Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

CRISPR: what it is, and why it is having a profound impact on human health

1,436 views

Published on

Slides from the Pistoia Alliance Debates webinar, November 2016.

Published in: Science
  • Discover How to Cure uterine fibroids and PCOS At Any Age, Even If You’ve Tried Everything And Nothing Has Ever Worked For You Before ➤➤ http://t.cn/Aig7bySW
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • DOWNLOAD FULL BOOKS, INTO AVAILABLE FORMAT ......................................................................................................................... ......................................................................................................................... 1.DOWNLOAD FULL. PDF EBOOK here { https://tinyurl.com/yxufevpm } ......................................................................................................................... 1.DOWNLOAD FULL. EPUB Ebook here { https://tinyurl.com/yxufevpm } ......................................................................................................................... 1.DOWNLOAD FULL. doc Ebook here { https://tinyurl.com/yxufevpm } ......................................................................................................................... 1.DOWNLOAD FULL. PDF EBOOK here { https://tinyurl.com/yxufevpm } ......................................................................................................................... 1.DOWNLOAD FULL. EPUB Ebook here { https://tinyurl.com/yxufevpm } ......................................................................................................................... 1.DOWNLOAD FULL. doc Ebook here { https://tinyurl.com/yxufevpm } ......................................................................................................................... ......................................................................................................................... ......................................................................................................................... .............. Browse by Genre Available eBooks ......................................................................................................................... Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult,
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here

CRISPR: what it is, and why it is having a profound impact on human health

  1. 1. November 16, 2016 CRISPR: what it is, and why it is having a profound impact on human health A Pistoia Alliance Debates Webinar Chaired by Alvis Brazma – EMBL-EBI
  2. 2. This webinar is being recorded
  3. 3. Poll Question 1: How would you rate your personal knowledge of CRISPR? A. I’m an expert B. I have used CRISPR C. I’ve heard of it D. I know next to nothing about it
  4. 4. ©PistoiaAlliance The Panel 4 Patrick Harrison, Senior Lecturer Physiology, University College of Cork The focus of Dr Harrison’s lab is the development gene editing for treatment of rare diseases. His early work in this field pioneered the use of ZFNs and CRISPR to successfully repair the most common CF-causing mutation, F508del, in cell culture. The current focus extends the work to correct CF mutations of the deep intron theratype in primary cells, stem cells and animal models. Dr. Harrison is a principal investigator in the CF Trust’s Gene Editing Strategic Research Centre, and has additional grant funding from the CF Foundation (USA), with collaborations across Europe, USA and New Zealand. He is also using CRISPR editing to model skin disorders such as atopic dermatitis and Epidermolysis Bullosa. Alvis Brazma, Senior Team Leader of Functional Genomics, EMBL-EBI Dr Alvis Brazma is a Senior Scientist at the European Molecular Biology Laboratory (EMBL) and leading a group on gene expression at the European Bioinformatics Institute (EMBL-EBI). He studied mathematics at the University of Latvia, Riga, before obtaining his PhD in computer science from the Moscow State University. In 1997 he joined the EMBL and in 1999 was among the first scientists to use microarray data to study gene regulation. In 1999 he founded the Microarray Gene Expression Data society and started a microarray database ArrayExpress. Now he is in charge of several major EBI resources, including ArrayExpress, Expression Atlas, and BioStudies database. He is co-leading the working group on data integration for Pan-cancer Whole Genome project of the International Cancer Genome Consortium. Mike Ollmann, Principal Scientist, Amgen Dr. Ollmann’s work focuses on use of somatic cell genetics techniques, particularly CRISPR/Cas9 and RNAi, for early stage drug discovery. Dr. Ollmann obtained his Ph.D. in Genetics with Dr. Greg Barsh at Stanford University, prior to joining Exelixis Inc., where his work included early use of RNAi in Drosophila and mammalian cells for target identification and validation. He joined Amgen in 2011 and is a Principal Scientist in the Genome Analysis Unit based in South San Francisco. Anna Middleton, Head of Society & Ethics Research Wellcome Genome Campus November 16, 2016 CRISPR Dr Anna Middleton is a social scientist, continually asking ‘how are people responding to genomics?’ Her PhD is in psychology and she is also a trained genetic counsellor, having worked in the NHS for 10 years with patients exploring the impact of genetics on themselves and their families. She runs the Society and Ethics Research Group at the Wellcome Genome Campus in Cambridge and delivers research that explore the social and ethical impact of new genomic technologies.
