loss howsoever arising from any use of such information or opinions or otherwise
arising in connection with this Presentation.
• Accordingly, information contained in the Presentation is being supplied to you solely for your information and may not be copied, reproduced or
further distributed to any person or published in whole or in part, for any purpose. In particular, the distribution of this Presentation in certain
jurisdictions may be restricted by law, and persons into whose possession this Presentation comes should inform themselves about, and observe,
any such restrictions. Any failure to comply with these restrictions may constitute a violation of laws of any such jurisdiction.
• This Presentation includes certain forward-looking statements, estimates and projections with respect to the anticipated future performance of
Horizon Discovery plc, its products and the markets in which it operates. Forward-looking statements involve risks and uncertainties. Actual events
could differ materially from those projected herein and such statements, estimates and projections reflect the various assumptions made by the
Company which assumptions may or may not prove to be correct. These forward-looking statements speak only as at the date of this
Presentation. The Company expressly disclaims any obligation or undertaking to disseminate any updates or revisions to any forward-looking
statements contained in the Presentation to reflect any change in the Company’s expectations with regard thereto or any change in events,
conditions or circumstances on which any such statements are based.
• No part of this Presentation, or the fact of its distribution, should form the basis of or be relied upon in connection with any contract or
commitment or investment decision whatsoever. This Presentation does not constitute a recommendation regarding the securities of the
Company.
• By participating in and/or accepting delivery of this Presentation you agree to be bound by the foregoing restrictions and the other terms of this
disclaimer.
3
Presenter
Chris Thorne, PhD | Commercial Marketing Manager
Chris has been working at Horizon for four years, during which he has been responsible
for the genetic validation of all cell lines in Horizon’s catalogue, has been part of the
launch of Horizon’s diagnostic reference materials and has supported hundreds of
academic labs as they implement CRISPR genome editing with Horizon’s tools.
Prior to Horizon Chris completed his PhD at the University of Liverpool.
4
Contents
1. The Case for Genome Editing
2. What is Genome Editing and how is it done?
3. CRISPR-Cas9 – origins and it’s application to genome editing
5
The Genomic Era…
6
The Genomic Era…
1. Elucidate the organisation of
genetic networks and their
contribution to cellular and
organismal phenotypes
2. Understand heritable variations
and their association with health
and disease
3. Translate genome-based
knowledge into health benefits
Adapted from The US National Human Genome Research Institute, (2003) Nature
7
Gene function analysis | Patient-derived cell lines
Human cell lines contain
pre-existing mutations
are derived directly
from human tumors
Immense genetic
diversity
However
Lack of wild type
controls
Availability of rare
mutation models
Cell line diversity makes it very hard link observations to specific genetics
(Domke et al Nat. Comms 2013)
8
Gene function analysis | RNAi
Problems with RNAi can result in false positives or negatives
Loss of function analysis
using RNAi is
inexpensive and widely
applicable
Incomplete knockdown
However Lack of reproducibility
Off-target effects
Brass et al.
Science
273 genes
Total overlap
only 3 genes
Shalem et al Science 2014 HIV Host Factors
9
Gene function analysis | Overexpression
Overexpression of oncogenes can over represent their role in disease biology
Gain of function analysis
using overexpression is
inexpensive and widely
applicable
Result may be artefact
of overexpression
However
Difficult to achieve long-
term overexpression
• Large growth induction phenotype
• Transforming alone
• Milder growth induction phenotype
• Non-transforming alone
10
The Opportunity: Genome Editing
11
The Opportunity: Genome Editing
Adapted from The US National Human Genome Research Institute, (2003) Nature
1. Elucidate the organisation of
genetic networks and their
contribution to cellular and
organismal phenotypes
2. Understand heritable variations
and their association with health
and disease
3. Translate genome-based
knowledge into health benefits
Knockouts
Knock-ins
Gene Therapy
12
Genome Editing Tools
Non-
Nuclease
Nuclease
13
Nuclease mediated genome editing
Exon 1 Exon 2 Exon 3
Exon Exon 2 Exon 31
Nuclease-induced
DNA double-strand break
Non-homologous
end joining
Exon 1
Homology-directed repair
Exon 2
Exon 2Exon 2Exon 1
Frameshift mutation
Exon 1
14
CRISPR-Cas system: Adaptive immunity in bacteria
15
CRISPR-Cas9 | How does it work?
Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
16
CRISPR mediated genome editing
Exon 1 Exon 2 Exon 3
Exon Exon 2 Exon 31
Cas9 nuclease-induced
DNA double-strand break
Non-homologous
end joining
Exon 1
Homology-directed repair
Exon 2
Exon 2Exon 2Exon 1
Frameshift mutation
Exon 1
17
CRISPR-Cas9: How does it work?
AGCTGGGATCAACTATAGCG CGG
gRNA target sequence PAM
18
CRISPR Specificity
Cas9 Wild type Cas9 Nickase (Cas9n)
Induces double strand break Only “nicks” a single strand
Only requires single gRNA Requires two guide RNAs for reasonable activity
Concerns about off-target specificity Reduced likelihood of off-target events
High efficiency of cleavage
Especially good for random indels (= KO)
Guide efficiency dictated by efficiency of the weakest
gRNA
Nishimasu et al Cell
19
Hsu et al. Cell. 2014
20
... HOWEVER …
Cell Line
Engineered cells!
Genome Editing Vector
Screen for clones
21
Next time: The Key Considerations For CRISPR Gene Editing
Cell Line
Gene Target
Modification
Choice of guide
Strategy Design
Screening
Validation
 Is it suitable?
 Is it essential/expressed/amplified?
 Knockin vs knockout
 Efficiency vs specificity
 Donor design to maximise efficiency
 How many clones to find a positive?
 Is my engineering as expected?
22
And then… CRISPR modified cell lines
What’s possible and how they will impact your research
Exon 8 Exon 9 NanoLuc polyA
Exon 1 Exon 3
Translocations and Fusions
Gene tagging
Chromosomal deletions
Chr 1 Chr 19
Point mutations
Exon 8 Exon 9
*
Your Horizon Contact:
t + 44 (0)1223 655580
f + 44 (0)1223 655581
e info@horizondiscovery.com
w www.horizondiscovery.com
Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Your Horizon Contact:
t + 44 (0)1223 655580
f + 44 (0)1223 655581
e info@horizondiscovery.com
w www.horizondiscovery.com
Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Chris Thorne, PhD
Commercial Marketing Manager
c.thorne@horizondiscovery.com
+44 1223 204 799

