In this talk I discuss recent work done in my lab and with collaborators abroad that contributes towards accelerating the specify -> design -> model -> build -> test & iterate biological engineering cycle. This will describe advances in biological programming languages for specifying combinatorial DNA libraries, the utilisation of off-the-shelf microfluidic devices to build the DNA libraries as well as data analysis techniques to accelerate computational simulations
Introduction to Next-Generation Sequencing (NGS) TechnologyQIAGEN
The continuous evolution of NGS technology has led to an enormous diversification in NGS applications and dramatically decreased the costs to sequence a complete human genome.
In this presentation, we will discuss the following major topics:
• Basic overview of NGS sequencing technologies
• Next-generation sequencing workflow
• Spectrum of NGS applications
• QIAGEN universal NGS solutions
My talk for the International Genomics session at ABRF 2017. Describing the issues caused by the uncontrolled naming of NGS methods: some examples and some suggestions about how to fix this.
Presentation carried out by Sergi Beltran Agulló, from the CNAG, at the course: Identification and analysis of sequence variants in sequencing projects: fundamentals and tools .
How to cluster and sequence an ngs library (james hadfield160416)James Hadfield
A presentation for people intersted in understanding how Illumina adapter ligation, clustering ands SBS sequencing work. Follow core-genomics http://core-genomics.blogspot.co.uk/
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
Introduction to Next-Generation Sequencing (NGS) TechnologyQIAGEN
The continuous evolution of NGS technology has led to an enormous diversification in NGS applications and dramatically decreased the costs to sequence a complete human genome.
In this presentation, we will discuss the following major topics:
• Basic overview of NGS sequencing technologies
• Next-generation sequencing workflow
• Spectrum of NGS applications
• QIAGEN universal NGS solutions
My talk for the International Genomics session at ABRF 2017. Describing the issues caused by the uncontrolled naming of NGS methods: some examples and some suggestions about how to fix this.
Presentation carried out by Sergi Beltran Agulló, from the CNAG, at the course: Identification and analysis of sequence variants in sequencing projects: fundamentals and tools .
How to cluster and sequence an ngs library (james hadfield160416)James Hadfield
A presentation for people intersted in understanding how Illumina adapter ligation, clustering ands SBS sequencing work. Follow core-genomics http://core-genomics.blogspot.co.uk/
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
Advanced NGS Library Prep for Challenging SamplesQIAGEN
Rapidly developing next-generation sequencing (NGS) technologies provide highly sensitive methods for discovering and characterizing the genetic information of a variety of samples. However, DNA samples are often limited in quantity, as well as compromised in quality. Such samples are not suitable for standard NGS library construction methods, which commonly require hundreds of nanograms of high-quality DNA. Examples of such challenging samples include circulating DNA, laser capture microdissection (LCM) samples, formalin-fixed paraffin-embedded (FFPE) samples, ancient DNA and chromatin immunoprecipitation (ChIP) samples.
This webinar discusses the measures that should be taken into consideration while sequencing such challenging samples. It also presents methods that can be used to optimize library construction to efficiently convert small amounts of DNA samples into high-quality sequencing libraries.
Next-generation sequencing and quality control: An Introduction (2016)Sebastian Schmeier
This lecture is part is an introductory bioinformatics workshop. It gives a background to what sequencing is, what the results of a sequencing experiment are, how to assess the quality of a sequencing run, what error sources exist and how to deal with errors. The accompanying websites are available at http://sschmeier.com/bioinf-workshop/
Proposed kinetic improvements to a Zika Biosensor developed by the Collins Lab at MIT that would reduce time of detection by 80% with a cost increase of only $0.01 per reaction.
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAGEN
Tumor heterogeneity has been known for a while but quantifying heterogeneity is still a challenge. NGS is the method of choice in the analysis of tumor heterogeneity, however, there are some inherent challenges associated with it. These include false positives, gaps in the gene due to overrepresentation and incomplete representation of low-frequency transcripts – all contributing to an inaccurate picture. Conventional library prep strategies for NGS are based on PCR, which introduces sequence-based bias and amplification noise, leading to these inaccuracies. In this webinar, we will cover
1. Principles of UMI and the new QIAseq product porfolio
2. How UMI along with SPE (single primer extension) allows for increased uniformity across difficult-to-sequence regions, removal of library construction bias, improved data analysis and sequencing optimization
3. How data generated from using UMI and SPE is directly comparable to analysis derived from whole transcriptome and exome sequencing
4. Application of UMI and SPE in the discovery of novel gene fusions and in the analysis of gene expression and genetic variation
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breedingJyoti Prakash Sahoo
These are the part of the Bacterial immune system which detects and recognize the foreign DNA and cleaves it.
THE CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) loci
Cas (CRISPR- associated) proteins can target and cleave invading DNA in a sequence – specific manner.
CRISPR array is composed of a series of repeats interspaced by spacer sequences acquired from invading genomes.
Next generation sequencing: research opportunities and bioinformatic challenges. A seminar I gave for the Computational Life Science (Univ. of Oslo) seminar series, March 2, 2011
Rare Variant Analysis Workflows: Analyzing NGS Data in Large CohortsGolden Helix Inc
Analysis of rare variants for population-level data is becoming a more common component of genomic research. Whether using exome chips, whole-exome sequencing, or even whole-genome sequencing, rare variation analysis requires a unique analytic perspective.