  5. 5. ©PistoiaAlliance Agenda 5 • CRISPR – Cas9 Gene Editing(PH) • Accelerating science (MO) • The informatics challenge (AB) • Cystic Fibrosis - the case for gene-editing (PH) • Ethics and CRISPR (slides from AM; presented by PH) 5November 16, 2016 CRISPR
  6. 6. CRISPR – Cas9 Gene Editing Why How What Patrick Harrison, PhD – University College Cork, Ireland
  7. 7. Val His Leu Thr Pro Glu Glu Lys Ser Asp November 16, 2016 CRISPR 7
  8. 8. Val His Leu Thr Pro Val Glu Lys Ser Asp Target DNA November 16, 2016 CRISPR 8
  9. 9. Thr Pro Glu Glu Lys Val His Leu Thr Pro Val Glu Lys Ser Asp Target DNA Donor DNA November 16, 2016 CRISPR 9
  10. 10. Target DNA Donor DNA Clustered Regularly Interspaced Short Palindromic Repeats Cas9 guide RNA November 16, 2016 CRISPR 10
  11. 11. Target DNA Donor DNA Cas9 guide RNA Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 11
  12. 12. Target DNA Donor DNA Cas9 guide RNA Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 12
  13. 13. Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 13
  14. 14. Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 14
  15. 15. Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 15
  16. 16. Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 16
  17. 17. Cut Resect Incorporate Seal Precision Repair November 16, 2016 CRISPR 17
  18. 18. Thr Pro Glu Glu Lys Val His Leu Thr Pro Glu Glu Lys Ser Asp Cut Resect Incorporate Seal Precision Repair HDR Homology-directed repair November 16, 2016 CRISPR 18
  19. 19. Target DNA Cas9 guide RNA November 16, 2016 CRISPR 19
  20. 20. November 16, 2016 CRISPR 20
  21. 21. November 16, 2016 CRISPR 21
  22. 22. Val His Leu Thr Pro Gly Glu Val STOP NHEJ Non-homologous end joining In-frame STOP codon = gene knock-out November 16, 2016 22CRISPR
  23. 23. Cas9 (2013) gRNA Why has Cas9/gRNA surpassed ZFNs and TALENs? ZFNs (1996) TALENs (2011) Standing on the shoulders of giants November 16, 2016 23CRISPR
  24. 24. Cas9/guideRNA Design and synthesis (2013) November 16, 2016 CRISPR 24
  25. 25. |||||||||||||||||||| 5’ GUCACCUCCAAUCAGUAGGG 3' gRNA Cas9/guideRNA Design and synthesis (2013) November 16, 2016 CRISPR 25
  26. 26. |||||||||||||||||||| 5’ GUCACCUCCAAUCAGUAGGGGUUUUAGAGCUAG .|||||. |||| GUUCAACUAUUGCCUGAUCGGAAUAAAAUU CGAUA |||| GAA AAAGUGGCACCGA .|||||||G 3’ UUUUUUCGUGGCU A A A A gRNA Cas9/guideRNA Design and synthesis (2013) November 16, 2016 CRISPR 26
  27. 27. |||||||||||||||||||| 5’ GUCACCUCCAAUCAGUAGGGGUUUUAGAGCUAG .|||||. |||| GUUCAACUAUUGCCUGAUCGGAAUAAAAUU CGAUA |||| GAA AAAGUGGCACCGA .|||||||G 3’ UUUUUUCGUGGCU A A A A Cas9 DSB gRNA Cas9/guideRNA Design and synthesis (2013) November 16, 2016 CRISPR 27
  28. 28. Double Stranded Break Two options NHEJ • High efficiency KO • All cell types • KO in any animal • Clinical Editing HDR • Low efficiency Precision Repair • Dividing cells only • Multiple corrections in vivo November 16, 2016 CRISPR 28
  29. 29. GFP transgenic rat ~40% Knock Outs CRISPR 2016 Mice Rats Cows Sheep Rabbits Monkeys Zebrafish Human Embryos (14-day limit) Transfer KO eggs to surrogate Pronuclei Germline Editing Inject Nuclease into Fertilised Eggs Yang 2009 November 16, 2016 CRISPR 29
  30. 30. F.IX gene variant 1 2 3 4 Pre-clinical in vivo editing – haemophilia B i.v. inject nuclease and donor Li 2011 November 16, 2016 CRISPR 30