More Related Content

What's hot

What's hot (20)

Crisper Cas system
Crisper Cas systemCrisper Cas system
Crisper Cas system
 
Crispr/cas9 101
Crispr/cas9 101Crispr/cas9 101
Crispr/cas9 101
 
Crispr-Cas9 technology
Crispr-Cas9 technologyCrispr-Cas9 technology
Crispr-Cas9 technology
 
CRISPR CAS9 technique
CRISPR CAS9 techniqueCRISPR CAS9 technique
CRISPR CAS9 technique
 
crispr cas 9
crispr cas 9crispr cas 9
crispr cas 9
 
CRISPR Cas 9 TECHNOLOGY
CRISPR Cas 9 TECHNOLOGYCRISPR Cas 9 TECHNOLOGY
CRISPR Cas 9 TECHNOLOGY
 
Crispr cas
Crispr casCrispr cas
Crispr cas
 
CRISPR in crop Improvement, CRISPR/Cas Genome editing tool
CRISPR in crop Improvement, CRISPR/Cas Genome editing toolCRISPR in crop Improvement, CRISPR/Cas Genome editing tool
CRISPR in crop Improvement, CRISPR/Cas Genome editing tool
 
Crispr technique
Crispr techniqueCrispr technique
Crispr technique
 
Crispr cas9 technology
Crispr cas9 technology Crispr cas9 technology
Crispr cas9 technology
 
Genome editing
Genome editingGenome editing
Genome editing
 
CRISPR-Cas9 system a tool for gene editing presentation
CRISPR-Cas9 system a tool for gene editing presentation CRISPR-Cas9 system a tool for gene editing presentation
CRISPR-Cas9 system a tool for gene editing presentation
 
Crispr cas9
Crispr cas9Crispr cas9
Crispr cas9
 
Crispr/Cas 9
Crispr/Cas 9Crispr/Cas 9
Crispr/Cas 9
 
Crispr cas
Crispr casCrispr cas
Crispr cas
 
CRISPR CAS
CRISPR CASCRISPR CAS
CRISPR CAS
 
CRISPR Presentation
CRISPR PresentationCRISPR Presentation
CRISPR Presentation
 
Crispr
CrisprCrispr
Crispr
 
Genome editing with CRISPR/Cas9
Genome editing with CRISPR/Cas9Genome editing with CRISPR/Cas9
Genome editing with CRISPR/Cas9
 