In this presentation, we will review some of the tools available in SVS for large sequenced cohorts including summarization, visualization, and statistical analysis of rare variants using KBAC, CMC, and other methods.
Special attention will be given to useful functions available for download from the SVS scripts repository.
As a leading provider of gene editing service, Creative Biogene has launched a powerful CRISPR/Cas9 Platform. Our platform performs gene knockout/knockin programme with CRISPR/Cas9 system, from designing gRNA constructs to transfection and single clone generation of a wide range of cells, including difficult-to-transfect and tumor cell lines, as well as plants, mouse and other animal models.
With technological breakthroughs in single cell isolation, whole genome amplification (WGA) and NGS library preparation, experiments using single cells are now possible. However, challenges still exist. In particular, methods for the unbiased and complete amplification of a single genome and for the efficient conversion of that amplified DNA into a sequencer-compatible library face several technical limitations including incomplete amplification, the introduction of PCR errors, GC-bias and locus or allelic drop-out. The presentation covers the impact of these factors and how one can mitigate it.
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...QIAGEN
This slidedeck provides a technical overview of DNA/RNA preprocessing, template preparation, sequencing and data analysis. It covers the applications for NGS technologies, including guidelines for how to select the technology that will best address your biological question.
Paper introduction to Combinatorial Optimization on Graphs of Bounded TreewidthYu Liu
This slides introduced the paper: H. L. Bodlaender and a. M. C. a. Koster, “Combinatorial Optimization on Graphs of Bounded Treewidth,” Comput. J., vol. 51, no. 3, pp. 255–269, Nov. 2007.
Advanced NGS Library Prep for Challenging SamplesQIAGEN
Rapidly developing next-generation sequencing (NGS) technologies provide highly sensitive methods for discovering and characterizing the genetic information of a variety of samples. However, DNA samples are often limited in quantity, as well as compromised in quality. Such samples are not suitable for standard NGS library construction methods, which commonly require hundreds of nanograms of high-quality DNA. Examples of such challenging samples include circulating DNA, laser capture microdissection (LCM) samples, formalin-fixed paraffin-embedded (FFPE) samples, ancient DNA and chromatin immunoprecipitation (ChIP) samples.
This webinar discusses the measures that should be taken into consideration while sequencing such challenging samples. It also presents methods that can be used to optimize library construction to efficiently convert small amounts of DNA samples into high-quality sequencing libraries.
Next-generation sequencing and quality control: An Introduction (2016)Sebastian Schmeier
This lecture is part is an introductory bioinformatics workshop. It gives a background to what sequencing is, what the results of a sequencing experiment are, how to assess the quality of a sequencing run, what error sources exist and how to deal with errors. The accompanying websites are available at http://sschmeier.com/bioinf-workshop/
Proposed kinetic improvements to a Zika Biosensor developed by the Collins Lab at MIT that would reduce time of detection by 80% with a cost increase of only $0.01 per reaction.
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAGEN
Tumor heterogeneity has been known for a while but quantifying heterogeneity is still a challenge. NGS is the method of choice in the analysis of tumor heterogeneity, however, there are some inherent challenges associated with it. These include false positives, gaps in the gene due to overrepresentation and incomplete representation of low-frequency transcripts – all contributing to an inaccurate picture. Conventional library prep strategies for NGS are based on PCR, which introduces sequence-based bias and amplification noise, leading to these inaccuracies. In this webinar, we will cover
1. Principles of UMI and the new QIAseq product porfolio
2. How UMI along with SPE (single primer extension) allows for increased uniformity across difficult-to-sequence regions, removal of library construction bias, improved data analysis and sequencing optimization
3. How data generated from using UMI and SPE is directly comparable to analysis derived from whole transcriptome and exome sequencing
4. Application of UMI and SPE in the discovery of novel gene fusions and in the analysis of gene expression and genetic variation
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breedingJyoti Prakash Sahoo
These are the part of the Bacterial immune system which detects and recognize the foreign DNA and cleaves it.
THE CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) loci
Cas (CRISPR- associated) proteins can target and cleave invading DNA in a sequence – specific manner.
CRISPR array is composed of a series of repeats interspaced by spacer sequences acquired from invading genomes.
Next generation sequencing: research opportunities and bioinformatic challenges. A seminar I gave for the Computational Life Science (Univ. of Oslo) seminar series, March 2, 2011
Rare Variant Analysis Workflows: Analyzing NGS Data in Large CohortsGolden Helix Inc
Analysis of rare variants for population-level data is becoming a more common component of genomic research. Whether using exome chips, whole-exome sequencing, or even whole-genome sequencing, rare variation analysis requires a unique analytic perspective.
In this presentation, we will review some of the tools available in SVS for large sequenced cohorts including summarization, visualization, and statistical analysis of rare variants using KBAC, CMC, and other methods.
Special attention will be given to useful functions available for download from the SVS scripts repository.
As a leading provider of gene editing service, Creative Biogene has launched a powerful CRISPR/Cas9 Platform. Our platform performs gene knockout/knockin programme with CRISPR/Cas9 system, from designing gRNA constructs to transfection and single clone generation of a wide range of cells, including difficult-to-transfect and tumor cell lines, as well as plants, mouse and other animal models.