  31. 31. F.IX gene variant 1 2 3 4 Pre-clinical in vivo editing – haemophilia B i.v. inject nuclease and donor Li 2011 November 16, 2016 CRISPR 31
  32. 32. F.IX gene variant 1 2 3 4 Pre-clinical in vivo editing – haemophilia B i.v. inject nuclease and donor Li 2011 November 16, 2016 CRISPR 32
  33. 33. F.IX gene variant Super-exon Donor 1 2 3 4 2 3 4 F.IX gene wild-type 1 2 3 42 3 4 Li 2011 November 16, 2016 CRISPR 33
  34. 34. Gene Editing = Permanent cDNA addition = Transient Li 2011 November 16, 2016 CRISPR 34
  35. 35. Gene Editing = Permanent cDNA addition = Transient Li 2011 November 16, 2016 CRISPR 35
  36. 36. Gene Editing = Permanent cDNA addition = Transient Li 2011 Li 2011 November 16, 2016 CRISPR 36
  37. 37. 100 to 1,000-fold reduction in viral load Control Tebas 2014 Patient #1 ZFNs delete CCR5 November 16, 2016 CRISPR 37
  38. 38. Acute Lymphoid Leukaemia Modified Patient T cells CAR targets CD19 TALENs delete TCR (avoids rejection) 2015 Patient #2 TALENs enable CAR-T cells November 16, 2016 CRISPR 38
  39. 39. CRISPR – Cas9 Gene Editing Interim Summary • Cas9/gRNA creates DNA breaks • HDR – precision repair @ low efficiency • NHEJ – targeted deletions @ high efficiency • Gene-edited cells already used in patients • CRISPR clinical trials – 2017/18? November 16, 2016 CRISPR 39
  40. 40. Poll Question 2: Does your company have an active CRISPR research/informatics effort underway? A. Actively using CRISPR B. Exploring use of CRISPR C. Not currently using CRISPR D. I don’t know
  41. 41. Accelerating science Mike Ollmann - Amgen
  42. 42. ©PistoiaAlliance Drug Discovery at Amgen Target discovery & validation driven by human genetics November 16, 2016 CRISPR 42
  43. 43. ©PistoiaAlliance Gene Knockout & Editing by CRISPR/Cas9 Figure from ThermoFisher November 16, 2016 CRISPR 43
  44. 44. ©PistoiaAlliance Rapid Gene Knockout by Delivery of Cas9/sgRNA Ribonucleoprotein complex Liang et al, J Biotech, 2015 102 103 104 105 200 150 100 50 Flow cytometry to quantify target protein levels 4 days after electroporation of Cas9/sgRNA complex Control cells - no sgRNA Cells+Cas9/target sgRNA Target protein expression levelCellcount November 16, 2016 CRISPR 44
  45. 45. ©PistoiaAlliance Rapid Gene Knockout by Delivery of Cas9/sgRNA Ribonucleoprotein complex Not-so-rapid clonal isolation of edited cells Ran et al, Nature Protocols, 2013 Liang et al, J Biotech, 2015 November 16, 2016 CRISPR 45
  46. 46. ©PistoiaAlliance Pooled Lentiviral sgRNA Libraries for Genome-scale Gene Knockout Screening Figure adapted from Hartenian & Doench, FEBS, 2015 November 16, 2016 CRISPR 46
  47. 47. ©PistoiaAlliance Beyond Gene Knockout: Alternative Cas9-mediated Screening Methods Sanjana, Analytical Biochem., 2016 47November 16, 2016 CRISPR
  48. 48. Poll Question 3: Which is more important to your research? A. Precision editing by homology-directed recombination (HDR) B. Targeted knock-out/deletion by non- homologous end-joining (NHEJ) C. Don’t use CRISPR
  49. 49. The informatics challenge From predicting the target sites to assessing the effects Alvis Brazma – EMBL-EBI
  50. 50. ©PistoiaAlliance Why bioinformatics? • Doing things in silico saves time and resources • Some examples of what can be done – Finding the target – a gene or locus of interest in the genome – Finding where to cut the genome near the target November 16, 2016 CRISPR 50