Crispr
CrisprCrispr
Crispr
 

Viewers also liked

Werner's Syndrome Keara and Tianna BIO 408 505
Werner's Syndrome Keara and Tianna BIO 408 505Werner's Syndrome Keara and Tianna BIO 408 505
Werner's Syndrome Keara and Tianna BIO 408 505
Keara Coffield
 
The Efficiency and Ethics of the CRISPR System in Human Embryos
The Efficiency and Ethics of the CRISPR System in Human EmbryosThe Efficiency and Ethics of the CRISPR System in Human Embryos
The Efficiency and Ethics of the CRISPR System in Human Embryos
Stephen Cranwell
 

Viewers also liked (15)

Crispr
CrisprCrispr
Crispr
 
Gene Editing - Challenges and Future of CRISPR in Clinical Development
Gene Editing - Challenges and Future of CRISPR in Clinical DevelopmentGene Editing - Challenges and Future of CRISPR in Clinical Development
Gene Editing - Challenges and Future of CRISPR in Clinical Development
 
The key considerations of crispr genome editing
The key considerations of crispr genome editingThe key considerations of crispr genome editing
The key considerations of crispr genome editing
 
Personalising CRISPR Genome Editing || Edward Perello || Disruptor Stories
Personalising CRISPR Genome Editing || Edward Perello || Disruptor StoriesPersonalising CRISPR Genome Editing || Edward Perello || Disruptor Stories
Personalising CRISPR Genome Editing || Edward Perello || Disruptor Stories
 
CRISPR: what it is, and why it is having a profound impact on human health
CRISPR: what it is, and why it is having a profound impact on human healthCRISPR: what it is, and why it is having a profound impact on human health
CRISPR: what it is, and why it is having a profound impact on human health
 
CRISPR
CRISPRCRISPR
CRISPR
 
A New molecular biology techniques for gene therapy
A New molecular biology techniques for gene therapyA New molecular biology techniques for gene therapy
A New molecular biology techniques for gene therapy
 
Review of CRISPR/Cas9
Review of CRISPR/Cas9Review of CRISPR/Cas9
Review of CRISPR/Cas9
 
Werner's Syndrome Keara and Tianna BIO 408 505
Werner's Syndrome Keara and Tianna BIO 408 505Werner's Syndrome Keara and Tianna BIO 408 505
Werner's Syndrome Keara and Tianna BIO 408 505
 
Crispr handbook 2015
Crispr handbook 2015Crispr handbook 2015
Crispr handbook 2015
 
The Efficiency and Ethics of the CRISPR System in Human Embryos
The Efficiency and Ethics of the CRISPR System in Human EmbryosThe Efficiency and Ethics of the CRISPR System in Human Embryos
The Efficiency and Ethics of the CRISPR System in Human Embryos
 
the application of CRISPR/Cas9 system in genome editing
the application of CRISPR/Cas9 system in genome editingthe application of CRISPR/Cas9 system in genome editing
the application of CRISPR/Cas9 system in genome editing
 
NAFLD Poster
NAFLD PosterNAFLD Poster
NAFLD Poster
 
Applications of crispr cas system
Applications of crispr cas systemApplications of crispr cas system
Applications of crispr cas system
 
Crispr cas ppt by ashish
Crispr cas ppt by ashishCrispr cas ppt by ashish
Crispr cas ppt by ashish
 

Similar to An Introduction to Crispr Genome Editing

ANGLE Peliminary Results 2013 31jul13
ANGLE Peliminary Results 2013 31jul13ANGLE Peliminary Results 2013 31jul13
ANGLE Peliminary Results 2013 31jul13
ANGLE plc
 
ANGLE Interim Results 2013 31jan13
ANGLE Interim Results 2013 31jan13ANGLE Interim Results 2013 31jan13
ANGLE Interim Results 2013 31jan13
ANGLE plc
 
Act annual-shareholders'-meeting-10.22.13
Act annual-shareholders'-meeting-10.22.13Act annual-shareholders'-meeting-10.22.13
Act annual-shareholders'-meeting-10.22.13
John Redaelli
 

Similar to An Introduction to Crispr Genome Editing (20)

Aug2015 horizon diagnostics
Aug2015 horizon diagnosticsAug2015 horizon diagnostics
Aug2015 horizon diagnostics
 
Jan2016 horizon GIAB
Jan2016 horizon GIABJan2016 horizon GIAB
Jan2016 horizon GIAB
 
Aug2014 horizon dx
Aug2014 horizon dxAug2014 horizon dx
Aug2014 horizon dx
 
HDx™ Reference Standards and Reference Materials for Next Generation Sequenci...
HDx™ Reference Standards and Reference Materials for Next Generation Sequenci...HDx™ Reference Standards and Reference Materials for Next Generation Sequenci...
HDx™ Reference Standards and Reference Materials for Next Generation Sequenci...
 