With technological breakthroughs in single cell isolation, whole genome amplification (WGA) and NGS library preparation, experiments using single cells are now possible. However, challenges still exist. In particular, methods for the unbiased and complete amplification of a single genome and for the efficient conversion of that amplified DNA into a sequencer-compatible library face several technical limitations including incomplete amplification, the introduction of PCR errors, GC-bias and locus or allelic drop-out. The presentation covers the impact of these factors and how one can mitigate it.
Next-Generation Sequencing an Intro to Tech and Applications: NGS Tech Overvi...QIAGEN
This slidedeck provides a technical overview of DNA/RNA preprocessing, template preparation, sequencing and data analysis. It covers the applications for NGS technologies, including guidelines for how to select the technology that will best address your biological question.
Paper introduction to Combinatorial Optimization on Graphs of Bounded TreewidthYu Liu
This slides introduced the paper: H. L. Bodlaender and a. M. C. a. Koster, “Combinatorial Optimization on Graphs of Bounded Treewidth,” Comput. J., vol. 51, no. 3, pp. 255–269, Nov. 2007.
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1QIAGEN
QIAseq RNA is a revolutionary turnkey solution for digital gene expression analysis by NGS. From 10 genes to 1000, from one sample to 100, QIAseq RNA delivers precise results on both ION and Illumina sequencing platforms. The data from QIAseq RNA is directly comparable to expression analysis derived from whole transcriptome sequencing or by qRTPCR, only better, cheaper, faster, and more flexible. This webinar will describe the principles of digital expression analysis by NGS, and review the features and benefits of the QIAseq system, options available, and the integrated data analysis package.
Enabling Large Scale Sequencing Studies through Science as a ServiceJustin Johnson
Now
“Now” generation sequencing has drastically changed the traditional costs and infrastructure within the sequencing community. There are several technologies, platforms and algorithms that show promise, but it is not always intuitive where to start. This uncertainty is compounded by the fact that commonly used analysis tools are difficult to build, maintain, and run effectively. Sample acquisition and preparation is quickly becoming a bottleneck as projects move from small sample sizes to hundreds or even thousands of samples. We will present case studies highlighting information, methods, challenges and opportunities in leveraging large scale high throughput sequencing and bioinformatics. Specifically we will highlight a recent genome-wide study of methylation patterns in 1575 individuals with Schizophrenia. We will also discuss several cancer transcriptome and exome sequencing projects as well as a human pathogen transcriptome characterization project consisting of multiple organisms and almost a billion reads.
The Future
The Ion Torrent PGM machine is a very promising, rapid throughput, ultra scalable sequencer that could play an integral part in future human health studies. Applications such as microbial whole genome sequencing, metagenomic characterization of environmental and microbiome sample, and targeted resequencing projects stand to benefit from this technology over time. To date we have completed more than 25 runs on a single PGM and will comment on the setup as well as sequence data and analysis.
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...Andor Kiss
A review of recent molecular biology technologies at the core genomics facility at Miami University (Ohio). The aim of this talk is to introduce the facility's capabilities to faculty, graduate and undergraduate students at MiamiU.
Speaker: Benedict C. S. Cross, PhD, Team leader (Discovery Screening), Horizon Discovery
CRISPR–Cas9 mediated genome editing provides a highly efficient way to probe gene function. Using this technology, thousands of genes can be knocked out and their function assessed in a single experiment. We have conducted over 150 of these complex and powerful screens and will use our experience to guide you through the process of screen design, performance and analysis.
We'll be discussing:
• How to use CRISPR screening for target ID and validation, understanding drug MOA and patient stratification
• The screen design, quality control and how to evaluate success of your screening program
• Horizon’s latest developments to the platform
• Horizon’s novel approaches to target validation screening
De novo transcriptome assembly of solid sequencing data in cucumis melobioejjournal
As sequencing technologies progress, focus shifts towards solving bioinformatic challenges, of which sequence read assembly is the first task. In the present study, we have carried out a comparison of two assemblers (SeqMan and CLC) for transcriptome assembly, using a new dataset from Cucumis melo. Between two assemblers SeqMan generated an excess of small, redundant contigs where as CLC generated the least redundant assembly. Since different assemblers use different algorithms to build contigs, wefollowed the merging of assemblies by CAP3 and found that the merged assembly is better than individual assemblies and more consistent in the number and size of contigs. Combining the assemblies from different programs gave a more credible final product, and therefore this approach is recommended for quantitative
output.
DE NOVO TRANSCRIPTOME ASSEMBLY OF SOLID SEQUENCING DATA IN CUCUMIS MELObioejjournal
As sequencing technologies progress, focus shifts towards solving bioinformatic challenges, of which
sequence read assembly is the first task. In the present study, we have carried out a comparison of two
assemblers (SeqMan and CLC) for transcriptome assembly, using a new dataset from Cucumis melo.
Between two assemblers SeqMan generated an excess of small, redundant contigs where as CLC generated
the least redundant assembly. Since different assemblers use different algorithms to build contigs, we
followed the merging of assemblies by CAP3 and found that the merged assembly is better than individual
assemblies and more consistent in the number and size of contigs. Combining the assemblies from different
programs gave a more credible final product, and therefore this approach is recommended for quantitative
output
DE NOVO TRANSCRIPTOME ASSEMBLY OF SOLID SEQUENCING DATA IN CUCUMIS MELObioejjournal
As sequencing technologies progress, focus shifts towards solving bioinformatic challenges, of which sequence read assembly is the first task. In the present study, we have carried out a comparison of two assemblers (SeqMan and CLC) for transcriptome assembly, using a new dataset from Cucumis melo. Between two assemblers SeqMan generated an excess of small, redundant contigs where as CLC generated
the least redundant assembly. Since different assemblers use different algorithms to build contigs, we followed the merging of assemblies by CAP3 and found that the merged assembly is better than individual assemblies and more consistent in the number and size of contigs. Combining the assemblies from different programs gave a more credible final product, and therefore this approach is recommended for quantitative
output.
