Therapeutic Club on Tauopathy. Its pathophysiology and therapeutic targets. Interactive session held at All India Institute of Medical Sciences, New Delhi - 110029 on 28th October 2017.

1. Therapeutic targets of Tauopathy
Therapeutic Club
Presenter: Dr. Pranav Sopory
Dept. of Pharmacology
AIIMS – New Delhi
1

2. Contents
1 Microtubules & Physiological Tau
2 Pathophysiology of Tau
3 Various Tauopathies
4 Tau based Treatment Approaches
2

3. 1. Physiological Tau
Functions of microtubules
1. ‘Tracks’ for transport of cellular cargoes (vesicles, organelles)
2. Regulation of cell shape and cell polarity during differentiation,
3. Chromosome partitioning at mitosis
How they do it:
• During these processes, MTs undergo rearrangements involving rapid transitions
between stable and dynamic states.
• Stability: MAP : Microtubule associated protein (aka: Tau protein)
• Instability: Kinase enzymes
3

4. 2. Formation of p-tau & NFT pathology
4
Increased phosphorylation/ Tau production.
• Genetic mutation
• Sporadic events
• This detached tau self assembles into paired
helical filaments (PHF)
• PHF + GAG =NFT
Drewes G, Ebneth A, Preuss U, Mandelkow EM, Mandelkow E. MARK, a novel family of protein kinases
that phosphorylate microtubule-associated proteins and trigger microtubule disruption. Cell. 1997 Apr
NFT pathology
• Induces apoptosis
• Other mechanisms

5. 5

6. 3. Various Tauopathies
Depending upon the location of deposition of p-tau
Disease Location Management
Alzheimer’s Disease Hippocampus and entorhinal
cortex
Cholinesterase inhibitors,
memantine
Progressive Supranuclear
Palsy
Basal ganglia and brainstem
and spinal cord
Levodopa
Frontotemporal Dementia Frontal lobe and temporal
lobe
Antipsychotics and
antidepressants
Chronic Traumatic
Encephalopathy
Sulcus depths No approved therapy
6
Several other types

7. Diagnose Tauopathy
Mostly clinical !
Specific to Tauopathy:
1. Levels of Total tau (CSF + Plasma) & Levels of p-tau (Plasma)
• 30 years meta-analysis shows strong association with AD
2. PET Tau
• Correlation with disease
Mild cognitive impairment Severe ADModerate AD
7

8. 5. Therapeutic targets
8
Targeted Non-targeted
MAPT gene (ASME) Insulin resistance
Anti-phsphorylation agents mTOR inhibitors
Cistauosis (CTE)
Inhibit the spread of p-tau
Anti-aggregation strategies
Microtubule stabilizing agents

9. A. ASME: Anti-sense mediated exon skipping
• MAPT gene: precursor of tau protein
• Knockdown mice models: Decreased risk of developing AD
• AON: anti-sense oligonucleotide
9
Tau Protein
mRNA
DNA (MAPT gene)
Protein expression:
absent
mRNA lacks ATG
AON

10. A. MAPT gene mutation: Therapeutic potential: ASME
10
AONs showing
positive results
Morpholino oligonucleotides Phosphorothioate
Examples AGTCGGTAGGACCAAGTT
TCAAGTG
GUUAUCUGCUUCUUCCAGCC
Mechanism Target start codon Alternative splicing (exon skipping)

11. B. Anti-phosphorylation agents
Enzyme Inhibitors
MARK • Strauosine
• Hymenialdisine
PKA • Iso-quinolone sulfonamide
• KT-5720
Cdk5 • Indirubins
• 2,6,9-Purines
• Roscovitine
GSK-3β • Lithium
• Valproate
11