Parsortix non-invasive cancer diagnostics | 3 September 2014
Parsortix non-invasive cancer diagnostics | 3 September 2014Parsortix non-invasive cancer diagnostics | 3 September 2014
Parsortix non-invasive cancer diagnostics | 3 September 2014
 
Shares Investor Evening 29 October 2014
Shares Investor Evening 29 October 2014Shares Investor Evening 29 October 2014
Shares Investor Evening 29 October 2014
 
TLSA Investor Presentation September 2021
TLSA Investor Presentation September 2021TLSA Investor Presentation September 2021
TLSA Investor Presentation September 2021
 
The Stock Market Show | 13 September 2014
The Stock Market Show | 13 September 2014The Stock Market Show | 13 September 2014
The Stock Market Show | 13 September 2014
 
ANGLE Peliminary Results 2013 31jul13
ANGLE Peliminary Results 2013 31jul13ANGLE Peliminary Results 2013 31jul13
ANGLE Peliminary Results 2013 31jul13
 
ANGLE Interim Results 2013 31jan13
ANGLE Interim Results 2013 31jan13ANGLE Interim Results 2013 31jan13
ANGLE Interim Results 2013 31jan13
 
Church SFAF2014 keynote
Church SFAF2014 keynoteChurch SFAF2014 keynote
Church SFAF2014 keynote
 
Globavir Presentation
Globavir PresentationGlobavir Presentation
Globavir Presentation
 
ANGLE Presentation 4 February 2014 Shares Cenkos Investor Forum
ANGLE Presentation 4 February 2014 Shares Cenkos Investor Forum ANGLE Presentation 4 February 2014 Shares Cenkos Investor Forum
ANGLE Presentation 4 February 2014 Shares Cenkos Investor Forum
 
Actinogen Medical - ASX: ACW
Actinogen Medical - ASX: ACWActinogen Medical - ASX: ACW
Actinogen Medical - ASX: ACW
 
TLSA Investor Presentation October 2021
TLSA Investor Presentation October 2021TLSA Investor Presentation October 2021
TLSA Investor Presentation October 2021
 
Cidara Presentation - December 2021
Cidara Presentation - December 2021Cidara Presentation - December 2021
Cidara Presentation - December 2021
 
TLSA Investor Presentation August 2021
TLSA Investor Presentation August 2021TLSA Investor Presentation August 2021
TLSA Investor Presentation August 2021
 
ACT Annual Shareholders' Meeting, October 22, 2013
ACT Annual Shareholders' Meeting, October 22, 2013ACT Annual Shareholders' Meeting, October 22, 2013
ACT Annual Shareholders' Meeting, October 22, 2013
 
Act annual-shareholders'-meeting-10.22.13
Act annual-shareholders'-meeting-10.22.13Act annual-shareholders'-meeting-10.22.13
Act annual-shareholders'-meeting-10.22.13
 
Company Overview Presentation Nov 2015
Company Overview Presentation Nov 2015Company Overview Presentation Nov 2015
Company Overview Presentation Nov 2015
 

Recently uploaded

Cyathodium bryophyte: morphology, anatomy, reproduction etc.
Cyathodium bryophyte: morphology, anatomy, reproduction etc.Cyathodium bryophyte: morphology, anatomy, reproduction etc.
Cyathodium bryophyte: morphology, anatomy, reproduction etc.
Silpa
 
CYTOGENETIC MAP................ ppt.pptx
CYTOGENETIC MAP................ ppt.pptxCYTOGENETIC MAP................ ppt.pptx
CYTOGENETIC MAP................ ppt.pptx
Silpa
 
biology HL practice questions IB BIOLOGY
biology HL practice questions IB BIOLOGYbiology HL practice questions IB BIOLOGY
biology HL practice questions IB BIOLOGY
1301aanya
 
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Sérgio Sacani
 
Digital Dentistry.Digital Dentistryvv.pptx
Digital Dentistry.Digital Dentistryvv.pptxDigital Dentistry.Digital Dentistryvv.pptx
Digital Dentistry.Digital Dentistryvv.pptx
MohamedFarag457087
 