Biological Apps: Rapidly Converging Technologies for Living Information Proce...Natalio Krasnogor
This is a plenary talk I gave at the 2018 International Conference on Information Processing and Management of Uncertainty in Knowledge-Based Systems in Cadiz, Spain
Memetic Algorithms have become one of the key methodologies behind solvers that are capable of tackling very large, real-world, optimisation problems. They are being actively investigated in research institutions as well as broadly applied in industry. In this talk we provide a pragmatic guide on the key design issues underpinning Memetic Algorithms (MA) engineering. We begin with a brief contextual introduction to Memetic Algorithms and then move on to define a Pattern Language for MAs. For each pattern, an associated design issue is tackled and illustrated with examples from the literature. We then fast forward to the future and mention what, in our mind, are the key challenges that scientistis and practitioner will need to face if Memetic Algorithms are to remain a relevant technology in the next 20 years.
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Natalio Krasnogor
In this talk I will overview ten years of research in the application of evolutionary computation ideas in the natural sciences. The talk will take us on a tour that will cover problems in nanoscience, e.g. controlling self-‐organizing systems, optimizing scanning probe microscopy, etc., problems arising in bioinformatics, such as predicting protein structures and their features, to challenges emerging in systems and synthetic biology. Although the algorithmic solutions involved in these problems are different from each other, at their core, they retain Darwin’s wonderful insights. I will conclude the talk by giving a personal view on why EC has been so successful and where, in my mind, the future lies.
These slides were used for a tutorial I gave at GECCO 2010. These are similar, yet not identical, to the other tutorials. The keynote file is too large for slideshare but if anybody needs the original I would be happy to provide a url from where to download it.
Integrative analysis of transcriptomics and proteomics data with ArrayMining ...Natalio Krasnogor
These slides are part of a presentation I gave on March 2010 at the BioInformatics and Genome Research Open Club at the Weizmann Institute of Science, Israel.
In these slides my student and I describe two web-applications for microarray and gene/protein set analysis,
ArrayMining.net and TopoGSA. These use ensemble and consensus methods as well as the
possibility of modular combinations of different analysis techniques for an integrative view of
(microarray-based) gene sets, interlinking transcriptomics with proteomics data sources. This integrative process uses tools from different fields, e.g. statistics, optimisation and network
topological studies. As an example for these integrative techniques, we use a microarray
consensus-clustering approach based on Simulated Annealing, which is part of the ArrayMining.net
Class Discovery Analysis module, and show how this approach can be combined in a modular
fashion with a prior gene set analysis. The results reveal that improved cluster validity indices can be obtained by merging the two methods, and provide pointers to distinct sub-classes within pre-defined tumour categories for a breast cancer dataset by the Nottingham Queens Medical Centre.
In the second part of the talk, I show how results from a supervised
microarray feature selection analysis on ArrayMining.net can be investigated in further detail with
TopoGSA, a new web-tool for network topological analysis of gene/protein sets mapped on a
comprehensive human protein-protein interaction network. I discuss results from a TopoGSA
analysis of the complete set of genes currently known to be mutated in cancer.
A Genetic Programming Challenge: Evolving the Energy Function for Protein Str...Natalio Krasnogor
In this talk I introduce a computational challenge for GP researchers, namely, the automated synthesis of energy functions for protein structure prediction.
Building Executable Biology Models for Synthetic BiologyNatalio Krasnogor
The leveraging of today's unprecedented capability to manipulate biological systems by state-of-the-art computational, mathematical and engineering techniques , may profoundly affect the way we approach the solution to pressing grand challenges such as the development of sustainable green energy, next generation healthcare, etc. The conceptual cornerstone of Synthetic Biology a field very much on its infancy- is that methodologies commonly used to design and construct non-biological artefacts (e.g. computer programs, airplanes, bridges, etc) might also be mastered to create designer living entities. Computational methods for modeling in Synthetic Biology consist of a list of instructions detailing an algorithm that can be executed and whose computation resembles the behavior of the biological system under study. This computational approach to modelling biological systems has been termed executable biology. In this talk I will describe current approaches for the automated generation and testing of executable biology models for synthetic biology.
This was a colloquioum talk at the Computer Science Department, Ben-Gurion University of the Negev, Israel (30/June/2009)
Extended Compact Genetic Algorithms and Learning Classifier Systems for Dimen...Natalio Krasnogor
In this talk we demonstrate an ECGA and LCS pipeline for reducing protein alphabets from the standard 20 to 5 or less symbols without significant loss of information. The pipeline tailors the reduction to different problems thus resulting on different optimal minimal alphabets.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
DERIVATION OF MODIFIED BERNOULLI EQUATION WITH VISCOUS EFFECTS AND TERMINAL V...Wasswaderrick3
In this book, we use conservation of energy techniques on a fluid element to derive the Modified Bernoulli equation of flow with viscous or friction effects. We derive the general equation of flow/ velocity and then from this we derive the Pouiselle flow equation, the transition flow equation and the turbulent flow equation. In the situations where there are no viscous effects , the equation reduces to the Bernoulli equation. From experimental results, we are able to include other terms in the Bernoulli equation. We also look at cases where pressure gradients exist. We use the Modified Bernoulli equation to derive equations of flow rate for pipes of different cross sectional areas connected together. We also extend our techniques of energy conservation to a sphere falling in a viscous medium under the effect of gravity. We demonstrate Stokes equation of terminal velocity and turbulent flow equation. We look at a way of calculating the time taken for a body to fall in a viscous medium. We also look at the general equation of terminal velocity.