  51. 51. ©PistoiaAlliance Cas9 nuclease is guided to the genome position by 20 nt short guide RNA (sgRNA) sequence From Sander & Joung, Nature Biotech. 32, 247 The guide sequence November 16, 2016 CRISPR 51
  52. 52. ©PistoiaAlliance Selecting the sgRNA sequence Genome Gene of interest 20 nt sequence Most similar sequence off target Target sequence - perfect match Most similar sequence off target TCC November 16, 2016 CRISPR 52
  53. 53. ©PistoiaAlliance Selecting the sgRNA sequence Genome Gene of interest 20 nt sequence Most similar sequence off target Most similar sequence off target Target sequence - perfect match TCC TCC November 16, 2016 CRISPR 53
  54. 54. ©PistoiaAlliance Annotated CRISPR/Cas9 target sites in Ensembl genome browser at European Bioinformatics Institute Anna Farne, Mark Thomas, David Parry-Smith November 16, 2016 CRISPR 54November 16, 2016 CRISPR 54
  55. 55. ©PistoiaAlliance What can bioinformatics do for CRISPR? • Tools for predicting and assessing the short guide RNA (sgRNA) – Purely sequence based methods – Methods utilizing the growing experimental evidence • Collecting the successes and failures of sgRNA sequences • Using machine learning to interpolate these • Tools for assessing and interpreting the editing results – Using and analyzing direct effects based on RNA sequencing – Assessing further downstream effects, such as systematic gene knockouts in cell lines November 16, 2016 CRISPR 55
  56. 56. ©PistoiaAlliance CRISPR activities at EMBL-EBI in collaboration with the Wellcome Trust Sanger Institute • Computational annotation of sgRNA binding sites • (Planned) Curated database of experimental results – Experimentally validated sgRNA binding sites – Knockout screen results • Gene essentiality in various cell lines November 16, 2016 CRISPR 56
  57. 57. Cystic Fibrosis The Case for Gene Editing Patrick Harrison, Ph.D. – University College Cork, Ireland
  58. 58. 58November 16, 2016 CRISPR Cl- Cl- HCO3 - HCO3 - Airway hydrationNeutral pH Normal Lung CFTR anion channel Cilia beating H2O H2O
  59. 59. 59November 16, 2016 CRISPR Cilia beating CF Lung Mutations in CFTR gene collapsed Cl- Cl- HCO3 - HCO3 - H2O H2O Cilia collapsed
  60. 60. 60November 16, 2016 CRISPR Class III No conductance Class II Reduced Trafficking Class I No protein CF – Personalised Medicine 4,000 people 92,000 people 4,000 people
  61. 61. 61November 16, 2016 CRISPR Absolutechangein% ofpredictedFEV1 Ramsay 2011 Nick Talbot Class III No conductance 4,000 people
  62. 62. 62November 16, 2016 CRISPR Absolutechangein% ofpredictedFEV1 . Wainwright 2015 Orkambi (dose A) Orkambi (dose B) Placebo BA Class II Reduced Trafficking 92,000 people
  63. 63. 63November 16, 2016 CRISPR Absolutechangein% ofpredictedFEV1 cDNA Placebo Alton 2015 Multi-dose CFTR cDNA is safe Class I No protein 4,000 people
  64. 64. 64 Genome F508del 5' 3' 3’ 5' Donor CTT 3' 5' 5' 3' CTT GAA --- --- Lee 2012 November 16, 2016 CRISPR
  65. 65. 65 Genome F508del 5' 3' 3’ 5' Donor CTT 3' 5' 5' 3' CTT GAA --- --- Lee 2012 November 16, 2016 CRISPR
  66. 66. 66 Genome F508del 5' 3' 3’ 5' NGG Donor CTT 3' 5' 5' 3' CTT GAA --- --- Schwank 2013 November 16, 2016 CRISPR
  67. 67. 67 5' 3' 3’ 5' 3' 5' 5' 3' CTT GAA Genome F508del Donor CTT November 16, 2016 CRISPR
  68. 68. 68 5' 3' 3’ 5' 3' 5' 5' 3' GAA CTT Genome F508del Donor CTT November 16, 2016 CRISPR
  69. 69. 69 5' 3' 3’ 5' 3' 5' 5' 3' GAA CTT Genome F508del Donor CTT November 16, 2016 CRISPR