Reboulia: features, anatomy, morphology etc.
Reboulia: features, anatomy, morphology etc.Reboulia: features, anatomy, morphology etc.
Reboulia: features, anatomy, morphology etc.
Silpa
 
The Mariana Trench remarkable geological features on Earth.pptx
The Mariana Trench remarkable geological features on Earth.pptxThe Mariana Trench remarkable geological features on Earth.pptx
The Mariana Trench remarkable geological features on Earth.pptx
seri bangash
 

Recently uploaded (20)

PATNA CALL GIRLS 8617370543 LOW PRICE ESCORT SERVICE
PATNA CALL GIRLS 8617370543 LOW PRICE ESCORT SERVICEPATNA CALL GIRLS 8617370543 LOW PRICE ESCORT SERVICE
PATNA CALL GIRLS 8617370543 LOW PRICE ESCORT SERVICE
 
Cyathodium bryophyte: morphology, anatomy, reproduction etc.
Cyathodium bryophyte: morphology, anatomy, reproduction etc.Cyathodium bryophyte: morphology, anatomy, reproduction etc.
Cyathodium bryophyte: morphology, anatomy, reproduction etc.
 
Thyroid Physiology_Dr.E. Muralinath_ Associate Professor
Thyroid Physiology_Dr.E. Muralinath_ Associate ProfessorThyroid Physiology_Dr.E. Muralinath_ Associate Professor
Thyroid Physiology_Dr.E. Muralinath_ Associate Professor
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.
 
Genome sequencing,shotgun sequencing.pptx
Genome sequencing,shotgun sequencing.pptxGenome sequencing,shotgun sequencing.pptx
Genome sequencing,shotgun sequencing.pptx
 
CYTOGENETIC MAP................ ppt.pptx
CYTOGENETIC MAP................ ppt.pptxCYTOGENETIC MAP................ ppt.pptx
CYTOGENETIC MAP................ ppt.pptx
 
Gwalior ❤CALL GIRL 84099*07087 ❤CALL GIRLS IN Gwalior ESCORT SERVICE❤CALL GIRL
Gwalior ❤CALL GIRL 84099*07087 ❤CALL GIRLS IN Gwalior ESCORT SERVICE❤CALL GIRLGwalior ❤CALL GIRL 84099*07087 ❤CALL GIRLS IN Gwalior ESCORT SERVICE❤CALL GIRL
Gwalior ❤CALL GIRL 84099*07087 ❤CALL GIRLS IN Gwalior ESCORT SERVICE❤CALL GIRL
 
Factory Acceptance Test( FAT).pptx .
Factory Acceptance Test( FAT).pptx       .Factory Acceptance Test( FAT).pptx       .
Factory Acceptance Test( FAT).pptx .
 
biology HL practice questions IB BIOLOGY
biology HL practice questions IB BIOLOGYbiology HL practice questions IB BIOLOGY
biology HL practice questions IB BIOLOGY
 
TransientOffsetin14CAftertheCarringtonEventRecordedbyPolarTreeRings
TransientOffsetin14CAftertheCarringtonEventRecordedbyPolarTreeRingsTransientOffsetin14CAftertheCarringtonEventRecordedbyPolarTreeRings
TransientOffsetin14CAftertheCarringtonEventRecordedbyPolarTreeRings
 
Zoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfZoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdf
 
Dr. E. Muralinath_ Blood indices_clinical aspects
Dr. E. Muralinath_ Blood indices_clinical  aspectsDr. E. Muralinath_ Blood indices_clinical  aspects
Dr. E. Muralinath_ Blood indices_clinical aspects
 
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
 
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryFAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
 
Digital Dentistry.Digital Dentistryvv.pptx
Digital Dentistry.Digital Dentistryvv.pptxDigital Dentistry.Digital Dentistryvv.pptx
Digital Dentistry.Digital Dentistryvv.pptx
 
Site Acceptance Test .
Site Acceptance Test                    .Site Acceptance Test                    .
Site Acceptance Test .
 
Reboulia: features, anatomy, morphology etc.
Reboulia: features, anatomy, morphology etc.Reboulia: features, anatomy, morphology etc.
Reboulia: features, anatomy, morphology etc.
 
Molecular markers- RFLP, RAPD, AFLP, SNP etc.
Molecular markers- RFLP, RAPD, AFLP, SNP etc.Molecular markers- RFLP, RAPD, AFLP, SNP etc.
Molecular markers- RFLP, RAPD, AFLP, SNP etc.
 