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...University of Maribor
Slides from:
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Track: Artificial Intelligence
https://www.etran.rs/2024/en/home-english/
Salas, V. (2024) "John of St. Thomas (Poinsot) on the Science of Sacred Theol...Studia Poinsotiana
I Introduction
II Subalternation and Theology
III Theology and Dogmatic Declarations
IV The Mixed Principles of Theology
V Virtual Revelation: The Unity of Theology
VI Theology as a Natural Science
VII Theology’s Certitude
VIII Conclusion
Notes
Bibliography
All the contents are fully attributable to the author, Doctor Victor Salas. Should you wish to get this text republished, get in touch with the author or the editorial committee of the Studia Poinsotiana. Insofar as possible, we will be happy to broker your contact.
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/
Plenary Speaker slides at the 2016 International Workshop on Biodesign Automation
1. 60IWBDA 2016 - Newcastle Upon Tyne /
Accelerating Synthetic Biology
via Software and Hardware
Advances
Prof. Natalio Krasnogor
Interdisciplinary Computing and Complex BioSystems (ICOS) Research Group
Centre for Bacterial Cell Biology
Centre for Synthetic Biology and the Bioeconomy
Newcastle University
Natalio.Krasnogor@newcastle
http://homepages.cs.ncl.ac.uk/natalio.krasnogor/
twitter: @NKrasnogor
1
Tuesday, 6 September 16
2. 60IWBDA 2016 - Newcastle Upon Tyne /
Outline
• Computational & Hardware support for designing and
manufacturing Combinatorial DNA at your Desk
• Machine Intelligence for Synthetic Biology
•Conclusions
2
Tuesday, 6 September 16
3. 60IWBDA 2016 - Newcastle Upon Tyne /
N
• Different scales require different “programming
languages”, e.g. DNALD, SBOL, IBL, etc for
modularity, hierarchical abstraction, reusability
& standardisation across scales
• Microfluidics for writing DNA but also as a
“wind-tunnel” on your desktop, e.g.,:
• to try out multiple designs and gather data
• to optimise cell-free kits for ad-hoc
applications
• to combinatorial stress-test synthetic cell
systems
• Machine Intelligence & data analytics across
scales
3
Tuesday, 6 September 16
4. 60IWBDA 2016 - Newcastle Upon Tyne /4
Tuesday, 6 September 16
5. 60IWBDA 2016 - Newcastle Upon Tyne /
Reading and Writing DNA at your Desk
• The study of biology has accelerated rapidly thanks to
methods for massively parallel cell-free cloning and DNA
sequencing in desktop next generation sequencing (NGS)
machines
• The engineering of biology is still largely restrained by
limitations of gene synthesis and cloning methodologies
• Off-the-shelf Microfluidic is about to supercharge synthetic
biology by:
• increasing the throughput of gene synthesis
• reducing cost through miniaturization
• handle complexity of more ambitious designs through
autonomous liquid handling at source.
5
Tuesday, 6 September 16
6. 60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial DNA Synthesis on your Desktop
Parts
Library
Targets
Operators
Planer Assembly Plan
Instrument Instructions
Programable Order
Polymerization (POP)
Microfluidics Combinatorial
Assembly of DNA (M-CAD)
Microfluidics In Vitro
Cloning (MIC)
Key challenge is to enable
precise design, editing and
manufacturing of combinatorial
DNA libraries at your desk.
CAD
CAM
6
Tuesday, 6 September 16
7. 60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial DNA Synthesis on your Desktop
Parts
Library
Targets
Operators
Planer Assembly Plan
Instrument Instructions
Programable Order
Polymerization (POP)
Microfluidics Combinatorial
Assembly of DNA (M-CAD)
Microfluidics In Vitro
Cloning (MIC)
Key challenge is to enable
precise design, editing and
manufacturing of combinatorial
DNA libraries at your desk.
CAD
CAM
and then find
out what the
heck just
happened!?!?
6
Tuesday, 6 September 16
8. 60IWBDA 2016 - Newcastle Upon Tyne /
A Programming Language for Sequences:
DNALD (DNA Library Design)
A specification language that
produces a set of target DNA
sequences as a function of
operations on a set of inputs
To maximise impact the specification process must be:
• user friendly and debuggable
• but expressively powerful enough to:
• define non-trivial combinatorial constructs
• communicate degrees of freedom
7
Tuesday, 6 September 16
9. 60IWBDA 2016 - Newcastle Upon Tyne /
DNA Library Designer with
DNALD
8
Tuesday, 6 September 16
11. 60IWBDA 2016 - Newcastle Upon Tyne /
Suggests quick fixes
resolve names
correct indices
10
Tuesday, 6 September 16
12. 60IWBDA 2016 - Newcastle Upon Tyne /
Search across projects
search
results
navigate
workspace
11
Tuesday, 6 September 16
13. 60IWBDA 2016 - Newcastle Upon Tyne /
Compare differences
between files and versions
duplicate each or
every change
highlights insertions
and deletions
12
Tuesday, 6 September 16
14. 60IWBDA 2016 - Newcastle Upon Tyne /
Graphical Representation of
Complex DNA Libraries
Assembly plan
13
Tuesday, 6 September 16
15. 60IWBDA 2016 - Newcastle Upon Tyne /
And Paired Visualisations
l Emphasises reuse with shared nodes and provides
indication of library's combinatorial degree
l Every path from 5' to 3' is an output
Graphical Representation of
Complex DNA Libraries
14
Tuesday, 6 September 16
16. 60IWBDA 2016 - Newcastle Upon Tyne /
How can DNALD be extended?
