QIAGEN, profile picture
Uploaded byQIAGEN
PDF, PPTX2,791 views

New Progress in Pyrosequencing for DNA Methylation

The document discusses advancements in pyrosequencing technology for automated DNA methylation analysis, highlighting challenges such as insufficient read lengths and incomplete bisulfite conversion. It introduces the PyroMark Q48 Autoprep and emphasizes its potential in overcoming these bottlenecks for epigenetic research. Additionally, it outlines the workflow for sample preparation and data analysis critical for reliable quantification of DNA methylation.

Embed presentation

Download as PDF, PPTX
Sample to Insight New progress in Pyrosequencing for automated single base resolution DNA methylation analysis for epigenetic research Gerald Schock, Ph.D. Associate Director Pyrosequencing QIAGEN GmbH New progress in Pyrosequencing for epigentic applications 1
Sample to Insight 2 QIAGEN products shown here are intended for molecular biology applications. These products are not intended for the diagnosis, prevention or treatment of a disease. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.QIAGEN.com or can be requested from QIAGEN Technical Services or your local distributor. Legal disclaimer New progress in Pyrosequencing for epigentic applications
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Challenges in Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 6 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 7 .Based on SEQUENCING-by-SYNTHESIS Principle* • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides * Ronaghi, M., Uhlén, M., Nyrén, P. (1998) A sequencing method based on real-time pyrophosphate. Science. 281:363. Step 1 Hybridization of a sequencing primer Step 2-4 Addition of dNTP, conversion into light signal, degradation of nucleotides Step 5 Pyrogram generation and data analysis
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 8 Sequencing through unknown regions Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 9 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 10 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides QIAGEN webinar: New progress in Pyrosequencing for automated quantitative analysis of bi- or multi-allelic sequence variations Recorded sessions: View online at www.qiagen.com
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 11 Insertions / Deletions - - - - - - - : 56% ATCTGCC: 44% C: 57% T: 43% A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 12 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions DNA methylation of multiple CpG sites .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 13 DNA methylation of multiple CpG sites A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight QIAGEN’s Pyrosequencing solutions for DNA methylation analysis 14 • PAXgene Blood DNA Tube • QIAamp Kits • AllPrep RNA/ DNA Kits • EpiTect Fast DNA Kits • EpiTect Fast LyseAll Kits • EpiTect Fast FFPE Kits • PyroMark Assay Design SW • PyroMark PCR Kit • PyroMark Q24 Advanced • PyroMark Q24 Advanced Reagents • PyroMark Q48 Autoprep • PyroMark Q48 Advanced Reagents Sample collection &/ stabilization DNA purification Assay design Bisulfite conversion Pre- amplification Pyro- sequencing PyroMark Assay Design SW PyroMark Q48 Advanced Kit PyroMark PCR Kit PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
Sample to Insight Pyrosequencing workflow – Assay design New progress in Pyrosequencing for epigentic applications 15 Assay design • Two PCR primers (one is biotinylated) o Biotin-labeled strand is isolated using Vacuum Prep Workstation • Sequencing primer o Placed in front of region of interest o Annealed to single-stranded DNA before Pyrosequencing reaction PCR primer Region of interest PCR primer Sequencing primer DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
Sample to Insight Pyrosequencing workflow - PCR New progress in Pyrosequencing for epigentic applications 16 PCR / RT-PCR • Can use any PCR machine • PyroMark PCR Kit / PyroMark OneStep RT-PCR Kit • Amplify relevant region by PCR (up to 500 bp) • Can use very short PCR products if desired (i.e. degraded DNA) • One primer has to be biotinylated DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
Sample to Insight Pyrosequencing workflow – Template preparation New progress in Pyrosequencing for epigentic applications 17 Template preparation • Separates biotinylated PCR strand from unbiotinylated strand and PCR primers • Streptavidin-coated Sepharose beads used for binding biotinylated PCR strand • Immobilization and separation by using o Sepharose beads and vacuum prep workstation (PyroMark Q96 ID, Q24, Q24 Adv) o Magnetic Sepharose beads (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
Sample to Insight Pyrosequencing workflow – Template preparation New progress in Pyrosequencing for epigentic applications 18 Annealing of Sequencing primer • Sequencing primer only binds to biotinylated PCR strand • ssDNA is needed for binding • Binding done o Manually (PyroMark Q96 ID, Q24, Q24 Adv) o Automated (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing Sequencing primer
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 19 Example: DNA methylation analysis .A G T T A C G A C A.Sequence to be analyzed: .After bisulfite conversion: .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .Analyzed sequence: X .A .G .T .A .A.T/C .T.T G .A
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 20 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
Sample to Insight Measuring frequencies in sequence variations 21 Quantitative peak heights to measure allele frequencies Wasson et al. 2002. Assessing allele frequencies of single nucleotide polymorphisms in DNA pools by Pyrosequencing technology. Biotechniques. 32:1144–1152. New progress in Pyrosequencing for epigentic applications Even as little as 2% of one allele in 98% of the other could be detected
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 22 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 23 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed: Ratio T:C
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 24 Example: DNA methylation analysis Ratio T:C C=0% T=100% .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Built-in quality control: successful bisulfite conversion X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed:
Sample to Insight Improving bisulfite conversion efficiency New progress in Pyrosequencing for epigentic applications 25 Superior bisulfite conversion. Following bisulfite conversion of genomic DNA using the EpiTect Fast DNA Bisulfite Kit or a kit from Supplier Z, unconverted genomic DNA and bisulfite converted DNA were coamplified and then sequenced by Pyrosequencing. EpiTect Fast Kits showed better results when a limited amount of DNA was analyzed (10 ng). DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing EpiTect Fast Bisulfite conversion Complete conversion ensures reliable quantification of DNA methylation
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 27 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Advanced Pyrosequencing Technology 28 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing New progress in Pyrosequencing for epigentic applications Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT
Sample to Insight Effects of low level incomplete bisulfite conversion 29 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally C Cm U Cm T C Bisulfite conversion PCR New progress in Pyrosequencing for epigentic applications
Sample to Insight Effects of low level incomplete bisulfite conversion 30 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% New progress in Pyrosequencing for epigentic applications After bisulfite conversion, some C nucleotides in some molecules remain unconverted. Conversion efficiency of EpiTect Kits is around 99.4–99.6%. Other kits show conversion efficiencies of 95–98%. Incomplete bisulfite conversion may affect Pyrosequencing results
Sample to Insight Effects of low level incomplete bisulfite conversion 31 Sample: unmethylated DNA (conventional Pyrosequencing) C T C T C A T T T T T A gDNA G A C G A T G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% T T T T T A G A T G A Tafter bis. ideally x% T A G A T C G A T single peak 5x peak wrong calculation peak deviations New progress in Pyrosequencing for epigentic applications
Sample to Insight Multiple dispensations act as “catch up” in Advanced Pyrosequencing 32 Sample: unmethylated DNA (Advanced Pyrosequencing) 0% T A G A T C G T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T A T single peak 5x peak +C +T less peak deviations → longer reads C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% correct calculation New progress in Pyrosequencing for epigentic applications
Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 33 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence
Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 34 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Conventional Pyrosequencing may show uncertain quantification results in long sequencing runs
Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 35 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Increasing peak deviation from expected signals in late sequence positions
Sample to Insight Advanced Pyrosequencing increases read length and trust New progress in Pyrosequencing for epigentic applications 36 Conventional vs. Advanced Pyrosequencing analysis of the LOX gene locus PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence Advanced Pyrosequencing overcomes issues of low level incomplete bisulfite conversion
Sample to Insight Issues with quantification of CpG methylation in homopolymers 37 Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT After bisulfite conversion TTYGYGATTGAATTYGAAAGATTTTTTTYGGYGGATGAAAGTYGTTATTTTTTGGTTGGTTGAGTTATAGTTTT 8xT if C is not methylated 7xT if C is methylated 6xT 4xT Histogram New progress in Pyrosequencing for epigentic applications Bisulfite conversion in DNA methylation analysis leads to occurrence of poly T stretches
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Improved quantification of CpG methylation in homopolymers 39 PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence New progress in Pyrosequencing for epigentic applications PyroMark Q24 Advanced enables reliable quantification of CpG methylation behind and even within a stretch of 8 T nucleotides
Sample to Insight Advanced Pyrosequencing Technology 40 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ de novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 41 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 42 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 43 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 44 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) PyroMark Analysis SW optimized analysis New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 45 PyroMark Platforms offering Advanced Pyrosequencing Advanced Pyrosequencing is available on two PyroMark Platforms PyroMark Q24 Advanced PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 46 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight PyroMark Q48 Autoprep – Workflow New progress in Pyrosequencing for epigentic applications 47 Workflow comparison of available Pyrosequencing platforms Sample preparation Assay design PCR amplification ssDNA preparation Analysis • PyroMark Q24 Vacuum Workstation • PyroMark Q96 Vacuum Workstation • PyroMark Q24 • PyroMark Q24 Adv. • PyroMark Q96 ID • PyroMark Q48 AutoprepNEW ssDNA preparation and analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing
Sample to Insight PyroMark Q48 Autoprep – Protocol New progress in Pyrosequencing for epigentic applications 48 Automatic template preparation fully integrated in PyroMark Q48 Autoprep workflow Load reagents, nucleotides, buffers Load PCR product & magnetic beads Insert Absorber strip & Disc Load Run files via USB or Ethernet Automatic template preparation Pyro- sequencing Analyze data
Sample to Insight PyroMark Q48 Autoprep – Dimensions & Weight 49 390 mm (L, closed) 300mm(H) 560 mm (L, open) 250 mm (W) Small footprint and low weight (8.5 kg) New progress in Pyrosequencing for epigentic applications Small footprint (1/2 x PyroMark Q24) and low weight (1/3 x PyroMark Q24)
Sample to Insight PyroMark Q48 Autoprep – SW User Interface New progress in Pyrosequencing for epigentic applications 50 Large and easy-to-use touch screen and intuitive instrument SW
Sample to Insight PyroMark Q48 Autoprep offers highest degree of automation 51 Automated protocol steps along the Pyrosequencing workflow Load reagents, nucleotides, buffers Load PCR product & beads Manual template preparation with VPWS Anneal Seq- primer Pyro- sequencing Wash Cartridge & VPWS Load reagents, nucleotides, buffers Load PCR product & magnetic beads Automatic template preparation Anneal Seq- primer Pyro- sequencing PyroMark Q96 MD, Q96 ID, Q24, and Q24 Advanced PyroMark Q48 Autoprep • Multi-step pipette can be used for pipetting beads • Automatic pipetting system can be used manual automated manual/automated • Automatic dispensation of up to 3 Seq primers • Manual dispensation for 4 or more Seq primers • Automatic dispensation of 3 MPD* Mixes *MPD: Multiple Primer Dispensation Wash Cartridge New progress in Pyrosequencing for epigentic applications
Sample to Insight Summary New progress in Pyrosequencing for epigentic applications 52 PyroMark Q48 Autoprep for “Advanced” Pyrosequencing in DNA methylation analysis • Cost-efficient tool for analyzing DNA methylation • Consecutive CpG and CpN sites analyzed independently in a single run • Improved quantification at any sequence position, even at homopolymer T sequences • Direct quality control of bisulfite conversion during the run • Fast processing: 48 samples in minutes • Automated Pyrosequencing through integrated template prep • Low sample input amounts: 1–10 ng • Highly accurate quantification: • LOD: 5% in methylation analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing for longer reads and more accurate methylation analysis
Sample to Insight PyroMark Q48 Autoprep on the web 53 More information about the platform, accessories and reagents are available online New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-autoprep/ https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-advanced-reagents/
Sample to Insight PyroMark Q48 Autoprep Intro Page 54New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/resources/technologies/pyrosequencing-resource-center/
Sample to Insight Challenges in Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications

More Related Content

PPTX
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
byQIAGEN
 
PDF
Dna Methylation Analysis in a Single Day - Download the Slides
byQIAGEN
 
PDF
DNA Methylation: An Essential Element in Epigenetics Facts and Technologies
byQIAGEN
 
PPTX
Pyrosequencing
byqadardana kakar
 
PPTX
CRISPR/CAS9- THE GENE EDITING TOOL
byChandni Verma
 
PDF
Genome editing with CRISPR/Cas9
bySaravanan KA
 
PDF
Sanger & maxam gilbert sequencing @ujjwalsirohi
byujjwal sirohi
 
PPTX
Crispr cas
byJaiKishan76
 
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
byQIAGEN
 
Dna Methylation Analysis in a Single Day - Download the Slides
byQIAGEN
 
DNA Methylation: An Essential Element in Epigenetics Facts and Technologies
byQIAGEN
 
Pyrosequencing
byqadardana kakar
 
CRISPR/CAS9- THE GENE EDITING TOOL
byChandni Verma
 
Genome editing with CRISPR/Cas9
bySaravanan KA
 
Sanger & maxam gilbert sequencing @ujjwalsirohi
byujjwal sirohi
 
Crispr cas
byJaiKishan76
 

What's hot

PPTX
Dna sequencing ppt
bySiddaraj Basavaraj
 
PPTX
Dna sequencing
bysiddhali shirude
 
PPTX
Pcr n optimization
byArsalanibrahim1
 
PDF
Transcriptome Analysis & Applications
by1010Genome Pte Ltd
 
PPTX
Plant Epigenetics in crop Improvement
bysukruthaa
 
PPTX
Tilling & Eco-tilling.pptx
byPrabhatSingh628463
 
PPTX
Next Generation Sequencing and its Applications in Medical Research - Frances...
bySri Ambati
 
PPTX
Forward and reverse genetics
byVinod Pawar
 
PPTX
SEMINAR ON CRISPR
byMan Mohan Soni
 
PPT
In situ Hybridization (ISH) and Fluorescence in Situ Hybridization (FISH)
byCreative-Diagnostics
 
PPT
Crispr
byMusharraf Ali
 
PPTX
CRISPR/CAS9 ppt by sanjana pandey
bySANJANA PANDEY
 
PPTX
PRINCIPLE OF CRISPR GENOME EDITING
byUNIVERSITI MALAYSIA SABAH
 
PPTX
Alternative splicing : mechanism and regulation
bySmrutirekha Sahu
 
PPTX
Crispr
byjain7177
 
PDF
Crispr cas
byamoldchokhat
 
PPTX
Gene silencing
byHajra sabir
 
PPTX
Restriction enzymes
byArjunaRajaKannan
 
PDF
Crispr application
byCreative Biogene
 
PPTX
Crispr cas ppt by ashish
byAshish Kumar Shukla
 
Dna sequencing ppt
bySiddaraj Basavaraj
 
Dna sequencing
bysiddhali shirude
 
Pcr n optimization
byArsalanibrahim1
 
Transcriptome Analysis & Applications
by1010Genome Pte Ltd
 
Plant Epigenetics in crop Improvement
bysukruthaa
 
Tilling & Eco-tilling.pptx
byPrabhatSingh628463
 
Next Generation Sequencing and its Applications in Medical Research - Frances...
bySri Ambati
 