Use of mutants in understanding seedling development.pptx
Use of mutants in understanding seedling development.pptxUse of mutants in understanding seedling development.pptx
Use of mutants in understanding seedling development.pptx
 
The Mariana Trench remarkable geological features on Earth.pptx
The Mariana Trench remarkable geological features on Earth.pptxThe Mariana Trench remarkable geological features on Earth.pptx
The Mariana Trench remarkable geological features on Earth.pptx
 

An Introduction to Crispr Genome Editing

  • 1. HORIZON DISCOVERY An Introduction To CRISPR Genome Editing Chris Thorne, PhD | Commercial Marketing Manager
  • 2. 2 Disclaimer 2 • This Presentation does not constitute or form any part of an offer to sell, or invitation to purchase or apply for or enter into any contract or make any other commitment whatsoever in relation to, securities. Although reasonable care has been taken to ensure that the facts stated in this Presentation are accurate and that the opinions expressed are fair and reasonable, the contents of this Presentation have not been formally verified by Horizon Discovery plc (the “Company”) or any other person. Accordingly, no representation or warranty, expressed or implied, is made as to the fairness, accuracy, completeness or correctness of the information and opinions contained in this Presentation and no reliance should be placed on such information or opinions. Further, the information in this Presentation is not complete and is subject to updating, revision, further verification and amendment. Neither the Company, nor any of its subsidiaries, nor any of its respective members, directors, officers or employees nor any other person accepts any liability whatsoever for any loss howsoever arising from any use of such information or opinions or otherwise arising in connection with this Presentation. • Accordingly, information contained in the Presentation is being supplied to you solely for your information and may not be copied, reproduced or further distributed to any person or published in whole or in part, for any purpose. In particular, the distribution of this Presentation in certain jurisdictions may be restricted by law, and persons into whose possession this Presentation comes should inform themselves about, and observe, any such restrictions. Any failure to comply with these restrictions may constitute a violation of laws of any such jurisdiction. • This Presentation includes certain forward-looking statements, estimates and projections with respect to the anticipated future performance of Horizon Discovery plc, its products and the markets in which it operates. Forward-looking statements involve risks and uncertainties. Actual events could differ materially from those projected herein and such statements, estimates and projections reflect the various assumptions made by the Company which assumptions may or may not prove to be correct. These forward-looking statements speak only as at the date of this Presentation. The Company expressly disclaims any obligation or undertaking to disseminate any updates or revisions to any forward-looking statements contained in the Presentation to reflect any change in the Company’s expectations with regard thereto or any change in events, conditions or circumstances on which any such statements are based. • No part of this Presentation, or the fact of its distribution, should form the basis of or be relied upon in connection with any contract or commitment or investment decision whatsoever. This Presentation does not constitute a recommendation regarding the securities of the Company. • By participating in and/or accepting delivery of this Presentation you agree to be bound by the foregoing restrictions and the other terms of this disclaimer.
  • 3. 3 Presenter Chris Thorne, PhD | Commercial Marketing Manager Chris has been working at Horizon for four years, during which he has been responsible for the genetic validation of all cell lines in Horizon’s catalogue, has been part of the launch of Horizon’s diagnostic reference materials and has supported hundreds of academic labs as they implement CRISPR genome editing with Horizon’s tools. Prior to Horizon Chris completed his PhD at the University of Liverpool.