• Plug-ins could be added to add semantics to variants, eg:
• different codon usage or codon tables for same protein sequence
• different coded protein sequence with same physico-chemical
properties
•
Equivalent/Reduced Alphabets
for Contact Number preservation
Equivalent/Reduced Alphabets
for solvent accessibility preservation
Text
Automated Alphabet Reduction for Protein Datasets. BMC Bioinformatics, 2009, 10:6
15
Tuesday, 6 September 16
17. 60IWBDA 2016 - Newcastle Upon Tyne /
How can DNALD be extended?
• Plug-ins could be added to use eg:
• Statistical or machine learning driven design of experiments
Text
16
Tuesday, 6 September 16
18. 60IWBDA 2016 - Newcastle Upon Tyne /
How can DNALD be extended?
Planning heuristics adaptable to other assembly protocols
17
Tuesday, 6 September 16
19. 60IWBDA 2016 - Newcastle Upon Tyne /
EXAMPLES
18
Tuesday, 6 September 16
20. 60IWBDA 2016 - Newcastle Upon Tyne /
Stem Cell Reprogramming (UKB)
Frank Edenhofer
19
Tuesday, 6 September 16
21. 60IWBDA 2016 - Newcastle Upon Tyne /
Operons Rewiring (UEVE)
François Képès
20
Tuesday, 6 September 16
22. 60IWBDA 2016 - Newcastle Upon Tyne /
From the DNA Library to the Synthesis Plan
l When O={+} & P=unrestricted è
Planning problem
l Related computational problem
bounded-depth min-cost string
production (BDMSP) is NP-hard
and APX-hard by reduction from
vertex cover
21
Tuesday, 6 September 16
23. 60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial DNA Synthesis on your Desktop
Parts
Library
Targets
Operators
Planer Assembly Plan
Instrument Instructions
Programable Order
Polymerization (POP)
Microfluidics Combinatorial
Assembly of DNA (M-CAD)
Microfluidics In Vitro
Cloning (MIC)
Key challenge is to enable
precise design, editing and
manufacturing of combinatorial
DNA libraries at your desk.
CAD
CAM
22
Tuesday, 6 September 16
24. 60IWBDA 2016 - Newcastle Upon Tyne /23
Tuesday, 6 September 16
25. 60IWBDA 2016 - Newcastle Upon Tyne /
One Pot VS Generic Protocols
Microfluidic gene synthesis is advancing fast to:
• overcome the limitation of strictly assembling genes
in one pot reactions & accommodate a range of
assembly methods.
• be able to execute ad hoc gene synthesis via
programmability over droplet routing.
• enable the implementation of complex & parallel
schemes (which are challenging to execute both
manually and on liquid handling robots)
• able to accommodate different construction protocols.
•More reproducible
Zhou,X et al. Microfluidic
PicoArray synthesis of
oligodeoxynucleotides and
simultaneous assembling of
multiple DNA sequences.
Nucleic Acids Res., 32,
5409–5417. 2004
Tian,J., et al. .
Advancinghigh-throughput
gene synthesis technology.
Mol. Biosyst., 5, 714–722.
2009
Quan,J.,et al. Parallel on-chip
gene synthesis and
application to optimization of
protein expression. Nat.
Biotechnol., 29, 449–452.