Forward and reverse genetics
byVinod Pawar
 
SEMINAR ON CRISPR
byMan Mohan Soni
 
In situ Hybridization (ISH) and Fluorescence in Situ Hybridization (FISH)
byCreative-Diagnostics
 
Crispr
byMusharraf Ali
 
CRISPR/CAS9 ppt by sanjana pandey
bySANJANA PANDEY
 
PRINCIPLE OF CRISPR GENOME EDITING
byUNIVERSITI MALAYSIA SABAH
 
Alternative splicing : mechanism and regulation
bySmrutirekha Sahu
 
Crispr
byjain7177
 
Crispr cas
byamoldchokhat
 
Gene silencing
byHajra sabir
 
Restriction enzymes
byArjunaRajaKannan
 
Crispr application
byCreative Biogene
 
Crispr cas ppt by ashish
byAshish Kumar Shukla
 

Similar to New Progress in Pyrosequencing for DNA Methylation

PDF
Using methylation patterns to determine origin of biological material and age
byQIAGEN
 
PPTX
Conventional and next generation sequencing ppt
byAshwini R
 
PPT
DNA sequencing by kk sahu sir
byKAUSHAL SAHU
 
PPTX
Dna sequencing
byNaima Qureshi
 
PPTX
Pyrosequencing
byMaheen Shamim
 
PPTX
Molecular genetic diagnosis
byariva zhagan
 
PPTX
The post-genomic era: epigenetic sequencing applications and data integration
byMaté Ongenaert
 
PPTX
Dna sequencing
byKeerthana Manoharan
 
PDF
Investigate the Molecular Basis of Disease
byQIAGEN
 
PPT
Adv lec4
byWael Katma
 
PPTX
Gene mapping and sequencing
byPREETAM PALKAR
 
PDF
DNA sequencing mapping pdf.pdf
byNetHelix
 
PDF
Prabhakar singh ii sem-paper-dna sequencing
byDepartment of Biochemistry, Veer Bahadur Singh Purvanchal Univarsity, Jaunpur
 
PPTX
Next Generation Sequencing
byAamir Wahab
 
PPTX
DNA sequencing.pptxnvbxgxgchjvjbkjnknll.m.
bymaninder1991
 
PPT
Dna sequencing AND ANALYSIS
byayesha sahi
 
PPTX
Sequencing based approaches for profiling dna methylation
bysciencelearning123
 
PDF
Data basics
byamlbinder
 
PDF
Goodwin2016 ngs 10 years
byPrakash Koringa
 
PPTX
20140613 Analysis of High Throughput DNA Methylation Profiling
byYi-Feng Chang
 
Using methylation patterns to determine origin of biological material and age
byQIAGEN
 
Conventional and next generation sequencing ppt
byAshwini R
 
DNA sequencing by kk sahu sir
byKAUSHAL SAHU
 
Dna sequencing
byNaima Qureshi
 
Pyrosequencing
byMaheen Shamim
 
Molecular genetic diagnosis
byariva zhagan
 
The post-genomic era: epigenetic sequencing applications and data integration
byMaté Ongenaert
 
Dna sequencing
byKeerthana Manoharan
 
Investigate the Molecular Basis of Disease
byQIAGEN
 
Adv lec4
byWael Katma
 
Gene mapping and sequencing
byPREETAM PALKAR
 
DNA sequencing mapping pdf.pdf
byNetHelix
 
Prabhakar singh ii sem-paper-dna sequencing
byDepartment of Biochemistry, Veer Bahadur Singh Purvanchal Univarsity, Jaunpur
 
Next Generation Sequencing
byAamir Wahab
 
DNA sequencing.pptxnvbxgxgchjvjbkjnknll.m.
bymaninder1991
 
Dna sequencing AND ANALYSIS
byayesha sahi
 
Sequencing based approaches for profiling dna methylation
bysciencelearning123
 
Data basics
byamlbinder
 
Goodwin2016 ngs 10 years
byPrakash Koringa
 
20140613 Analysis of High Throughput DNA Methylation Profiling
byYi-Feng Chang
 

More from QIAGEN

PDF
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
byQIAGEN
 
PDF
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
byQIAGEN
 
PDF
Reproducibility, Quality Control and Importance of Automation
byQIAGEN
 
PDF
Cancer Research & the Challenges of FFPE Samples – An Introduction
byQIAGEN
 
PDF
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
byQIAGEN
 
PDF
Critical Factors for Successful Real-Time PCR: Multiplex PCR
byQIAGEN
 
PDF
QIAGEN LNA Tools - Experience truly exceptional RNA Research
byQIAGEN
 
PDF
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
byQIAGEN
 
PDF
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
byQIAGEN
 
PDF
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
byQIAGEN
 
PDF
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
byQIAGEN
 
PDF
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
byQIAGEN
 
PDF
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
byQIAGEN
 
PDF
Take your RNA research to the next level with QIAGEN LNA tools!
byQIAGEN
 
PDF
Building a large-scale missing persons ID SNP panel - Download the study
byQIAGEN
 
PDF
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
byQIAGEN
 
PDF
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
byQIAGEN
 
PDF
Practical hints and new solutions for successful real-time PCR studies
byQIAGEN
 
