Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
CRISPR: Gene editing for everyone. 
Join the Program Now! 
Our mission 
“to translate the human genome and accelerate 
the discovery of personalised medicines” 
Tailoring the right ...
The opportunity: translating genetic information into personalised medicines 
 Information is no longer a bottleneck, emp...
GENESIS™: Comprehensive genome editing 
 Horizon is the only source of rAAV expertise and is uniquely capable of exploiti...
Table of Contents 
 The CRISPR/Cas9 gene editing system 
 Using CRISPR to generate knock-outs and knock-ins 
• Case stud...
The CRISPR/Cas9 System 
RNA-guided platform to introduce either a cut at a specified location in the genome. 
 Short ‘gui...
The CRISPR/Cas9 System 
Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
The CRISPR/Cas9 System 
gRNA target sequence PAM 
Cas9 wild-type or Cas9 nickase? 
Nishimasu et al Cell 
Cas9 Wild type Cas9 Nickase (Cas9n) 
Induces double strand break On...
Designing a guide RNA 
 Cas9 wild-type: The cut site occurs 3 bp 5’ of the PAM sequence 
gRNA target sequence PAM 
Designing a guide RNA 
Ran et al Cell 2014
Table of Contents 
 The CRISPR/Cas9 gene editing system 
 Using CRISPR to generate knock-outs and knock-ins 
• Case stud...
Using CRISPR to Generate Gene KOs and KIs 
Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3...
Using CRISPR to Generate Gene KOs and KIs 
Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3...
Using CRISPR to Generate Gene KOs and KIs 
Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitut...
Using CRISPR to Generate Gene KOs and KIs 
Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitut...
On the surface genome editing with CRISPR appears as simple as: 
Identifying a gRNA target sequence 
Ordering an oligo wit...
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Limiting re-cutting by the gRNA can improve the odds (… greatly)
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Key Considerations For CRISPR Gene Editing 
Gene Target Specifics 
Cell Line 
gRNA Design 
gRNA Activity 
Donor Design 
Table of Contents 
 The CRISPR/Cas9 gene editing system 
 Using CRISPR to generate knock-outs and knock-ins 
• Case stud...
Other applications of the CRISPR platform 
 (A) Nuclease or Nickase 
 (B) Two nickase complexes can mimic targeted 
sgRNA Screening 
Lentivirally delivered sgRNA can drive efficient cleavage of target genomic 
sequences for use in whole ...
sgRNA Screening 
Shalem et al Science 2014
Cas9/sgRNA suppresses gene expression far more effectively than shRNA 
Shalem et al Science 2014
Synthetic Lethality sgRNA Screening 
We are integrating CRISPR-based Synthetic Lethality Screens into our platform 
LentiCRISPR v2 reagents and GeCKO v2 library 
 Due to large vector size, only low titers were achievable with version 1 v...
LentiCRISPR v2 reagents and GeCKO v2 library 
 ~120,000 guideRNAs against ~19,000 genes 
 6 guides vs. each gene in two ...
LentiCRISPR v2 reagents and GeCKO v2 library 
GeCKO v2 library has now arrived 
Library amplification + QC 
Lentivirus ...
Table of Contents 
 The CRISPR/Cas9 gene editing system 
 Using CRISPR to generate knock-outs and knock-ins 
• Case stud...
Horizons CRISPR developments: Combining rAAV + CRISPR 
 Can we combine technologies for improved efficiency? 
 Tested us...
Horizons CRISPR developments: Free CRISPR Reagents for Knock-Outs 
 Open to all academic researchers 
 Free guide design...
GENASSIST: CRISPR and rAAV enabled gene editing 
Cas9 Vectors 
• Wild type and nickase 
• Separate or combined with guide ...
CRISPR and rAAV Intellectual property 
It is Horizon's intent to ensure that our customers have a risk free environment to...
Your Horizon Contact: 
Chris Thorne PhD 
Gene Editing Community Specialist 
+44 1223 204799...
Useful Resources 
From Horizon 
 Free gRNAs in Cas9 wild type vector – 
 Technical ma...
Upcoming SlideShare
Loading in …5

CRISPR - gene-editing for everyone

Have you considered that protein over-expression or inefficient mRNA knockdown may be masking physiological effects in your assays? Increasingly scientists are moving to endogenous gene-editing to characterise the function of their genes of interest.