2011
24
Tuesday, 6 September 16
26. 60IWBDA 2016 - Newcastle Upon Tyne /
Programmable Liquid Handling
25
Tuesday, 6 September 16
27. 60IWBDA 2016 - Newcastle Upon Tyne /26
Tuesday, 6 September 16
28. 60IWBDA 2016 - Newcastle Upon Tyne /
What Can Be Done
• Synthesis of Genes de novo ==> POP assembly
• Construction of Rationally Designed (DNALD) Combinatorial
Gene Libraries ==> M-CAD
• Cell-free cloning of assembled synthetic DNA ==> M-IC
• Sequenced validation
• Downstream (application) validation
on-chip
off-chip
27
Tuesday, 6 September 16
29. 60IWBDA 2016 - Newcastle Upon Tyne /
Post-transcriptional regulation of Azurin, a bacterial QS-
activated gene (Nottingham & Newcastle)
Koch, Heeb, Camara, Dubern, Krasnogor
28
Tuesday, 6 September 16
30. 60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial Library Design (DNALD) &
Construction (EWD): the Azurin example
• Bacteria regulate gene expression at the transcriptional
and post- transcriptional level
• RsmA global post-transcriptional regulator, modulates
switch between acute and chronic infection (p. aeruginosa
@ cystic fibrosis)
• RsmA positively and negatively regulates target mRNAs
by binding to mRNA secondary structures (stem loops-
palindromic sequences)
•RsmA homologues (CsrA) present in a variety of bacteria,
Gram-positive and Gram-negative
29
Tuesday, 6 September 16
31. 60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RmsA
positively regulates Azurin
Three hypothetical loops in the mRNA
2nd and 3rd AGGA is in the loop of the stem
30
Tuesday, 6 September 16
32. 60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RrmsA
positively regulates Azurin
31
Tuesday, 6 September 16
33. 60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RrmsA
positively regulates Azurin
32
Tuesday, 6 September 16
34. 60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RrmsA
positively regulates Azurin
33
Tuesday, 6 September 16
35. 60IWBDA 2016 - Newcastle Upon Tyne /
Post-transcriptional regulation of Azurin, a bacterial QS-
activated gene (Nottingham & Newcastle)
Koch, Heeb, Camara, Dubern, Krasnogor
34
Tuesday, 6 September 16
36. 60IWBDA 2016 - Newcastle Upon Tyne /
M-CAD
35
Tuesday, 6 September 16
37. 60IWBDA 2016 - Newcastle Upon Tyne /
M-CAD
36
Tuesday, 6 September 16
38. 60IWBDA 2016 - Newcastle Upon Tyne /
Results
•Gel electrophoresis analysis
of a representative set of 16 of
the Azurin library targets shows
that all constructs are of the
expected size with no spurious
assembly products
•Western blot from extracts of
Pseudomonas aeruginosa
expressing the azurine gene
incubated with anti-azurin
polyclonal antibodies
37
Tuesday, 6 September 16
39. 60IWBDA 2016 - Newcastle Upon Tyne /
Outline
• Computational & Hardware support for designing and
manufacturing Combinatorial DNA at your Desk
• Machine Intelligence for Synthetic Biology
•Conclusions
38
Tuesday, 6 September 16
40. 60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Polymers For Controlling QS
Dependent Phenotypes
Bacterial Sequestrant
Dual action
QS Quencher
39
Tuesday, 6 September 16
41. 60IWBDA 2016 - Newcastle Upon Tyne /
10s of Persons-years!
40
Tuesday, 6 September 16
42. 60IWBDA 2016 - Newcastle Upon Tyne /
On Roll Royces & Ford Ts: an analogy
• Hand-crafted
• + Comfortable
• + Reliable/Robust
• Faster
• + Expensive
• Selective
• Assembly Line Product
• - Comfortable
• - Reliable/Robust
• Slower
• Cheaper
• Ubiquitous/Popular
41
Tuesday, 6 September 16
43. 60IWBDA 2016 - Newcastle Upon Tyne /
Modular models for SynBio design
http://www.virtualparts.org
42
Tuesday, 6 September 16
44. 60IWBDA 2016 - Newcastle Upon Tyne /
What does the VPR do?
•Provides modular, composable,
dynamic models of genetic components
•AND includes models of the upper
layers of molecular biology they
encode (mRNA, proteins, metabolites
etc.)
•AND their interactions
•SBML and Rule Based
•Facilitates model-based design
•Supports automated design
•e.g. Computational Intelligence
•Supports CAD tools and languages
G. Misirli, J. Hallinan, and A. Wipat, “Composable modular models for synthetic
biology,” ACM J. Emerging Technologies in Computing Systems, vol. 11, iss. 3, pp. 1-19,
2014
43
Tuesday, 6 September 16
45. 60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Open Language (SBOL)
•Synthetic biology standard
(currently Version 2.0):
•Designed to allow for the
exchange of descriptions of
genetic parts, devices,
modules, and systems.
•Facilitates storage of genetic
designs in repositories.
•Allows for designs of genetic
parts and systems to be
embedded in publications.
•SBOL can be used to create
workflows between different
tools Galdzicki et al., Nature Biotechnology (2014)
Six independent groups collaborated on
the design of a set of genetic toggle
switches. using several SBOL enabled
tools.
44
Tuesday, 6 September 16
46. 60IWBDA 2016 - Newcastle Upon Tyne /45
An Environment for Augmented Biodesign Using Integrated Data Resources James McLaughlin, Goksel Misirli, Matthew Pocock, and Anil Wipat
IWBDA 2016
Tuesday, 6 September 16
47. 60IWBDA 2016 - Newcastle Upon Tyne /
User
create data-informed design
Data augmented
design
AmBiT
Data enrichment:
BLAST
EMBOSS
database cross refs
Other SBOL Stack
instances
46
An Environment for Augmented Biodesign Using Integrated Data Resources James McLaughlin, Goksel Misirli, Matthew Pocock, and Anil Wipat
IWBDA 2016
Tuesday, 6 September 16
48. 60IWBDA 2016 - Newcastle Upon Tyne /
Meta-Stochastic Simulation
ssapredict - Web application using
classifiers as a tool for biologists to
deduce the best stochastic simulation
algorithm for their model
User simply clicks to upload
stochastic model in SBML format
Fast model property analysis is
performed (C++ and igraph)
Algorithm prediction performed using
biomodels analysis. (Linear SVC
using python sklearn)
Results displayed. User can then
download preconfigured simulator to
execute their model
47
Tuesday, 6 September 16
49. 60IWBDA 2016 - Newcastle Upon Tyne /
Automated Model Analysis for
Simulations Reaction & species
dependency graphs
generated from models
Clocks identify fast to
compute properties
48
Tuesday, 6 September 16
50. 60IWBDA 2016 - Newcastle Upon Tyne /
Model analysis
49
Tuesday, 6 September 16
51. 60IWBDA 2016 - Newcastle Upon Tyne /
•Model checking: Exhaustively, verifies whether a property holds by a model of
a system. Statistical model checking (SMC) integrates the simulation
technique with model checking by generating and verifying a number of
simulation paths to determine an “approximate correctness” of queried
properties.