  • 4. 4 Contents 1. The Case for Genome Editing 2. What is Genome Editing and how is it done? 3. CRISPR-Cas9 – origins and it’s application to genome editing
  • 6. 6 The Genomic Era… 1. Elucidate the organisation of genetic networks and their contribution to cellular and organismal phenotypes 2. Understand heritable variations and their association with health and disease 3. Translate genome-based knowledge into health benefits Adapted from The US National Human Genome Research Institute, (2003) Nature
  • 7. 7 Gene function analysis | Patient-derived cell lines Human cell lines contain pre-existing mutations are derived directly from human tumors Immense genetic diversity However Lack of wild type controls Availability of rare mutation models Cell line diversity makes it very hard link observations to specific genetics (Domke et al Nat. Comms 2013)
  • 8. 8 Gene function analysis | RNAi Problems with RNAi can result in false positives or negatives Loss of function analysis using RNAi is inexpensive and widely applicable Incomplete knockdown However Lack of reproducibility Off-target effects Brass et al. Science 273 genes Total overlap only 3 genes Shalem et al Science 2014 HIV Host Factors
  • 9. 9 Gene function analysis | Overexpression Overexpression of oncogenes can over represent their role in disease biology Gain of function analysis using overexpression is inexpensive and widely applicable Result may be artefact of overexpression However Difficult to achieve long- term overexpression • Large growth induction phenotype • Transforming alone • Milder growth induction phenotype • Non-transforming alone
  • 11. 11 The Opportunity: Genome Editing Adapted from The US National Human Genome Research Institute, (2003) Nature 1. Elucidate the organisation of genetic networks and their contribution to cellular and organismal phenotypes 2. Understand heritable variations and their association with health and disease 3. Translate genome-based knowledge into health benefits Knockouts Knock-ins Gene Therapy
  • 13. 13 Nuclease mediated genome editing Exon 1 Exon 2 Exon 3 Exon Exon 2 Exon 31 Nuclease-induced DNA double-strand break Non-homologous end joining Exon 1 Homology-directed repair Exon 2 Exon 2Exon 2Exon 1 Frameshift mutation Exon 1
  • 14. 14 CRISPR-Cas system: Adaptive immunity in bacteria
  • 15. 15 CRISPR-Cas9 | How does it work? Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
  • 16. 16 CRISPR mediated genome editing Exon 1 Exon 2 Exon 3 Exon Exon 2 Exon 31 Cas9 nuclease-induced DNA double-strand break Non-homologous end joining Exon 1 Homology-directed repair Exon 2 Exon 2Exon 2Exon 1 Frameshift mutation Exon 1
  • 17. 17 CRISPR-Cas9: How does it work? AGCTGGGATCAACTATAGCG CGG gRNA target sequence PAM
  • 18. 18 CRISPR Specificity Cas9 Wild type Cas9 Nickase (Cas9n) Induces double strand break Only “nicks” a single strand Only requires single gRNA Requires two guide RNAs for reasonable activity Concerns about off-target specificity Reduced likelihood of off-target events High efficiency of cleavage Especially good for random indels (= KO) Guide efficiency dictated by efficiency of the weakest gRNA Nishimasu et al Cell
  • 19. 19 Hsu et al. Cell. 2014
  • 20. 20 ... HOWEVER … Cell Line Engineered cells! Genome Editing Vector Screen for clones
  • 21. 21 Next time: The Key Considerations For CRISPR Gene Editing Cell Line Gene Target Modification Choice of guide Strategy Design Screening Validation  Is it suitable?  Is it essential/expressed/amplified?  Knockin vs knockout  Efficiency vs specificity  Donor design to maximise efficiency  How many clones to find a positive?  Is my engineering as expected?
  • 22. 22 And then… CRISPR modified cell lines What’s possible and how they will impact your research Exon 8 Exon 9 NanoLuc polyA Exon 1 Exon 3 Translocations and Fusions Gene tagging Chromosomal deletions Chr 1 Chr 19 Point mutations Exon 8 Exon 9 *
  • 23. Your Horizon Contact: t + 44 (0)1223 655580 f + 44 (0)1223 655581 e info@horizondiscovery.com w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Your Horizon Contact: t + 44 (0)1223 655580 f + 44 (0)1223 655581 e info@horizondiscovery.com w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Chris Thorne, PhD Commercial Marketing Manager c.thorne@horizondiscovery.com +44 1223 204 799