PDF
The power of a splice
byQIAGEN
 
PDF
Take lung cancer research to a new molecular dimension
byQIAGEN
 
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
byQIAGEN
 
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
byQIAGEN
 
Reproducibility, Quality Control and Importance of Automation
byQIAGEN
 
Cancer Research & the Challenges of FFPE Samples – An Introduction
byQIAGEN
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
byQIAGEN
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
byQIAGEN
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
byQIAGEN
 
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
byQIAGEN
 
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
byQIAGEN
 
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
byQIAGEN
 
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
byQIAGEN
 
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
byQIAGEN
 
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
byQIAGEN
 
Take your RNA research to the next level with QIAGEN LNA tools!
byQIAGEN
 
Building a large-scale missing persons ID SNP panel - Download the study
byQIAGEN
 
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
byQIAGEN
 
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
byQIAGEN
 
Practical hints and new solutions for successful real-time PCR studies
byQIAGEN
 
The power of a splice
byQIAGEN
 
Take lung cancer research to a new molecular dimension
byQIAGEN
 

Recently uploaded

PDF
Lenvatinib Tablets: Uses, Benefits, Diseases Treated & Availability in the Ph...
byLetsMeds
 
PPTX
CPCSEA GUIDELINE (COMMITTEE FOR THE PURPOSE OF CONTROL AND SUPERVISION OF EXP...
byVinayPolpelliwar
 
PPTX
CELL PHYSIOLOGY: STRUCTURE AND FUNCTIONS
byDR.P.S SUDHAKAR
 
PDF
Filling in the Gaps in Hemophilia Guideline Recommendations: Evidence-Based S...
byi3 Health
 
PPTX
IgA Nephropathy: overview of Clinical trials (Journal Club)
byibrahimgalalah
 
PPTX
On DNA sequence chimeras, DNA sequence misannotation and interpretation issue...
byChristenRuneStensvol
 
PPTX
ENZYMOLOGY EC2_4.: CLINICAL ENZYMES AS THERAPEUTIC AGENTS: pptx
byESIC MEDICAL COLLEGE AND HOSPITAL ANDHERI EAST MUMBAI
 
PPTX
Acid base disorder and Arterial Blood Gas Analysis .pptx
byDr Sushil Gyawali
 
PPTX
2026 ADA Standards of Care:Summary of Changes
byDr. Om J Lakhani
 
PPTX
ENZYMOLOGY: IUBMB SYSTEM: COENZYMES: COFACTORS
byESIC MEDICAL COLLEGE AND HOSPITAL ANDHERI EAST MUMBAI
 
PDF
Novo protocolo (7) da ABM sobre Políticas de Apoio à AMAMENTAÇÃO em MATERNIDADES
byProf. Marcus Renato de Carvalho
 
PDF
Partograph: It is a composite graphical recording of cervical dilatation and ...
byMayuriGamit2
 
PPTX
MEDICAL RESEARCH UNIT_III_RESEARCH METHODOLOGY & BIOSTATISTICS.pptx
byDHANASHREE KOLHEKAR
 
PPTX
Research Methodology_UNIT_V_Declaration of Helsinki M. Pharm (IIIrd Sem.).pptx
byDHANASHREE KOLHEKAR
 
PPTX
Oncology Physiotherapy_ A Key Piece in Cancer Care Puzzle.pptx
byasmitashresthapt
 
PPTX
Ginger_Research_Presentation_Updated (2).pptx
byMadan Bhandari university and St. Xavier's college , Maitighar
 
PDF
MIndsets in Career of Emergency Medicine
byChing-Hsing Lee
 
PPTX
ATTENTION (PSYCHOLOGY IN NURSING) COGNITIVE PROCESS.pptx
byPahari Sharma
 
PPTX
Types of Hernia Treated by the Best Hernia Surgeon in Ahmedabad
byGastro Clinic
 
PPTX
NERVOUS SYSTEM11 by Gulshan athbhaiya.pptx
byGulshan Athbhaiya
 
Lenvatinib Tablets: Uses, Benefits, Diseases Treated & Availability in the Ph...
byLetsMeds
 
CPCSEA GUIDELINE (COMMITTEE FOR THE PURPOSE OF CONTROL AND SUPERVISION OF EXP...
byVinayPolpelliwar
 
CELL PHYSIOLOGY: STRUCTURE AND FUNCTIONS
byDR.P.S SUDHAKAR
 
Filling in the Gaps in Hemophilia Guideline Recommendations: Evidence-Based S...
byi3 Health
 
IgA Nephropathy: overview of Clinical trials (Journal Club)
byibrahimgalalah
 
On DNA sequence chimeras, DNA sequence misannotation and interpretation issue...
byChristenRuneStensvol
 