Dr Chris Thorne from Cambridge Biotech Horizon Discovery discusses the ground breaking gene-editing technology CRISPR. The simplicity of experimental design has led to rapid adoption of the technology across the scientific community. However, challenges remain.

This Slidedeck focuses specifically on implementing CRISPR experiments, and explore a number of key considerations crucial to maximising chances of targeting success, whether your goal is to generate a knock-out or a knock-in. Chris also takes a look at some of the alternative uses of CRISPR, including sgRNA genome wide synthetic lethality screens.

The slides aim to support those researchers either planning to or already using CRISPR gene-editing in their lab. Horizon Discovery have also recently launched a program aimed specifically at academic cell biologists to promote the adoption of CRISPR by offering FREE CRISPR Reagents for knock-out cell line generation - more information available here.

Related Books

Free with a 30 day trial from Scribd

See all
  • Be the first to comment

CRISPR - gene-editing for everyone

  1. 1. GENASSIST™ CRISPR: Gene editing for everyone. Join the Program Now! Visit FREE CRISPR Reagents for Knockout Generation
  2. 2. Our mission “to translate the human genome and accelerate the discovery of personalised medicines” Tailoring the right the right the right time Horizon Discovery Ltd. 7100 Cambridge Research Park, UK 2
  3. 3. The opportunity: translating genetic information into personalised medicines  Information is no longer a bottleneck, emphasis is shifting to the ‘what does it all mean’  Genome editing is enabling the promise of the genomic era to be realized in the form of novel therapeutics and diagnostics  It involves the capability to efficiently introduce targeted alterations into any specific gene in living cells 3
  4. 4. GENESIS™: Comprehensive genome editing  Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project rAAV • High precision / low thru-put • Any locus, wide cell tropism • Well validated, KI focus Zinc Fingers • Med precision / med thru-put • Good genome coverage • Well validated / KO Focus CRISPR • New but high potential • Capable of multi-gene targeting • Simple RNA-directed cleavage • Combinable with AAV 4
  5. 5. Table of Contents  The CRISPR/Cas9 gene editing system  Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells  Key considerations for CRISPR gene editing  Other CRISPR applications • Case study: sgRNA library screening  CRISPR at developments at Horizon Discovery and beyond
  6. 6. The CRISPR/Cas9 System RNA-guided platform to introduce either a cut at a specified location in the genome.  Short ‘guide’ RNAs with homology to target loci direct a generic nuclease (Cas9)  Guide RNA + Cas9 are delivered into the cell  Cas9 cleavage is repaired by either NHEJ, or HDR in tandem with a donor  High efficiencies of knockout or knock-in
  7. 7. The CRISPR/Cas9 System Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
  8. 8. The CRISPR/Cas9 System gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG
  9. 9. Cas9 wild-type or Cas9 nickase? Nishimasu et al Cell Cas9 Wild type Cas9 Nickase (Cas9n) Induces double strand break Only “nicks” a single strand Only requires single gRNA Requires two guide RNAs for reasonable activity Concerns about off-target specificity Reduced likelihood of off-target events High efficiency of cleavage Especially good for random indels (= KO) Guide efficiency dictated by efficiency of the weakest gRNA
  10. 10. Designing a guide RNA  Cas9 wild-type: The cut site occurs 3 bp 5’ of the PAM sequence gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG TCGACCCTAGTTGATATCGC GCC  Cas9n (D10a): the single strand nick occurs on the opposite strand gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG TCGACCCTAGTTGATATCGC GCC
  11. 11. Designing a guide RNA Ran et al Cell 2014
  12. 12. Table of Contents  The CRISPR/Cas9 gene editing system  Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells  Key considerations for CRISPR gene editing  Other CRISPR applications • Case study: sgRNA library screening  CRISPR at developments at Horizon Discovery and beyond
  13. 13. Using CRISPR to Generate Gene KOs and KIs Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3) Conserved exon 3 targeted 96 Clones Screened 28 Positive for cutting 7 Clones Sequenced 3 Clones with indels on all three alleles ENSEMBL