Editor's Notes

  1. Pleasure to be here to today to tell you more about Horizon and our suite of technologies based around a core expertise in human genome editing and how we are applying this to better understand the human genome, find new validated targets and support targeted drug discovery with predictive, genetically-defined, in vitro models that accurately represent target patient groups.
  2. As researchers working in the era of the human genome, with unparalleled access to genetic information obtained from healthy and diseased individuals the challenge has fundamentally shifted from obtaining that information to understanding what it means. And the reason for this, is that by understanding the genetic drivers of disease we can identify individuals with these genetics and tailor specific therapies to treat their diseases – the era of personalised medicine. And A better understanding of the genetics of disease stands to impact not just patient prognosis, but also drug development outcomes, as targets can be identified and rationalised more rapidly, and suitable clinical and patient populations identified – allowing companies to fail ineffective drugs faster, and get effective drugs to market quicker. In the past researchers had (broadly speaking) three options open to them to explore gene function which are: Using patient derived cell lines with preexisting disease-associated mutations to study gene function Using RNAi based loss of function study the effect of removing a gene from the system Using overexpression based gain of function experiments
  3. And in fact when the HGP finished in 2003 the US NHGR Insti proposed some grand challenges to translate the wealthof genomic information that had been (and continues to be) generated, and these were: 1,2,3 Now in a cell biology context, these challenges have been broadly speaking addresses in three ways. If you make a genetic observation about a disease the first thing you can do is…
  4. The first of these is to find a pre-existing human cell line with the same genetic aberation and use this as a model system to study your gene. Ideally this would be compared to a cell line that lacks the mutation. However with leaps forward in sequencing technology we have come to appreciate the genetic diversity of human cell line models And so this can make attributing any phenotypic observations to a specific genetic observations challenging, with each cell line potentially containing tens of mutations that might be drivers or simply passengers.
  5. Another approach to studying a gene is to remove it from the system using RNAi, and look for phenotypic effects. RNAi is not without it’s weaknesses however. Whilst easy to use it is often challenging to achieve a complete knockdown of expression, and residual 5-10% of a transcript can result in masked phenotypes. Further to this as this study demonstrates RNAi screens are often difficult to reproduce – here we see three screens looking for HIV host factors, with an overlap of just 3 genes between the three. Hence there is a very real risk of fast positives or negatives inherent to the technology.
  6. So rather than removing the gene from the system the next approach is to overexpress it as a transgene – either in wild type or mutant form and again look for effects on phenotype. Overexpression can itself however be the cause of phenotypic changes – a huge over abundance of protein can lead to miscompartmentalisation and mistrafficking of proteins which in turn can lead to non-biological functional consequences Over expression of the oncogenic form of PI3 Kinase in a normal epithelial cell line results in a large growth induction phenotype and transformation of those cells. If you knock-in the same mutation at the endogenous locus the phenotype is much milder – with the mutation not being transforming by itself, In other words over expression of oncogenes can over represent their role in disease biology.
  7. …nucleases such as CRISPR, ZFNs and TALENs all rely in cleavage of a target site in the genome to stimulate a DNA repair pathway and elicit a change. This is often a highly efficient process, meaning editing efficiencies can be very high with these systems. They come with an inherent risk however (a risk that varies depending on the system you’re using) which is that the nuclease could in theory cut elswhere in the genome without you knowing about it – and you may end up with off target modifications.
  8. Generally speaking when targeting genes of interest two DNA repair pathways are used to mediate the majority of genomic modifications we want to make. The first of these is NHEJ HR
  9. s. pyogenes
  10. The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community. The system itself is comprised of three key components the Cas9 protein, which cuts/cleaves the DNA and Two RNAs - a crispr RNA contains a sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site. This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
  11. Irrespective of which tool you’re using however, the process of genome editing relies on the use of the cells own DNA repair pathways to elicit changes to a target locus, and the function of these tools is to stimulate these pathways, and ideally make changes in a predictible way. Generally speaking when targeting genes of interest two types of genomic modifications represent the majority of the projects we undertake, and with CRISPR-Cas9 you can leverage either pathway with different levels of efficiency NHEJ HR
  12. The design rules for CRISPR are straightforward, as you require only a 23 nucleotide sequence that ends in an NGG motif – known as the protospacer associated motif (or PAM site). Of this 23bases, only the first 20 are included in the guide target sequence which is appended to the tracrRNA “fixed scaffold” and together comprise the gRNA. So as the only requirement is this NGG, on average eligible PAM sites can be found every 12bp, although this will depends on sequence Several tools for gRNA design – HD has our own. One of the key considerations is what is the off target potential of my guide – very often even a 23 base pair sequence will be found elsewhere in the enormity of the genome, and even if an exact match isn’t observed there may be instances of homology with a few mismatches. In fact the specificity of the CRISPR system remains a concern for researchers, especially where minimising off target modifications is critical, such as those working in the field of gene therapy. Various approaches are being taken improve specificity - Interestingly recent work by Keith Joung’s lab has shown using a 17bp target region can reduce some of the off target potential that guides have
  13. Another approach has been to mutate the nuclease such that it will only nick one strand of the dsDNA, a nickase form of the protein. Nicks will in general be repaired by the base excision repair pathway which is significantly higher fidelity than NHEJ. Targeting strategies using the nickase are designed with two gRNAs, one to recruit the nickase to each strand of the DNA, only after which a DSB will be introduced. This increase in specificity is unfortunately at the expense of some efficiency at you’re at the mercy of your weakest guide in the pair
  14. For