ENZYMOLOGY EC2_4.: CLINICAL ENZYMES AS THERAPEUTIC AGENTS: pptx
byESIC MEDICAL COLLEGE AND HOSPITAL ANDHERI EAST MUMBAI
 
Acid base disorder and Arterial Blood Gas Analysis .pptx
byDr Sushil Gyawali
 
2026 ADA Standards of Care:Summary of Changes
byDr. Om J Lakhani
 
ENZYMOLOGY: IUBMB SYSTEM: COENZYMES: COFACTORS
byESIC MEDICAL COLLEGE AND HOSPITAL ANDHERI EAST MUMBAI
 
Novo protocolo (7) da ABM sobre Políticas de Apoio à AMAMENTAÇÃO em MATERNIDADES
byProf. Marcus Renato de Carvalho
 
Partograph: It is a composite graphical recording of cervical dilatation and ...
byMayuriGamit2
 
MEDICAL RESEARCH UNIT_III_RESEARCH METHODOLOGY & BIOSTATISTICS.pptx
byDHANASHREE KOLHEKAR
 
Research Methodology_UNIT_V_Declaration of Helsinki M. Pharm (IIIrd Sem.).pptx
byDHANASHREE KOLHEKAR
 
Oncology Physiotherapy_ A Key Piece in Cancer Care Puzzle.pptx
byasmitashresthapt
 
Ginger_Research_Presentation_Updated (2).pptx
byMadan Bhandari university and St. Xavier's college , Maitighar
 