  14. 14. Using CRISPR to Generate Gene KOs and KIs Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3) 1 2 3 Parental Allele 1 Allele 2 Allele 3
  15. 15. Using CRISPR to Generate Gene KOs and KIs Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression 1 2 3 4 THUMPD3 Plasmid donor Cas9n BGH PolyA SV40 NLS hROSA26 locus 635 bp 571 bp
  16. 16. Using CRISPR to Generate Gene KOs and KIs Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression Negative control gRNA 1 only gRNA 2 only gRNA 1 and 2 gRNA 1 and 2 + Cas9n 600bp 500bp 400bp 300bp 200bp 100bp Clones Screened 10% Positive for integration All positives contained only a single insertion All positives contained indels in second allele
  17. 17. On the surface genome editing with CRISPR appears as simple as: Identifying a gRNA target sequence Ordering an oligo with the target sequence and cloning it into a gRNA vector Transfecting cells with the gRNA + Cas9 ... HOWEVER …
  18. 18. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation
  19. 19. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Gene copy number  Number and nature of modified alleles  Effect of modification on growth Normal human karyotype HeLa cell karyotype
  20. 20. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Transfection/electroporation  Single-cell dilution  Optimal growth conditions
  21. 21. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Sequence source  Off-target potential  Guide proximity  Wild-type Cas9 or mutant nickase
  22. 22. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Number of gRNAs  gRNA activity measurement NT Cas9 wt only gRNA uncut 1 2 3 4 5 600 500 400 300 200 100 +ve 700 700 600 500 400 300 200 100
  23. 23. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Donor sequence modifications  Modification effects on expression or splicing  Donor size  Type of donor (AAV, oligo, plasmid)  Selection based strategies Cas9 Cut Site Genomic Sequence Donor Sequence containing mutation
  24. 24. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Donor sequence modifications  Modification effects on expression or splicing  Donor size  Type of donor (AAV, oligo, plasmid)  Selection based strategies (+/+) (KI/KI) (+/-) (KI/-) (-/-) (KI/+)
  25. 25. Limiting re-cutting by the gRNA can improve the odds (… greatly)
  26. 26. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Number of cells to screen  Screening strategy  Modifications on different alleles  Homozygous or heterozygous modifications versus mixed cultures % cells targeted
  27. 27. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  Confirmatory genotyping strategies  Off-target site analysis  Genetic drift/stability  Modification expression  Contamination Heterozygous knock-in Wild type
  28. 28. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation  How many copies?  Is it suitable?  What’s my goal? (Precision vs Efficiency)  Does my guide cut?  Have I minimised re-cutting?  How many clones to find a positive?  Is my engineering as expected?
  29. 29. Table of Contents  The CRISPR/Cas9 gene editing system  Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells  Key considerations for CRISPR gene editing  Other CRISPR applications • Case study: sgRNA library screening  CRISPR at developments at Horizon Discovery and beyond
  30. 30. Other applications of the CRISPR platform  (A) Nuclease or Nickase  (B) Two nickase complexes can mimic targeted DSBs via cooperative nicks  (C) Expression of all components from one plasmid  (D) Purified Cas9 protein and in vitro transcribed gRNA can be microinjected into fertilized zygotes  (E) Viral vectors encoding CRISPR reagents can be transduced into tissues or cells of interest.  (F) Genome-scale functional screening can be facilitated by mass synthesis and delivery of guide RNA libraries.  (G) Catalytically dead Cas9 can be fused to functional effectors such as transcriptional activators or epigenetic enzymes.  (H) Cas9 coupled to fluorescent reporters facilitates live imaging of DNA loci  (I) Inducible reconstituting split fragments of Cas9 confers temporal control of dynamic cellular processes. Hsu et al. Cell. 2014
  31. 31. sgRNA Screening Lentivirally delivered sgRNA can drive efficient cleavage of target genomic sequences for use in whole genome screens Use massively-parallel next-gen sequencing to assess results Possible addition/replacement to RNAi screens
  32. 32. 32 sgRNA Screening Shalem et al Science 2014
  33. 33. Cas9/sgRNA suppresses gene expression far more effectively than shRNA Shalem et al Science 2014