  70. 70. 70 5' 3' 3’ 5' 3' 5' 5' 3' GAA CTT CTT Genome F508del Donor CTT November 16, 2016 CRISPR
  71. 71. 71 5' 3' 3’ 5' 3' 5' 5' 3' GAA CTT CTT GAA CTT Genome F508del Donor CTT November 16, 2016 CRISPR
  72. 72. 72 Editing restores function Stem Cell Organoids WT F508del F508del edited November 16, 2016 CRISPR Schwank 2013 72
  73. 73. 73 WT F508del F508del edited Editing restores function Stem Cell Organoids November 16, 2016 CRISPR Schwank 2013 73
  74. 74. 74 WT F508del F508del edited Editing restores function Stem Cell Organoids November 16, 2016 CRISPR Schwank 2013 74
  75. 75. 75 Schwank 2013 WT F508del F508del edited Editing restores function Stem Cell Organoids November 16, 2016 CRISPR 75
  76. 76. 76 HDR restores CFTR <1% Select & enrich NHEJ >50% KO How can KO fix CF? 76 November 16, 2016 CRISPR
  77. 77. 77 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' CRISPR KO – 40% of Class I (and IV) mutations Deep intron Mutations 3272 -26A>G (n = 463) 3849 +10kb C>T (n = 1,143) * * * 1811+1.6kb A>G (n = 71) 77 November 16, 2016 CRISPR
  78. 78. 78 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' 3849 +10kb C>T (n = 1,143) * WT GTEx 22 AG GC AG Ex 23 November 16, 2016 CRISPR
  79. 79. 79 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' 3849 +10kb C>T (n = 1,143) * WT GTEx 22 AG GT AG Ex 23 79 November 16, 2016 CRISPR
  80. 80. 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' 3849 +10kb C>T (n = 1,143) * WT GTEx 22 AG GT AG Ex 23pseudo Exon TAA 80 CRISPRNovember 16, 2016
  81. 81. 81 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' 3849 +10kb C>T (n = 1,143) * GWT GTEx 22 GT AG Ex 23pseudo Exon TAA Delete 25 to 150 bp 3849 +10kb C>T (n = 1,143) A 81 November 16, 2016 CRISPR
  82. 82. 82 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 26 2724 25 3’5' WT GTEx 22 AG Ex 23 82 November 16, 2016 CRISPR
  83. 83. 83 November 16, 2016 CRISPR One for All CFTR super-exons 83
  84. 84. 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' 84 November 16, 2016 CRISPR
  85. 85. 85 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' Bednarski 2016 CFTR Exons 11-27 85 November 16, 2016 CRISPR
  86. 86. 86 CFTR Exons 11-27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' Bednarski 2016 86 November 16, 2016 CRISPR
  87. 87. 87 CFTR Exons 11-27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 3’5' Bednarski 2016 87 November 16, 2016 CRISPR
  88. 88. 88 CFTR Exons 11-27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 5' CFTR Exons 11-27 CFTR Exons 11-27 3’ Bednarski 2016 88 November 16, 2016 CRISPR
  89. 89. 89 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 23 26 2722 24 25 5' CFTR Exons 11-27 CFTR Exons 11-27 CFTR Exons 11-27 AAAA 3’ Unedited Super-exon Bednarski 2016 November 16, 2016 CRISPR 89
  90. 90. November 16, 2016 CRISPR 90 Cystic Fibrosis – Cas9 Gene Editing Interim Summary • HDR – precise but inefficient • NHEJ – efficient but only 2% of individuals • HDR superexon – all mutations but inefficient • NHEJ superexon – TBC
  91. 91. Cystic Fibrosis The Case for Gene Editing Patrick Harrison, Ph.D. – University College Cork, Ireland
  92. 92. Dr Anna Middleton Head of Society and Ethics Research Wellcome Genome Campus Cambridge, UK November 16, 2016 CRISPR 92