12. B. Anti-phosphorylation studies: Lithium
Lithium
• Neuroprotective drug
• Inhibits GSK-3β (phosphorylates tau)
Studies in 3xTg mice
• Mutation in APP, MAPT, PSEN1
• Chronic administration of LiCl
• 300uL of 0.6 mol/L/mouse/day i.p
• Start at 15 mo age
• Duration: 4 weeks
Caccamo A, Oddo S, Tran LX, LaFerla FM. Lithium Reduces Tau Phosphorylation but Not Aβ or Working Memory
Deficits in a Transgenic Model with Both Plaques and Tangles. The American Journal of Pathology. 2007 12

13. B. Anti-phosphorylation studies: Lithium
Caccamo A, Oddo S, Tran LX, LaFerla FM. Lithium Reduces Tau Phosphorylation but Not Aβ or Working Memory
Deficits in a Transgenic Model with Both Plaques and Tangles. The American Journal of Pathology. 2007
Matsunaga S, Kishi T, Annas P, Basun H,
Hampel H, Iwata N. Lithium as a Treatment
for Alzheimer's Disease: A Systematic
Review and Meta-Analysis. J Alzheimers Dis.
2015
Results Conclusion
• Specific to tau and not Aβ.
• ADD ON THERAPY
for AD
• BROADER USE.
• Off-label use in CTE (R/o
BPD and suicide).
Meta-analysis, 2015

14. C. Cistauosis
• Seen in Chronic Traumatic Encephalopathy (CTE)
• Post-mortem brain of boxers: Increased levels of pathogenic tau
• Histopathology:
Cistauosis: the cis isomer cannot promote microtubule assembly, is more resistant to dephosphorization and
degradation, and is more prone to aggregation.
• Pathophysiology:
1. Severe injury to axons: Tau dissociated from microtubules: facilitates subsequent tau aggregation
2. Small vessel bleeds over a prolonged time: chronic inflammation: exacerbates the acute tauopathy
occurring after acute injury
3. Decreased ALP: unable to dephosphorylate tau
4. Deficiency of Proline isomerase, Pin1 (coverts cis to trans)
• Tau-PET:
25 y.o. patient similar to 65 y.o. asymptomatic person (PART, trans-tau) 14

15. C. CTE: Therapeutic potential: ‘cis-mAb’
Prevent cistauosis!
• Balb/c female mice (2–3 months old) were immunized with 100 mg of cis-tau
(pThr231-Pip)
Administered to:
• CTE model mice (rmTBI) used
• Cis-p-tau elevated and concentrated in neurons around blood vessels
• Treated with cis-mAb or IgG isotype control, 20mg i.c.v.
Results:
• Prevents formation of oligomer and tangles
15
Kondo A, Shahpasand K, Mannix R, Qiu J, Moncaster J, Chen CH, Yao Y, Lin YM, Driver JA, Sun Y, Wei S, Luo ML, Albayram O, Huang P, Rotenberg A, Ryo A, Goldstein LE,
Pascual-Leone A, McKee AC, Meehan W, Zhou XZ, Lu KP. Antibody against early driver of neurodegeneration cis P-tau blocks brain injury and tauopathy. Nature. 2015 Jul

16. D. Spread of p-Tau from one cell to another
• Transfer synaptically and from microglia
• AD: Disease spreads from Hippocampus to the whole brain.
• P-Tau: stimulates aggregation of natively folded tau in naive cell (mechanism
unknown)
• Spread via: Exosomes (vehicles) or after lysis of a neuron
• CSF and Plasma study of AD/MCI/FTD:
Tau filled exosomes + ve
16
Medina M, Avila J. The role of extracellular Tau in the spreading of neurofibrillary
pathology. Frontiers in Cellular Neuroscience. 2014

17. D. Spread of p-Tau: AADvac–1 vaccine
Stop spread of p-Tau
Idea: Antibodies act extracellulary, and attack tau outside of neurons
AADvac-1 vaccine:
• Synthetic peptide derived from amino acids 294 to 305 of the tau sequence.
• Aluminum hydroxide as an adjuvant
• Phase 1 results:
• Injection site reaction
• Hypertension
• UTI
17https://clinicaltrials.gov/ct2/show/record/NCT01850238