  34. 34. 34 Synthetic Lethality sgRNA Screening We are integrating CRISPR-based Synthetic Lethality Screens into our platform sgRNA technology will be transformational for both Target ID and early-stage Target Validation
  35. 35. LentiCRISPR v2 reagents and GeCKO v2 library  Due to large vector size, only low titers were achievable with version 1 vectors → large-scale v1 library virus production (and concentration)  By vector element clean-up and optimization, v2 vectors produce ~10-fold higher titers  Additional two-vector lentiviral system now available for hard-to-infect cell lines Sanjana et al. Nature Methods 2014
  36. 36. LentiCRISPR v2 reagents and GeCKO v2 library  ~120,000 guideRNAs against ~19,000 genes  6 guides vs. each gene in two half-libraries (3 guides/gene in Library A or B)  1000 non-targeting sgRNAs Sanjana et al. Nature Methods 2014
  37. 37. LentiCRISPR v2 reagents and GeCKO v2 library GeCKO v2 library has now arrived Library amplification + QC Lentivirus production • Determine MOI for GeCKO v2 library lentivirus Two-vector v2 lentiCRISPR system upgraded to include fluorescent tags for rapid hit validation by dual-colour co-culture experiments GFP P2A lentiGuide- Puro_P2A_tGFP RFP P2A lentiGuide- Puro_P2A_tRFP
  38. 38. Table of Contents  The CRISPR/Cas9 gene editing system  Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells  Key considerations for CRISPR gene editing  Other CRISPR applications • Case study: sgRNA library screening  CRISPR at developments at Horizon Discovery and beyond
  39. 39. Horizons CRISPR developments: Combining rAAV + CRISPR  Can we combine technologies for improved efficiency?  Tested using a reporter cell-line harbouring an inactivating mutation in GFP  Correction donor-vector supplied either as dsPlasmid, ssDNA oligos, or ssDNA rAAV  rAAV = the most efficient donor vector (50 fold) % Green cells (FACs)
  40. 40. Horizons CRISPR developments: Free CRISPR Reagents for Knock-Outs  Open to all academic researchers  Free guide design using gUIDEbook, Horizon’s in silico guide design software  Free cloning 5 guides cloned into all-in-one plasmids that express Cas9  Must let Horizon know when your guide has been used to generate a cell line (feedback on which guide or guides worked)  Must license that cell line back to Horizon in return for a royalty  Only pay cost of shipping What? Free? WHY?! Strengthen Academic Links Improve gRNA Design Platform Expand Cell Line Repository Horizon would like to license your cell lines!
  41. 41. GENASSIST: CRISPR and rAAV enabled gene editing Cas9 Vectors • Wild type and nickase • Separate or combined with guide Guide RNA • Single or double guides • Available OTS for in-lab cloning • Custom guide generation available with validation Donors • Available OTS for in-lab cloning • Plasmid or rAAV format • Custom donor generation available Cell Lines • CRISPR-ready cell lines • 550+ OTS cell line menu available for further gene editing Services • Viral encapsulation of rAAV donor • Project design support • On-going expert scientific support
  42. 42. CRISPR and rAAV Intellectual property It is Horizon's intent to ensure that our customers have a risk free environment to perform and benefit from CRISPR gene editing now and in the future. We bring to our customers the widest breadth of IP available from any commercial source:  We currently have either already taken a license to or are in late-stage negotiations to access multiple separate CRISPR IP patent estates  Horizon is the only company with access to rAAV as a precise gene editing or DNA/plasmid delivery platform, we are the only company able to offer hybrid rAAV/CRISPR systems that draw from the best aspects of both approaches for far superior gene editing efficiencies.
  43. 43. Your Horizon Contact: Chris Thorne PhD Gene Editing Community Specialist +44 1223 204799 Horizon Discovery Ltd, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Tel: +44 (0) 1223 655 580 (Reception / Front desk) Fax: +44 (0) 1223 655 581 Email: Web:
  44. 44. Useful Resources From Horizon  Free gRNAs in Cas9 wild type vector –  Technical manuals for working with CRISPR - technical-manuals In the Literature  Exploring the importance of offset and overhand for nickase -  sgRNA whole genome screening: • Shalem et al - • Wang et al - On the web  Feng Zhang on Game Changing Therapeutic Technology (Link to Feng’s Video)  Guide design -  CRISPR Google Group -!forum/crispr