MIndsets in Career of Emergency Medicine
byChing-Hsing Lee
 
ATTENTION (PSYCHOLOGY IN NURSING) COGNITIVE PROCESS.pptx
byPahari Sharma
 
Types of Hernia Treated by the Best Hernia Surgeon in Ahmedabad
byGastro Clinic
 
NERVOUS SYSTEM11 by Gulshan athbhaiya.pptx
byGulshan Athbhaiya
 

New Progress in Pyrosequencing for DNA Methylation

  • 1.
    Sample to Insight Newprogress in Pyrosequencing for automated single base resolution DNA methylation analysis for epigenetic research Gerald Schock, Ph.D. Associate Director Pyrosequencing QIAGEN GmbH New progress in Pyrosequencing for epigentic applications 1
  • 2.
    Sample to Insight 2 QIAGENproducts shown here are intended for molecular biology applications. These products are not intended for the diagnosis, prevention or treatment of a disease. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.QIAGEN.com or can be requested from QIAGEN Technical Services or your local distributor. Legal disclaimer New progress in Pyrosequencing for epigentic applications
  • 3.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 4.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 5.
    Sample to Insight Challengesin Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications
  • 6.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 6 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 7.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 7 .Based on SEQUENCING-by-SYNTHESIS Principle* • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides * Ronaghi, M., Uhlén, M., Nyrén, P. (1998) A sequencing method based on real-time pyrophosphate. Science. 281:363. Step 1 Hybridization of a sequencing primer Step 2-4 Addition of dNTP, conversion into light signal, degradation of nucleotides Step 5 Pyrogram generation and data analysis
  • 8.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 8 Sequencing through unknown regions Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 9.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 9 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 10.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 10 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides QIAGEN webinar: New progress in Pyrosequencing for automated quantitative analysis of bi- or multi-allelic sequence variations Recorded sessions: View online at www.qiagen.com
  • 11.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 11 Insertions / Deletions - - - - - - - : 56% ATCTGCC: 44% C: 57% T: 43% A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 12.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 12 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions DNA methylation of multiple CpG sites .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 13.
    Sample to Insight Pyrosequencing– principle and key features New progress in Pyrosequencing for epigentic applications 13 DNA methylation of multiple CpG sites A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 14.
    Sample to Insight QIAGEN’sPyrosequencing solutions for DNA methylation analysis 14 • PAXgene Blood DNA Tube • QIAamp Kits • AllPrep RNA/ DNA Kits • EpiTect Fast DNA Kits • EpiTect Fast LyseAll Kits • EpiTect Fast FFPE Kits • PyroMark Assay Design SW • PyroMark PCR Kit • PyroMark Q24 Advanced • PyroMark Q24 Advanced Reagents • PyroMark Q48 Autoprep • PyroMark Q48 Advanced Reagents Sample collection &/ stabilization DNA purification Assay design Bisulfite conversion Pre- amplification Pyro- sequencing PyroMark Assay Design SW PyroMark Q48 Advanced Kit PyroMark PCR Kit PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
  • 15.
    Sample to Insight Pyrosequencingworkflow – Assay design New progress in Pyrosequencing for epigentic applications 15 Assay design • Two PCR primers (one is biotinylated) o Biotin-labeled strand is isolated using Vacuum Prep Workstation • Sequencing primer o Placed in front of region of interest o Annealed to single-stranded DNA before Pyrosequencing reaction PCR primer Region of interest PCR primer Sequencing primer DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
  • 16.
    Sample to Insight Pyrosequencingworkflow - PCR New progress in Pyrosequencing for epigentic applications 16 PCR / RT-PCR • Can use any PCR machine • PyroMark PCR Kit / PyroMark OneStep RT-PCR Kit • Amplify relevant region by PCR (up to 500 bp) • Can use very short PCR products if desired (i.e. degraded DNA) • One primer has to be biotinylated DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
  • 17.
    Sample to Insight Pyrosequencingworkflow – Template preparation New progress in Pyrosequencing for epigentic applications 17 Template preparation • Separates biotinylated PCR strand from unbiotinylated strand and PCR primers • Streptavidin-coated Sepharose beads used for binding biotinylated PCR strand • Immobilization and separation by using o Sepharose beads and vacuum prep workstation (PyroMark Q96 ID, Q24, Q24 Adv) o Magnetic Sepharose beads (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
  • 18.
    Sample to Insight Pyrosequencingworkflow – Template preparation New progress in Pyrosequencing for epigentic applications 18 Annealing of Sequencing primer • Sequencing primer only binds to biotinylated PCR strand • ssDNA is needed for binding • Binding done o Manually (PyroMark Q96 ID, Q24, Q24 Adv) o Automated (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing Sequencing primer
  • 19.
    Sample to Insight Measuringfrequencies in sequence variations New progress in Pyrosequencing for epigentic applications 19 Example: DNA methylation analysis .A G T T A C G A C A.Sequence to be analyzed: .After bisulfite conversion: .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .Analyzed sequence: X .A .G .T .A .A.T/C .T.T G .A
  • 20.
    Sample to Insight Measuringfrequencies in sequence variations New progress in Pyrosequencing for epigentic applications 20 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
  • 21.
    Sample to Insight Measuringfrequencies in sequence variations 21 Quantitative peak heights to measure allele frequencies Wasson et al. 2002. Assessing allele frequencies of single nucleotide polymorphisms in DNA pools by Pyrosequencing technology. Biotechniques. 32:1144–1152. New progress in Pyrosequencing for epigentic applications Even as little as 2% of one allele in 98% of the other could be detected
  • 22.
    Sample to Insight Measuringfrequencies in sequence variations New progress in Pyrosequencing for epigentic applications 22 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
  • 23.
    Sample to Insight Measuringfrequencies in sequence variations New progress in Pyrosequencing for epigentic applications 23 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed: Ratio T:C
  • 24.
    Sample to Insight Measuringfrequencies in sequence variations New progress in Pyrosequencing for epigentic applications 24 Example: DNA methylation analysis Ratio T:C C=0% T=100% .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Built-in quality control: successful bisulfite conversion X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed:
  • 25.
    Sample to Insight Improvingbisulfite conversion efficiency New progress in Pyrosequencing for epigentic applications 25 Superior bisulfite conversion. Following bisulfite conversion of genomic DNA using the EpiTect Fast DNA Bisulfite Kit or a kit from Supplier Z, unconverted genomic DNA and bisulfite converted DNA were coamplified and then sequenced by Pyrosequencing. EpiTect Fast Kits showed better results when a limited amount of DNA was analyzed (10 ng). DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing EpiTect Fast Bisulfite conversion Complete conversion ensures reliable quantification of DNA methylation
  • 26.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 27.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 27 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 28.
    Sample to Insight AdvancedPyrosequencing Technology 28 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing New progress in Pyrosequencing for epigentic applications Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT
  • 29.