18. E. Anti-aggregation strategies: PTH
Tau: Highly water soluble compound
Aggregates due to: Polymerization of PHF -> NFT
Phenyl Thiazolyl hydrazide derivative
• Depolymerization of PHF by targeting GAG
• Compound tested in a cell model of tau pathology for
activity and toxicity.
18
Pickhardt M, Larbig G, Khlistunova I, Coksezen A, Meyer B, Mandelkow EM, Schmidt B, Mandelkow E. Phenylthiazolyl-
hydrazide and its derivatives are potent inhibitors of tau aggregation and toxicity in vitro and in cells. Biochemistry.
2007 Sep
Other agents
Rhodanines
Anthraquinones
N-phenylamines

19. F. Microtubule stabilizing drug
• NFT+: Cannot stabilize microtubules
• Principle: Stabilize microtubules
• Use MT stabilizing molecules: in low doses
• Mechanism of action:
• stabilize GDP-bound tubulin in the microtubule,
thereby preventing depolymerization.
• Limitations:
• Poor BBB availability
• Peripheral neuropathy
19
Brunden KR, Ballatore C, Lee VM-Y, Smith AB, Trojanowski JQ. Brain-penetrant microtubule-stabilizing
compounds as potential therapeutic agents for tauopathies. Biochemical Society transactions. 2012
Drug Model used
Paclitaxel T44 tau mice
EpoD
(epothilone D)
PS19 tau transgenic
mice
Dictyostatin PS19 tau transgenic
mice
Peroluside MAPT mice
Synstab MAPT mice
AIM: Prevent –
• Microtubule decay
• Transport impairment
• synaptic degeneration

20. G. mTOR hyperactivity: Rapamycin
Pre-clinical study
P301S Mice model
Result:
• Decreased tau accumulation
• Improved cognition
Clinical study
Clinical trial: NCT 02874924
• Effects of Rapamycin in adults aged
70-95.
Rapamycin Attenuates the Progression of Tau Pathology in P301S Tau Transgenic
Mice, Sefika Ozcelik Graham Fraser Perrine Castets
20
https://clinicaltrials.gov/ct2/show/record/NCT02874924

21. H. Insulin resistance
• Post-mortem brains (AD/ FTD/ PSGP):
• Increased levels of AbN phosphorylated insulin receptor substrate 1 (marker of insulin
resistance)
Correlation between increased PINS1 and p-tau
• Pre-clinical studies also show causality between IR and tauopathy
• Also, ICV-STZ model of AD relies on this mechanism to cause cognitive deficit
• Alzheimers Disease: aka Type 3 Diabetes Mellitus
21
Razay G, Vreugdenhil A, Wilcock G. The metabolic syndrome and Alzheimer disease. Arch Neurol. 2007 Jan
Yarchoan M, Toledo JB, Lee EB, et al. Abnormal serine phosphorylation of insulin receptor substrate 1 is associated with tau pathology in Alzheimer’s
disease and tauopathies. Acta neuropathologica. 2014

22. H. Insulin resistance: Therapeutic potential
SNIFF study trial (Study of intraNasal Insulin in the Fight against Forgetfulness)
• Use: Humulin R – 100 U
Advantage:
• INI will not enter peripheral blood stream
• No hypoglycemia, no insulin resistance
• Study completion date: December 31, 2018
22https://clinicaltrials.gov/ct2/show/NCT01767909
Primary endpoints
Change in global measure of cognition
Change in daily functioning
Surrogate endpoint
Plasma tau levels
Other studies
Metformin
Liraglutide
Group Drug
MCI Humulin R – 100 U
AD Placebo
AIM:
Arrest or reverse the disease at its
earliest stages

23. ?
Thank You
23
Conclusion
• Chronic neurological disorders are a heavy burden
on DALY outcome
• TAU pathology: major cause for pathogenesis of
multiple chronic neurodegerative disorders
• No cure exists
• Research on cell lines and animals shows positive
signs
• Onset of anti-p-tau therapy is crucial