  93. 93. The most discussed ethics… • The most controversial aspect of CRISPR is the potential use in editing gametes or embryos • It is illegal to edit a human embryo with the aim of implanting it to achieve a pregnancy • However, it is acceptable (e.g. in the UK, under license) to do research using CRISPR on embryos up to 14 days of age November 16, 2016 CRISPR 93
  94. 94. Public Debate pivotal • Public debate about ‘designer babies’, eugenics and the ‘slippery slope’ in the application of genetic technology has been happening for the last 40 years • However, now is the time to consider, what is socially acceptable in terms of research on embryos • If parents consent for research to happen on their discarded ’IVF’ embryos (that will never result in a pregnancy), does this mean it is socially acceptable to do? November 16, 2016 CRISPR 94
  95. 95. The Debate so far… • Should all research on embryos be banned? • We live in a society where research on embryos up to the 14 day point is acceptable (and is being done) • CRISPR research should form part of this picture • If there is a moratorium on editing embryos in a research setting, this will push the research underground and out of public scrutiny • Research needs to be publicly funded on editing, in order to maintain safe regulation November 16, 2016 CRISPR 95
  96. 96. Help the debate… • There are concerns that ethical debates about embryo editing will negatively affect research on somatic cells • we mustn’t let discussion about embryos dominate the public debate • We need to avoid the unhelpful ‘slippery slope’ arguments and consider the evolution of editing on a case by case basis November 16, 2016 CRISPR 96
  97. 97. Policy is on its way… • A policy statement from the American Society of Human Genetics on ‘Germline Gene Editing’ will be issued shortly – has contribution from British, Canadian and USA genetic counsellors November 16, 2016 CRISPR 97
  98. 98. Audience Q&A Please use the Question function in GoToWebinar
  99. 99. ©PistoiaAlliance Other CRISPR events and resources • Pistoia Alliance member Benchling is hosting a panel discussion: Engineering the Future: Opportunities and Applications of CRISPR Wednesday November 30th 5:30-7:30pm PST Rock Health, 455 Mission Bay Boulevard, South #124, San Francisco, CA 94158 (more information at https://www.eventbrite.com/e/engineering-the-future-opportunities- and-applications-of-crispr-tickets-28795197210): • Pistoia Alliance member Merck KGaA (Millipore Sigma/SigmaAldrich) has series of technical webinars and other videos available http://www.sigmaaldrich.com/video/life-science/crispr-webinars.html • Others?
  100. 100. ©PistoiaAlliance To address question posed by attendee re: tools CRISPR 100November 16, 2016 • <Alvis Brazma> The two widely used tools for CRISPR/Cas9 design that I would recommend are: – GPP Web Portal at the Broad Institute - http://portals.broadinstitute.org/gpp/public/analysis- tools/sgrna-design – CRISPRseek Bioconductor package http://bioconductor.org/packages/release/bioc/html/C RISPRseek.html • <Patrick Harrison> Recommended the following site for additional CRISPR resources: – https://www.addgene.org/crispr
  101. 101. IDMP: Overview and collaboration opportunities The next Pistoia Alliance Discussion Webinar: Moderator: Gerhard Noelken Date: January 2017 check http://www.pistoiaalliance.org/events/ for the latest information
  102. 102. info@pistoiaalliance.org @pistoiaalliance www.pistoiaalliance.org

×