•Machine Learning method for selecting the most appropriate Stochastic
Simulation Algorithms (SSAs) has been extended to Statistical Model Checkers
(SMCs) selection.
•However, there are intrinsic differences between simulation algorithms and
model checkers; model checkers require both the model & property
specifications.
•Our methodology is illustrated for frequently used properties in the literature,
called property patterns.
Automated Model Analysis for
Formal Verification
In collaboration with Prof. M. Gheorghe, Dr. Savas
Konur (Bradford University) & Mehmet E. Bakir
(Sheffield University)
50
Tuesday, 6 September 16
52. 60IWBDA 2016 - Newcastle Upon Tyne /
Verification Patterns
•Patterns are frequently used property types for querying
features of models (e.g., something is always the case,
something will eventually be the case)
•Below are 8 frequently used patterns represented in natural
language and using existing temporal logic operators
51
Tuesday, 6 September 16
53. 60IWBDA 2016 - Newcastle Upon Tyne /
Fastest model checkers
52
Tuesday, 6 September 16
54. 60IWBDA 2016 - Newcastle Upon Tyne /
Fastest model checkers
53
Tuesday, 6 September 16
55. 60IWBDA 2016 - Newcastle Upon Tyne /
SMCs Prediction
•The SSAs prediction method has been extended by allowing parallel edges
for species and reaction dependency graphs and some non-graph properties
such as, the number of updated variables involved in a reaction - min, mean,
max and sum of the update values.
•Support Vector Machine (SVM) prediction of the fastest SMC presented
below.
Patterns Accuracy
Eventually 0.945
Always 0.927
Follows 0.961
Precedes 0.967
Never 0.942
Steady-State 0.939
Until 0.941
Infinitely-Often 0.961
54
Tuesday, 6 September 16
56. 60IWBDA 2016 - Newcastle Upon Tyne /
Outline
• Computational & Hardware support for designing and
manufacturing Combinatorial DNA at your Desk
• Machine Intelligence for Synthetic Biology
•Conclusions
55
Tuesday, 6 September 16
57. 60IWBDA 2016 - Newcastle Upon Tyne /
u domain specific language for
synthetic biology
u SB entities (genes, proteins,
promoters) first class entities
u implemented as Eclipse RCP
Synthetic Biology Life Cycle
Design
u emphasis on high performance
u 9 different stochastic simulation
algorithm variants
u automated algorithm selection
u MPI support
Simulation
VerificationBiocompilation
u quasi-natural language for
definition of properties
u automatic translation into
temporal logics
u automated algorithm
selection
u links to sequence repositories
u design completion with terminators,
RBS, spacers, ...
u consideration of custom constraints
VERIFY [ GFP > 0 uM ] EVENTUALLY HOLDS
VERIFY [ GFP > 0 uM ] ALWAYS HOLDS
VERIFY [ GFP > 2*RFP ] NEVER HOLDS
GTATAATTACGGCTACAATGCGCCGTTATT
56
Tuesday, 6 September 16
58. 60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
Design
Simulation
VerificationBiocompilation
Data Analytics &
Machine
Intelligence
“Wind Tunneling”
via desktop
microfluidics
57
Tuesday, 6 September 16
59. 60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
58
Tuesday, 6 September 16
66. 60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
disrupted by machine learning, data analytic and peer-to-peer
data-driven bio-manufacturing
so we can
finally find out
what the heck
just
happened!?!?
Like “Neural
Grafting” for
BioRobots
59
Tuesday, 6 September 16
67. My colleagues at the ICOS and CSBB in Newcastle
Prof. A. Wipat (Newcastle U.)
Dr. M. Gheorghe (Bradford U.)
Dr. J. Bacardit (Newcastle U.)
Prof. P. Wright (Newcastle U.)
Prof. C. Alexander (U. Nottingham)
Dr. F. Fernandez-Trillo (U. Birmingham)
Prof. M. Camara (U. Nottingham)
Dr. S. Heeb (U. Nottingham)
Dr. J. Dubern (U. Nottingham)
Prof. C. Biggs (U. Sheffield)
Dr. S. Konur (Bradford U.)
Dr. S. Kalvala (Warwick U.)
Dr. C. Ladrou (Warwick U.)
Dr. C. Delattre (Illumina)
Dr. A. Rivald (Illumina)
Prof. E. Shapiro (Weizmann Institute)
Dr. T. Ben Yehezquel (Weizmann Institute)
Prof. U. Feigel (Weizmann Institute)
!
60IWBDA 2016 - Newcastle Upon Tyne /
Acknowledgements
EP/N031962/1
EP/J004111/2
EP/D021847/2
EP/I031642/2
BB/F01855X/1
BB/D019613/1
5 Years Research Managing Director
for a new £8M grant:
http://tinyurl.com/h99vl3h
closing date: 5/September/2016
60
Tuesday, 6 September 16