    Sample to Insight Effectsof low level incomplete bisulfite conversion 29 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally C Cm U Cm T C Bisulfite conversion PCR New progress in Pyrosequencing for epigentic applications
  • 30.
    Sample to Insight Effectsof low level incomplete bisulfite conversion 30 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% New progress in Pyrosequencing for epigentic applications After bisulfite conversion, some C nucleotides in some molecules remain unconverted. Conversion efficiency of EpiTect Kits is around 99.4–99.6%. Other kits show conversion efficiencies of 95–98%. Incomplete bisulfite conversion may affect Pyrosequencing results
  • 31.
    Sample to Insight Effectsof low level incomplete bisulfite conversion 31 Sample: unmethylated DNA (conventional Pyrosequencing) C T C T C A T T T T T A gDNA G A C G A T G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% T T T T T A G A T G A Tafter bis. ideally x% T A G A T C G A T single peak 5x peak wrong calculation peak deviations New progress in Pyrosequencing for epigentic applications
  • 32.
    Sample to Insight Multipledispensations act as “catch up” in Advanced Pyrosequencing 32 Sample: unmethylated DNA (Advanced Pyrosequencing) 0% T A G A T C G T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T A T single peak 5x peak +C +T less peak deviations → longer reads C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% correct calculation New progress in Pyrosequencing for epigentic applications
  • 33.
    Sample to Insight Incompletebisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 33 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence
  • 34.
    Sample to Insight Incompletebisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 34 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Conventional Pyrosequencing may show uncertain quantification results in long sequencing runs
  • 35.
    Sample to Insight Incompletebisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 35 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Increasing peak deviation from expected signals in late sequence positions
  • 36.
    Sample to Insight AdvancedPyrosequencing increases read length and trust New progress in Pyrosequencing for epigentic applications 36 Conventional vs. Advanced Pyrosequencing analysis of the LOX gene locus PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence Advanced Pyrosequencing overcomes issues of low level incomplete bisulfite conversion
  • 37.
    Sample to Insight Issueswith quantification of CpG methylation in homopolymers 37 Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT After bisulfite conversion TTYGYGATTGAATTYGAAAGATTTTTTTYGGYGGATGAAAGTYGTTATTTTTTGGTTGGTTGAGTTATAGTTTT 8xT if C is not methylated 7xT if C is methylated 6xT 4xT Histogram New progress in Pyrosequencing for epigentic applications Bisulfite conversion in DNA methylation analysis leads to occurrence of poly T stretches
  • 38.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 39.
    Sample to Insight Improvedquantification of CpG methylation in homopolymers 39 PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence New progress in Pyrosequencing for epigentic applications PyroMark Q24 Advanced enables reliable quantification of CpG methylation behind and even within a stretch of 8 T nucleotides
  • 40.
    Sample to Insight AdvancedPyrosequencing Technology 40 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ de novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development New progress in Pyrosequencing for epigentic applications
  • 41.
    Sample to Insight AdvancedPyrosequencing Technology 41 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) New progress in Pyrosequencing for epigentic applications
  • 42.
    Sample to Insight AdvancedPyrosequencing Technology 42 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration New progress in Pyrosequencing for epigentic applications
  • 43.
    Sample to Insight AdvancedPyrosequencing Technology 43 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) New progress in Pyrosequencing for epigentic applications
  • 44.
    Sample to Insight AdvancedPyrosequencing Technology 44 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) PyroMark Analysis SW optimized analysis New progress in Pyrosequencing for epigentic applications
  • 45.
    Sample to Insight AdvancedPyrosequencing Technology 45 PyroMark Platforms offering Advanced Pyrosequencing Advanced Pyrosequencing is available on two PyroMark Platforms PyroMark Q24 Advanced PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
  • 46.
    Sample to Insight Outline Newprogress in Pyrosequencing for epigentic applications 46 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 47.
    Sample to Insight PyroMarkQ48 Autoprep – Workflow New progress in Pyrosequencing for epigentic applications 47 Workflow comparison of available Pyrosequencing platforms Sample preparation Assay design PCR amplification ssDNA preparation Analysis • PyroMark Q24 Vacuum Workstation • PyroMark Q96 Vacuum Workstation • PyroMark Q24 • PyroMark Q24 Adv. • PyroMark Q96 ID • PyroMark Q48 AutoprepNEW ssDNA preparation and analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing
  • 48.
    Sample to Insight PyroMarkQ48 Autoprep – Protocol New progress in Pyrosequencing for epigentic applications 48 Automatic template preparation fully integrated in PyroMark Q48 Autoprep workflow Load reagents, nucleotides, buffers Load PCR product & magnetic beads Insert Absorber strip & Disc Load Run files via USB or Ethernet Automatic template preparation Pyro- sequencing Analyze data
  • 49.
    Sample to Insight PyroMarkQ48 Autoprep – Dimensions & Weight 49 390 mm (L, closed) 300mm(H) 560 mm (L, open) 250 mm (W) Small footprint and low weight (8.5 kg) New progress in Pyrosequencing for epigentic applications Small footprint (1/2 x PyroMark Q24) and low weight (1/3 x PyroMark Q24)
  • 50.
    Sample to Insight PyroMarkQ48 Autoprep – SW User Interface New progress in Pyrosequencing for epigentic applications 50 Large and easy-to-use touch screen and intuitive instrument SW
  • 51.
    Sample to Insight PyroMarkQ48 Autoprep offers highest degree of automation 51 Automated protocol steps along the Pyrosequencing workflow Load reagents, nucleotides, buffers Load PCR product & beads Manual template preparation with VPWS Anneal Seq- primer Pyro- sequencing Wash Cartridge & VPWS Load reagents, nucleotides, buffers Load PCR product & magnetic beads Automatic template preparation Anneal Seq- primer Pyro- sequencing PyroMark Q96 MD, Q96 ID, Q24, and Q24 Advanced PyroMark Q48 Autoprep • Multi-step pipette can be used for pipetting beads • Automatic pipetting system can be used manual automated manual/automated • Automatic dispensation of up to 3 Seq primers • Manual dispensation for 4 or more Seq primers • Automatic dispensation of 3 MPD* Mixes *MPD: Multiple Primer Dispensation Wash Cartridge New progress in Pyrosequencing for epigentic applications
  • 52.
    Sample to Insight Summary Newprogress in Pyrosequencing for epigentic applications 52 PyroMark Q48 Autoprep for “Advanced” Pyrosequencing in DNA methylation analysis • Cost-efficient tool for analyzing DNA methylation • Consecutive CpG and CpN sites analyzed independently in a single run • Improved quantification at any sequence position, even at homopolymer T sequences • Direct quality control of bisulfite conversion during the run • Fast processing: 48 samples in minutes • Automated Pyrosequencing through integrated template prep • Low sample input amounts: 1–10 ng • Highly accurate quantification: • LOD: 5% in methylation analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing for longer reads and more accurate methylation analysis
  • 53.
    Sample to Insight PyroMarkQ48 Autoprep on the web 53 More information about the platform, accessories and reagents are available online New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-autoprep/ https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-advanced-reagents/
  • 54.
    Sample to Insight PyroMarkQ48 Autoprep Intro Page 54New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/resources/technologies/pyrosequencing-resource-center/
  • 55.
    Sample to Insight Challengesin Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications