Simple Sequence Repeats (SSR), also known as Microsatellites, have been extensively used as
molecular markers due to their abundance and high degree of polymorphism. The nucleotide sequences of
polymorphic forms of the same gene should be 99.9% identical. So, Microsatellites extraction from the Gene is
crucial. However, Microsatellites repeat count is compared, if they differ largely, he has some disorder. The Y
chromosome likely contains 50 to 60 genes that provide instructions for making proteins. Because only males
have the Y chromosome, the genes on this chromosome tend to be involved in male sex determination and
development. Several Microsatellite Extractors exist and they fail to extract microsatellites on large data sets of
giga bytes and tera bytes in size. The proposed tool “MS-Extractor: An Innovative Approach to extract
Microsatellites on „Y‟ Chromosome” can extract both Perfect as well as Imperfect Microsatellites from large
data sets of human genome „Y‟. The proposed system uses string matching with sliding window approach to
locate Microsatellites and extracts them.
the document is about chromosomal analysis technique named array CGH technology, the complete procedure and the result interpretation of chromosomal variation
FGFBP1 pathways control after induction of a conditional transgene in a mouse...Anne Deslattes Mays
A systems biology approach to analyzing large data sets, such as this study which involved five full mouse cDNA arrays allows the researcher to capture a snapshot of the unfolding remodeling events of an organisms response to change, stress or disease. Analyzing data in this form involves filtering the biological signal from the noise. Sorting the noise in appropriate manners is essential to be able to complete the biological story. Building on existing knowledge base, we can complete the picture as long as the proper context of the collection, normalization and analysis is maintained. High throughput technologies such as microarrays and RNA sequencing as enabled by next generation sequencing presents the researcher with the challenge of extracting meaningful information from the measurements. Software tools and analysis techniques are not a substitute to understanding the biological context from which the data are collected. Engineering and digital signal processing has allowed us to derive the understanding of how to reconstruct a signal from the presence of a continual stream of noisy analog data. Sampling frequency and proper filtering are a must to be able to sort out a meaningful signal from the noise. These same principles apply not only to communication theory but also when studying large data such as those that may be collected from high throughput systems such as a Affymetrix mouse cDNA array.
the document is about chromosomal analysis technique named array CGH technology, the complete procedure and the result interpretation of chromosomal variation
FGFBP1 pathways control after induction of a conditional transgene in a mouse...Anne Deslattes Mays
A systems biology approach to analyzing large data sets, such as this study which involved five full mouse cDNA arrays allows the researcher to capture a snapshot of the unfolding remodeling events of an organisms response to change, stress or disease. Analyzing data in this form involves filtering the biological signal from the noise. Sorting the noise in appropriate manners is essential to be able to complete the biological story. Building on existing knowledge base, we can complete the picture as long as the proper context of the collection, normalization and analysis is maintained. High throughput technologies such as microarrays and RNA sequencing as enabled by next generation sequencing presents the researcher with the challenge of extracting meaningful information from the measurements. Software tools and analysis techniques are not a substitute to understanding the biological context from which the data are collected. Engineering and digital signal processing has allowed us to derive the understanding of how to reconstruct a signal from the presence of a continual stream of noisy analog data. Sampling frequency and proper filtering are a must to be able to sort out a meaningful signal from the noise. These same principles apply not only to communication theory but also when studying large data such as those that may be collected from high throughput systems such as a Affymetrix mouse cDNA array.
Neuro-Genetic Optimization of LDO-fired Rotary Furnace Parameters for the Pro...IJERD Editor
The rising demand for high quality homogenous castings necessitate that vast amount of
manufacturing knowledge be incorporated in manufacturing systems. Rotary furnace involves several critical
parameters like excess air, flame temperature, rotational speed of the furnace drum, melting time, preheat air
temperature, fuel consumption and melting rate of the molten metal which should be controlled throughout the
melting process. A complex relationship exists between these manufacturing parameters and hence there is a
need to develop models which can capture this complex interrelationship and enable fast computation. In the
present work, we propose a generic approach where the applicability and effectiveness of neural network in
function approximation is used for rapid estimation of melting rate and they are integrated into the framework
of genetic evolutionary algorithm to form a neuro-genetic optimization technique. A neural network model is
trained with the experimental results. The results indicate that the heuristic converges to better solutions rapidly
as it provides the values of various process parameters for optimizing the objective in a single run and thus
assists for the improvement of quality in development of sound parts
PALLAVAS IMMIGRATION? (Father of “DARK RICE”)IJERD Editor
This scientific research focus that Ancient Pallavas race called by author as “FLYING
PALLAVAS” shall be considered as origin of ancient human race on the “Earth Planet” lived in KACHCHA
THEEVU (3,00,000 years ago) even before emission of 1st sun rays on the earth planet. The scientific research
focus that the Pallavas race shall be considered as ancient angel race migrated from DEVAS RACE of white
planet (also called as mother planet of universe). The Pallavas race shall also be considered as expert in stone
architect work, father of dark rice and inventor of “IDLI FORMULA”.
Simulated Analysis of Resonant Frequency Converter Using Different Tank Circu...IJERD Editor
LLC resonant frequency converter is basically a combo of series as well as parallel resonant ckt. For
LCC resonant converter it is associated with a disadvantage that, though it has two resonant frequencies, the
lower resonant frequency is in ZCS region [5]. For this application, we are not able to design the converter
working at this resonant frequency. LLC resonant converter existed for a very long time but because of
unknown characteristic of this converter it was used as a series resonant converter with basically a passive
(resistive) load. . Here, it was designed to operate in switching frequency higher than resonant frequency of the
series resonant tank of Lr and Cr converter acts very similar to Series Resonant Converter. The benefit of LLC
resonant converter is narrow switching frequency range with light load[6] . Basically, the control ckt plays a
very imp. role and hence 555 Timer used here provides a perfect square wave as the control ckt provides no
slew rate which makes the square wave really strong and impenetrable. The dead band circuit provides the
exclusive dead band in micro seconds so as to avoid the simultaneous firing of two pairs of IGBT’s where one
pair switches off and the other on for a slightest period of time. Hence, the isolator ckt here is associated with
each and every ckt used because it acts as a driver and an isolation to each of the IGBT is provided with one
exclusive transformer supply[3]. The IGBT’s are fired using the appropriate signal using the previous boards
and hence at last a high frequency rectifier ckt with a filtering capacitor is used to get an exact dc
waveform .The basic goal of this particular analysis is to observe the wave forms and characteristics of
converters with differently positioned passive elements in the form of tank circuits. The supported simulation
is done through PSIM 6.0 software tool
Thermo mechanical characterization and damage of polymer materials:Applicatio...IJERD Editor
Plastic materials occupy a large part in our daily lives because of their ease of installation and relatively low production costs. The rapid technical development and we live brings more and more mechanical engineers to face the problems of damage to materials. However, these problems are even more serious than fatigue cracking often leads to a sudden break often cause accidents. This unfortunately happens all too frequently, due to insufficient knowledge either room service conditions or even damage parameters. This work presents new developments in the field of fracture mechanics and the objective is the evaluation of defects and thus a better estimate of the reliability of the polymeric material structures
Comparative Analysis of Social Sustainability at Four Locations of Indore Cit...IJERD Editor
Sustainable development is the thought process behind well being of humanity. It expects the
sustenance of mankind on earth. As per the idea of sustainable development lays stress on encompassing all the
three parameters of sustainability, meaning balance between socio-economic activities with environment
ultimately, the process should enhance the quality of human life. The development should encourage human
bonding in the society and feeling of neighbourhood satisfaction by fulfilling community needs. Finally
sustainable development is devolvement which accompanies welfare of the society by including some design
elements in the safe built environment. Some alterations in physical environment can bring in the feeling of
safety for the society.
Indore is a fast growing city of Madhya Pradesh in India. The research paper aims at analysing the Social
Sustainability at four locations of the city. The four locations have been selected as per their socio-economic
status. The comparative analysis has been done by ANOVA, SPSS 21.
Study showed that when the city is developing and maintaining parameters of Social Sustainability then all its
neighbourhoods follows the paths of development. It is a good sign towards positive growth.
Gesture Gaming on the World Wide Web Using an Ordinary Web CameraIJERD Editor
- Gesture gaming is a method by which users having a laptop/pc/x-box play games using natural or
bodily gestures. This paper presents a way of playing free flash games on the internet using an ordinary webcam
with the help of open source technologies. Emphasis in human activity recognition is given on the pose
estimation and the consistency in the pose of the player. These are estimated with the help of an ordinary web
camera having different resolutions from VGA to 20mps. Our work involved giving a 10 second documentary to
the user on how to play a particular game using gestures and what are the various kinds of gestures that can be
performed in front of the system. The initial inputs of the RGB values for the gesture component is obtained by
instructing the user to place his component in a red box in about 10 seconds after the short documentary before
the game is finished. Later the system opens the concerned game on the internet on popular flash game sites like
miniclip, games arcade, GameStop etc and loads the game clicking at various places and brings the state to a
place where the user is to perform only gestures to start playing the game. At any point of time the user can call
off the game by hitting the esc key and the program will release all of the controls and return to the desktop. It
was noted that the results obtained using an ordinary webcam matched that of the Kinect and the users could
relive the gaming experience of the free flash games on the net. Therefore effective in game advertising could
also be achieved thus resulting in a disruptive growth to the advertising firms.
Mitigation of Voltage Sag/Swell with Fuzzy Control Reduced Rating DVRIJERD Editor
Power quality has been an issue that is becoming increasingly pivotal in industrial electricity
consumers point of view in recent times. Modern industries employ Sensitive power electronic equipments,
control devices and non-linear loads as part of automated processes to increase energy efficiency and
productivity. Voltage disturbances are the most common power quality problem due to this the use of a large
numbers of sophisticated and sensitive electronic equipment in industrial systems is increased. This paper
discusses the design and simulation of dynamic voltage restorer for improvement of power quality and
reduce the harmonics distortion of sensitive loads. Power quality problem is occurring at non-standard
voltage, current and frequency. Electronic devices are very sensitive loads. In power system voltage sag,
swell, flicker and harmonics are some of the problem to the sensitive load. The compensation capability
of a DVR depends primarily on the maximum voltage injection ability and the amount of stored
energy available within the restorer. This device is connected in series with the distribution feeder at
medium voltage. A fuzzy logic control is used to produce the gate pulses for control circuit of DVR and the
circuit is simulated by using MATLAB/SIMULINK software.
Gold prospecting using Remote Sensing ‘A case study of Sudan’IJERD Editor
Gold has been extracted from northeast Africa for more than 5000 years, and this may be the first
place where the metal was extracted. The Arabian-Nubian Shield (ANS) is an exposure of Precambrian
crystalline rocks on the flanks of the Red Sea. The crystalline rocks are mostly Neoproterozoic in age. ANS
includes the nations of Israel, Jordan. Egypt, Saudi Arabia, Sudan, Eritrea, Ethiopia, Yemen, and Somalia.
Arabian Nubian Shield Consists of juvenile continental crest that formed between 900 550 Ma, when intra
oceanic arc welded together along ophiolite decorated arc. Primary Au mineralization probably developed in
association with the growth of intra oceanic arc and evolution of back arc. Multiple episodes of deformation
have obscured the primary metallogenic setting, but at least some of the deposits preserve evidence that they
originate as sea floor massive sulphide deposits.
The Red Sea Hills Region is a vast span of rugged, harsh and inhospitable sector of the Earth with
inimical moon-like terrain, nevertheless since ancient times it is famed to be an abode of gold and was a major
source of wealth for the Pharaohs of ancient Egypt. The Pharaohs old workings have been periodically
rediscovered through time. Recent endeavours by the Geological Research Authority of Sudan led to the
discovery of a score of occurrences with gold and massive sulphide mineralizations. In the nineties of the
previous century the Geological Research Authority of Sudan (GRAS) in cooperation with BRGM utilized
satellite data of Landsat TM using spectral ratio technique to map possible mineralized zones in the Red Sea
Hills of Sudan. The outcome of the study mapped a gossan type gold mineralization. Band ratio technique was
applied to Arbaat area and a signature of alteration zone was detected. The alteration zones are commonly
associated with mineralization. The alteration zones are commonly associated with mineralization. A filed check
confirmed the existence of stock work of gold bearing quartz in the alteration zone. Another type of gold
mineralization that was discovered using remote sensing is the gold associated with metachert in the Atmur
Desert.
Hearing loss is one of the most common human impairments. It is estimated that by year 2015 more
than 700 million people will suffer mild deafness. Most can be helped by hearing aid devices depending on the
severity of their hearing loss. This paper describes the implementation and characterization details of a dual
channel transmitter front end (TFE) for digital hearing aid (DHA) applications that use novel micro
electromechanical- systems (MEMS) audio transducers and ultra-low power-scalable analog-to-digital
converters (ADCs), which enable a very-low form factor, energy-efficient implementation for next-generation
DHA. The contribution of the design is the implementation of the dual channel MEMS microphones and powerscalable
ADC system.
Spatial and temporal distribution of Nitrate (NO3 -) In groundwater of Rohtak...IJERD Editor
The contamination of ground water has increased with rapid urbanization, agricultural inputs and
industrialization. In the last few decades the nitrate (NO3
-) pollution is on the increase in the urban areas.
Contamination of ground water with nitrate is mainly by the process of leaching due to high mobility of nitrate
ions through soil. By mapping water quality using the decision support system like geographical information
system (GIS), the data can be represented graphically in map and is useful for taking quick decision. The
objective of present study was to monitor the spatial and temporal nitrate ion concentration in ground water of
Rohtak city in pre monsoon, monsoon and post monsoon season of private ground water drinking sources, and
graphical representation of data using GIS. The samples from the various colonies of Rohtak city showed nitrate
range from 1.8 mg/l to 45mg/l. Most areas showed a ground water nitrate level within permissible limits of 45
mg/L (CPCB) how ever Village Samargopalpur had the highest nitrate concentration (79mg/L). Higher nitrate
concentration was observed in area having history of agriculture use and open sewage, septic tanks, municipal
solid waste and dairy waste dumps. In all the sampling sites the nitrate concentration was highest during the pre
monsoon season.
Model of Energy Generation in Plant by the Cells of The Leafs During the Nigh...IJERD Editor
It is known fact that plants generates energy using the sunlight and that the intensity of the sun drastically reduced from 18:00 hours to 6:00 hours (over the night). A mathematical model is presented to describe the process and the energy generated by the cells in the leaf of a plant at this period. The model equations are solved with graph showing the production level within the range of periods stated. This study assumed that plants have already generated enough energy both stored and used. The result showed that plant makes use of existing stored energy thus reducing the level of the stored energy until the next day when the energy level begins to increase.
High Power Lasers and New ApplicationsIJERD Editor
Jets, sprites, climate change, high power lasers, orbital electrical socket, electrical breakdown, Impulsar, launching of objects by laser, high power lasers, optical breakdown, shock waves, conductivity of dust plasma, optical breakdown
A Comparative Analysis of Feature Selection Methods for Clustering DNA SequencesCSCJournals
Large-scale analysis of genome sequences is in progress around the world, the major application of which is to establish the evolutionary relationship among the species using phylogenetic trees. Hierarchical agglomerative algorithms can be used to generate such phylogenetic trees given the distance matrix representing the dissimilarity among the species. ClustalW and Muscle are two general purpose programs that generates distance matrix from the input DNA or protein sequences. The limitation of these programs is that they are based on Smith-Waterman algorithm which uses dynamic programming for doing the pair-wise alignment. This is an extremely time consuming process and the existing systems may even fail to work for larger input data set. To overcome this limitation, we have used the frequency of codons usage as an approximation to find dissimilarity among species. The proposed technique further reduces the complexity by extracting only the significant features of the species from the mtDNA sequences using the techniques like frequent codons, codons with maximum range value or PCA technique. We have observed that the proposed system produces nearly accurate results in a significantly reduced running time.
Genetic algorithm guided key generation in wireless communication (gakg)IJCI JOURNAL
In this paper, the proposed technique use high speed stream cipher approach because this approach is useful where less memory and maximum speed is required for encryption process. In this proposed approach Self Acclimatize Genetic Algorithm based approach is exploits to generate the key stream for encrypt / decrypt the plaintext with the help of key stream. A widely practiced approach to identify a good set of parameters for a problem is through experimentation. For these reasons, proposed enhanced Self Acclimatize Genetic Algorithm (GAKG) offering the most appropriate exploration and exploitation behavior. Parametric tests are done and results are compared with some existing classical techniques, which shows comparable results for the proposed system.
Neuro-Genetic Optimization of LDO-fired Rotary Furnace Parameters for the Pro...IJERD Editor
The rising demand for high quality homogenous castings necessitate that vast amount of
manufacturing knowledge be incorporated in manufacturing systems. Rotary furnace involves several critical
parameters like excess air, flame temperature, rotational speed of the furnace drum, melting time, preheat air
temperature, fuel consumption and melting rate of the molten metal which should be controlled throughout the
melting process. A complex relationship exists between these manufacturing parameters and hence there is a
need to develop models which can capture this complex interrelationship and enable fast computation. In the
present work, we propose a generic approach where the applicability and effectiveness of neural network in
function approximation is used for rapid estimation of melting rate and they are integrated into the framework
of genetic evolutionary algorithm to form a neuro-genetic optimization technique. A neural network model is
trained with the experimental results. The results indicate that the heuristic converges to better solutions rapidly
as it provides the values of various process parameters for optimizing the objective in a single run and thus
assists for the improvement of quality in development of sound parts
PALLAVAS IMMIGRATION? (Father of “DARK RICE”)IJERD Editor
This scientific research focus that Ancient Pallavas race called by author as “FLYING
PALLAVAS” shall be considered as origin of ancient human race on the “Earth Planet” lived in KACHCHA
THEEVU (3,00,000 years ago) even before emission of 1st sun rays on the earth planet. The scientific research
focus that the Pallavas race shall be considered as ancient angel race migrated from DEVAS RACE of white
planet (also called as mother planet of universe). The Pallavas race shall also be considered as expert in stone
architect work, father of dark rice and inventor of “IDLI FORMULA”.
Simulated Analysis of Resonant Frequency Converter Using Different Tank Circu...IJERD Editor
LLC resonant frequency converter is basically a combo of series as well as parallel resonant ckt. For
LCC resonant converter it is associated with a disadvantage that, though it has two resonant frequencies, the
lower resonant frequency is in ZCS region [5]. For this application, we are not able to design the converter
working at this resonant frequency. LLC resonant converter existed for a very long time but because of
unknown characteristic of this converter it was used as a series resonant converter with basically a passive
(resistive) load. . Here, it was designed to operate in switching frequency higher than resonant frequency of the
series resonant tank of Lr and Cr converter acts very similar to Series Resonant Converter. The benefit of LLC
resonant converter is narrow switching frequency range with light load[6] . Basically, the control ckt plays a
very imp. role and hence 555 Timer used here provides a perfect square wave as the control ckt provides no
slew rate which makes the square wave really strong and impenetrable. The dead band circuit provides the
exclusive dead band in micro seconds so as to avoid the simultaneous firing of two pairs of IGBT’s where one
pair switches off and the other on for a slightest period of time. Hence, the isolator ckt here is associated with
each and every ckt used because it acts as a driver and an isolation to each of the IGBT is provided with one
exclusive transformer supply[3]. The IGBT’s are fired using the appropriate signal using the previous boards
and hence at last a high frequency rectifier ckt with a filtering capacitor is used to get an exact dc
waveform .The basic goal of this particular analysis is to observe the wave forms and characteristics of
converters with differently positioned passive elements in the form of tank circuits. The supported simulation
is done through PSIM 6.0 software tool
Thermo mechanical characterization and damage of polymer materials:Applicatio...IJERD Editor
Plastic materials occupy a large part in our daily lives because of their ease of installation and relatively low production costs. The rapid technical development and we live brings more and more mechanical engineers to face the problems of damage to materials. However, these problems are even more serious than fatigue cracking often leads to a sudden break often cause accidents. This unfortunately happens all too frequently, due to insufficient knowledge either room service conditions or even damage parameters. This work presents new developments in the field of fracture mechanics and the objective is the evaluation of defects and thus a better estimate of the reliability of the polymeric material structures
Comparative Analysis of Social Sustainability at Four Locations of Indore Cit...IJERD Editor
Sustainable development is the thought process behind well being of humanity. It expects the
sustenance of mankind on earth. As per the idea of sustainable development lays stress on encompassing all the
three parameters of sustainability, meaning balance between socio-economic activities with environment
ultimately, the process should enhance the quality of human life. The development should encourage human
bonding in the society and feeling of neighbourhood satisfaction by fulfilling community needs. Finally
sustainable development is devolvement which accompanies welfare of the society by including some design
elements in the safe built environment. Some alterations in physical environment can bring in the feeling of
safety for the society.
Indore is a fast growing city of Madhya Pradesh in India. The research paper aims at analysing the Social
Sustainability at four locations of the city. The four locations have been selected as per their socio-economic
status. The comparative analysis has been done by ANOVA, SPSS 21.
Study showed that when the city is developing and maintaining parameters of Social Sustainability then all its
neighbourhoods follows the paths of development. It is a good sign towards positive growth.
Gesture Gaming on the World Wide Web Using an Ordinary Web CameraIJERD Editor
- Gesture gaming is a method by which users having a laptop/pc/x-box play games using natural or
bodily gestures. This paper presents a way of playing free flash games on the internet using an ordinary webcam
with the help of open source technologies. Emphasis in human activity recognition is given on the pose
estimation and the consistency in the pose of the player. These are estimated with the help of an ordinary web
camera having different resolutions from VGA to 20mps. Our work involved giving a 10 second documentary to
the user on how to play a particular game using gestures and what are the various kinds of gestures that can be
performed in front of the system. The initial inputs of the RGB values for the gesture component is obtained by
instructing the user to place his component in a red box in about 10 seconds after the short documentary before
the game is finished. Later the system opens the concerned game on the internet on popular flash game sites like
miniclip, games arcade, GameStop etc and loads the game clicking at various places and brings the state to a
place where the user is to perform only gestures to start playing the game. At any point of time the user can call
off the game by hitting the esc key and the program will release all of the controls and return to the desktop. It
was noted that the results obtained using an ordinary webcam matched that of the Kinect and the users could
relive the gaming experience of the free flash games on the net. Therefore effective in game advertising could
also be achieved thus resulting in a disruptive growth to the advertising firms.
Mitigation of Voltage Sag/Swell with Fuzzy Control Reduced Rating DVRIJERD Editor
Power quality has been an issue that is becoming increasingly pivotal in industrial electricity
consumers point of view in recent times. Modern industries employ Sensitive power electronic equipments,
control devices and non-linear loads as part of automated processes to increase energy efficiency and
productivity. Voltage disturbances are the most common power quality problem due to this the use of a large
numbers of sophisticated and sensitive electronic equipment in industrial systems is increased. This paper
discusses the design and simulation of dynamic voltage restorer for improvement of power quality and
reduce the harmonics distortion of sensitive loads. Power quality problem is occurring at non-standard
voltage, current and frequency. Electronic devices are very sensitive loads. In power system voltage sag,
swell, flicker and harmonics are some of the problem to the sensitive load. The compensation capability
of a DVR depends primarily on the maximum voltage injection ability and the amount of stored
energy available within the restorer. This device is connected in series with the distribution feeder at
medium voltage. A fuzzy logic control is used to produce the gate pulses for control circuit of DVR and the
circuit is simulated by using MATLAB/SIMULINK software.
Gold prospecting using Remote Sensing ‘A case study of Sudan’IJERD Editor
Gold has been extracted from northeast Africa for more than 5000 years, and this may be the first
place where the metal was extracted. The Arabian-Nubian Shield (ANS) is an exposure of Precambrian
crystalline rocks on the flanks of the Red Sea. The crystalline rocks are mostly Neoproterozoic in age. ANS
includes the nations of Israel, Jordan. Egypt, Saudi Arabia, Sudan, Eritrea, Ethiopia, Yemen, and Somalia.
Arabian Nubian Shield Consists of juvenile continental crest that formed between 900 550 Ma, when intra
oceanic arc welded together along ophiolite decorated arc. Primary Au mineralization probably developed in
association with the growth of intra oceanic arc and evolution of back arc. Multiple episodes of deformation
have obscured the primary metallogenic setting, but at least some of the deposits preserve evidence that they
originate as sea floor massive sulphide deposits.
The Red Sea Hills Region is a vast span of rugged, harsh and inhospitable sector of the Earth with
inimical moon-like terrain, nevertheless since ancient times it is famed to be an abode of gold and was a major
source of wealth for the Pharaohs of ancient Egypt. The Pharaohs old workings have been periodically
rediscovered through time. Recent endeavours by the Geological Research Authority of Sudan led to the
discovery of a score of occurrences with gold and massive sulphide mineralizations. In the nineties of the
previous century the Geological Research Authority of Sudan (GRAS) in cooperation with BRGM utilized
satellite data of Landsat TM using spectral ratio technique to map possible mineralized zones in the Red Sea
Hills of Sudan. The outcome of the study mapped a gossan type gold mineralization. Band ratio technique was
applied to Arbaat area and a signature of alteration zone was detected. The alteration zones are commonly
associated with mineralization. The alteration zones are commonly associated with mineralization. A filed check
confirmed the existence of stock work of gold bearing quartz in the alteration zone. Another type of gold
mineralization that was discovered using remote sensing is the gold associated with metachert in the Atmur
Desert.
Hearing loss is one of the most common human impairments. It is estimated that by year 2015 more
than 700 million people will suffer mild deafness. Most can be helped by hearing aid devices depending on the
severity of their hearing loss. This paper describes the implementation and characterization details of a dual
channel transmitter front end (TFE) for digital hearing aid (DHA) applications that use novel micro
electromechanical- systems (MEMS) audio transducers and ultra-low power-scalable analog-to-digital
converters (ADCs), which enable a very-low form factor, energy-efficient implementation for next-generation
DHA. The contribution of the design is the implementation of the dual channel MEMS microphones and powerscalable
ADC system.
Spatial and temporal distribution of Nitrate (NO3 -) In groundwater of Rohtak...IJERD Editor
The contamination of ground water has increased with rapid urbanization, agricultural inputs and
industrialization. In the last few decades the nitrate (NO3
-) pollution is on the increase in the urban areas.
Contamination of ground water with nitrate is mainly by the process of leaching due to high mobility of nitrate
ions through soil. By mapping water quality using the decision support system like geographical information
system (GIS), the data can be represented graphically in map and is useful for taking quick decision. The
objective of present study was to monitor the spatial and temporal nitrate ion concentration in ground water of
Rohtak city in pre monsoon, monsoon and post monsoon season of private ground water drinking sources, and
graphical representation of data using GIS. The samples from the various colonies of Rohtak city showed nitrate
range from 1.8 mg/l to 45mg/l. Most areas showed a ground water nitrate level within permissible limits of 45
mg/L (CPCB) how ever Village Samargopalpur had the highest nitrate concentration (79mg/L). Higher nitrate
concentration was observed in area having history of agriculture use and open sewage, septic tanks, municipal
solid waste and dairy waste dumps. In all the sampling sites the nitrate concentration was highest during the pre
monsoon season.
Model of Energy Generation in Plant by the Cells of The Leafs During the Nigh...IJERD Editor
It is known fact that plants generates energy using the sunlight and that the intensity of the sun drastically reduced from 18:00 hours to 6:00 hours (over the night). A mathematical model is presented to describe the process and the energy generated by the cells in the leaf of a plant at this period. The model equations are solved with graph showing the production level within the range of periods stated. This study assumed that plants have already generated enough energy both stored and used. The result showed that plant makes use of existing stored energy thus reducing the level of the stored energy until the next day when the energy level begins to increase.
High Power Lasers and New ApplicationsIJERD Editor
Jets, sprites, climate change, high power lasers, orbital electrical socket, electrical breakdown, Impulsar, launching of objects by laser, high power lasers, optical breakdown, shock waves, conductivity of dust plasma, optical breakdown
A Comparative Analysis of Feature Selection Methods for Clustering DNA SequencesCSCJournals
Large-scale analysis of genome sequences is in progress around the world, the major application of which is to establish the evolutionary relationship among the species using phylogenetic trees. Hierarchical agglomerative algorithms can be used to generate such phylogenetic trees given the distance matrix representing the dissimilarity among the species. ClustalW and Muscle are two general purpose programs that generates distance matrix from the input DNA or protein sequences. The limitation of these programs is that they are based on Smith-Waterman algorithm which uses dynamic programming for doing the pair-wise alignment. This is an extremely time consuming process and the existing systems may even fail to work for larger input data set. To overcome this limitation, we have used the frequency of codons usage as an approximation to find dissimilarity among species. The proposed technique further reduces the complexity by extracting only the significant features of the species from the mtDNA sequences using the techniques like frequent codons, codons with maximum range value or PCA technique. We have observed that the proposed system produces nearly accurate results in a significantly reduced running time.
Genetic algorithm guided key generation in wireless communication (gakg)IJCI JOURNAL
In this paper, the proposed technique use high speed stream cipher approach because this approach is useful where less memory and maximum speed is required for encryption process. In this proposed approach Self Acclimatize Genetic Algorithm based approach is exploits to generate the key stream for encrypt / decrypt the plaintext with the help of key stream. A widely practiced approach to identify a good set of parameters for a problem is through experimentation. For these reasons, proposed enhanced Self Acclimatize Genetic Algorithm (GAKG) offering the most appropriate exploration and exploitation behavior. Parametric tests are done and results are compared with some existing classical techniques, which shows comparable results for the proposed system.
A genetic algorithm for the optimal design of a multistage amplifier IJECEIAES
The optimal sizing of analog circuits is one of the most complicated processes, because of the number of variables taken into, to the number of required objectives to be optimized and to the constraint functions restrictions. The aim is to automate this activity in order to accelerate the circuits design and sizing. In this paper, we deal with the optimization of the three stage bipolar transistor amplifier performances namely the voltage gain (AV), the input impedance (ZIN), the output impedance (ZOUT), the power consumption (P) and the low and the high cutoff frequency (FL,FH), through the Genetic Algorithm (GA). The presented optimization problem is of multi-dimensional parameters, and the trade-off of all parameters. In fact, the passive components (Resistors and Capacitors) are selected from manufactured constant values (E12, E24, E48, E96, E192) for the purpose of reduce the cost of design; also, the intrinsic parameters of transistors (hybrid parameters and the junction capacitances) are considered variables in order not to be limited in design. SPICE simulation is used to validate the obtained result/performances.
ANALYSIS OF ELEMENTARY CELLULAR AUTOMATA CHAOTIC RULES BEHAVIORijsptm
We present detailed and in depth analysis of Elementary Cellular Automata (ECA) with periodic
cylindrical configuration. The focus is to determine whether Cellular Automata (CA) is suitable for the
generation of pseudo random number sequences (PRNs) of cryptographic strength. Additionally, we
identify the rules that are most suitable for such applications. It is found that only two sub-clusters of the
chaotic rule space are actually capable of producing viable PRNs. Furthermore, these two sub-clusters
consist of two majorly non-linear rules. Each sub-cluster of rules is derived from a cluster leader rule by
reflection or negation or the combined two transformations. It is shown that the members of each subcluster
share the same dynamical behavior. Results of testing the ECA running under these rules for
comprehensively large number of lattice lengths using the Diehard Test suite have shown that apart from
some anomaly, the whole output sequence can be potentially utilized for cryptographic strength pseudo
random sequence generation with sufficiently large number of p-values pass rates.
large data set is not available for some disease such as Brain Tumor. This and part2 presentation shows how to find "Actionable solution from a difficult cancer dataset
Integrative analysis of transcriptomics and proteomics data with ArrayMining ...Natalio Krasnogor
These slides are part of a presentation I gave on March 2010 at the BioInformatics and Genome Research Open Club at the Weizmann Institute of Science, Israel.
In these slides my student and I describe two web-applications for microarray and gene/protein set analysis,
ArrayMining.net and TopoGSA. These use ensemble and consensus methods as well as the
possibility of modular combinations of different analysis techniques for an integrative view of
(microarray-based) gene sets, interlinking transcriptomics with proteomics data sources. This integrative process uses tools from different fields, e.g. statistics, optimisation and network
topological studies. As an example for these integrative techniques, we use a microarray
consensus-clustering approach based on Simulated Annealing, which is part of the ArrayMining.net
Class Discovery Analysis module, and show how this approach can be combined in a modular
fashion with a prior gene set analysis. The results reveal that improved cluster validity indices can be obtained by merging the two methods, and provide pointers to distinct sub-classes within pre-defined tumour categories for a breast cancer dataset by the Nottingham Queens Medical Centre.
In the second part of the talk, I show how results from a supervised
microarray feature selection analysis on ArrayMining.net can be investigated in further detail with
TopoGSA, a new web-tool for network topological analysis of gene/protein sets mapped on a
comprehensive human protein-protein interaction network. I discuss results from a TopoGSA
analysis of the complete set of genes currently known to be mutated in cancer.
A Novel Method for Prevention of Bandwidth Distributed Denial of Service AttacksIJERD Editor
Distributed Denial of Service (DDoS) Attacks became a massive threat to the Internet. Traditional
Architecture of internet is vulnerable to the attacks like DDoS. Attacker primarily acquire his army of Zombies,
then that army will be instructed by the Attacker that when to start an attack and on whom the attack should be
done. In this paper, different techniques which are used to perform DDoS Attacks, Tools that were used to
perform Attacks and Countermeasures in order to detect the attackers and eliminate the Bandwidth Distributed
Denial of Service attacks (B-DDoS) are reviewed. DDoS Attacks were done by using various Flooding
techniques which are used in DDoS attack.
The main purpose of this paper is to design an architecture which can reduce the Bandwidth
Distributed Denial of service Attack and make the victim site or server available for the normal users by
eliminating the zombie machines. Our Primary focus of this paper is to dispute how normal machines are
turning into zombies (Bots), how attack is been initiated, DDoS attack procedure and how an organization can
save their server from being a DDoS victim. In order to present this we implemented a simulated environment
with Cisco switches, Routers, Firewall, some virtual machines and some Attack tools to display a real DDoS
attack. By using Time scheduling, Resource Limiting, System log, Access Control List and some Modular
policy Framework we stopped the attack and identified the Attacker (Bot) machines
Influence of tensile behaviour of slab on the structural Behaviour of shear c...IJERD Editor
-A composite beam is composed of a steel beam and a slab connected by means of shear connectors
like studs installed on the top flange of the steel beam to form a structure behaving monolithically. This study
analyzes the effects of the tensile behavior of the slab on the structural behavior of the shear connection like slip
stiffness and maximum shear force in composite beams subjected to hogging moment. The results show that the
shear studs located in the crack-concentration zones due to large hogging moments sustain significantly smaller
shear force and slip stiffness than the other zones. Moreover, the reduction of the slip stiffness in the shear
connection appears also to be closely related to the change in the tensile strain of rebar according to the increase
of the load. Further experimental and analytical studies shall be conducted considering variables such as the
reinforcement ratio and the arrangement of shear connectors to achieve efficient design of the shear connection
in composite beams subjected to hogging moment.
Reducing Corrosion Rate by Welding DesignIJERD Editor
The paper addresses the importance of welding design to prevent corrosion at steel. Welding is
used to join pipe, profiles at bridges, spindle, and a lot more part of engineering construction. The
problems happened associated with welding are common issues in these fields, especially corrosion.
Corrosion can be reduced with many methods, they are painting, controlling humidity, and also good
welding design. In the research, it can be found that reducing residual stress on the welding can be
solved in corrosion rate reduction problem.
Preheating on 500oC and 600oC give better condition to reduce corosion rate than condition after
preheating 400oC. For all welding groove type, material with 500oC and 600oC preheating after 14 days
corrosion test is 0,5%-0,69% lost. Material with 400oC preheating after 14 days corrosion test is 0,57%-0,76%
lost.
Welding groove also influence corrosion rate. X and V type welding groove give better condition to reduce
corrosion rate than use 1/2V and 1/2 X welding groove. After 14 days corrosion test, the samples with
X welding groove type is 0,5%-0,57% lost. The samples with V welding groove after 14 days corrosion test is
0,51%-0,59% lost. The samples with 1/2V and 1/2X welding groove after 14 days corrosion test is 0,58%-
0,71% lost.
Router 1X3 – RTL Design and VerificationIJERD Editor
Routing is the process of moving a packet of data from source to destination and enables messages
to pass from one computer to another and eventually reach the target machine. A router is a networking device
that forwards data packets between computer networks. It is connected to two or more data lines from different
networks (as opposed to a network switch, which connects data lines from one single network). This paper,
mainly emphasizes upon the study of router device, it‟s top level architecture, and how various sub-modules of
router i.e. Register, FIFO, FSM and Synchronizer are synthesized, and simulated and finally connected to its top
module.
Active Power Exchange in Distributed Power-Flow Controller (DPFC) At Third Ha...IJERD Editor
This paper presents a component within the flexible ac-transmission system (FACTS) family, called
distributed power-flow controller (DPFC). The DPFC is derived from the unified power-flow controller (UPFC)
with an eliminated common dc link. The DPFC has the same control capabilities as the UPFC, which comprise
the adjustment of the line impedance, the transmission angle, and the bus voltage. The active power exchange
between the shunt and series converters, which is through the common dc link in the UPFC, is now through the
transmission lines at the third-harmonic frequency. DPFC multiple small-size single-phase converters which
reduces the cost of equipment, no voltage isolation between phases, increases redundancy and there by
reliability increases. The principle and analysis of the DPFC are presented in this paper and the corresponding
simulation results that are carried out on a scaled prototype are also shown.
Study on the Fused Deposition Modelling In Additive ManufacturingIJERD Editor
Additive manufacturing process, also popularly known as 3-D printing, is a process where a product
is created in a succession of layers. It is based on a novel materials incremental manufacturing philosophy.
Unlike conventional manufacturing processes where material is removed from a given work price to derive the
final shape of a product, 3-D printing develops the product from scratch thus obviating the necessity to cut away
materials. This prevents wastage of raw materials. Commonly used raw materials for the process are ABS
plastic, PLA and nylon. Recently the use of gold, bronze and wood has also been implemented. The complexity
factor of this process is 0% as in any object of any shape and size can be manufactured.
Spyware triggering system by particular string valueIJERD Editor
This computer programme can be used for good and bad purpose in hacking or in any general
purpose. We can say it is next step for hacking techniques such as keylogger and spyware. Once in this system if
user or hacker store particular string as a input after that software continually compare typing activity of user
with that stored string and if it is match then launch spyware programme.
A Blind Steganalysis on JPEG Gray Level Image Based on Statistical Features a...IJERD Editor
This paper presents a blind steganalysis technique to effectively attack the JPEG steganographic
schemes i.e. Jsteg, F5, Outguess and DWT Based. The proposed method exploits the correlations between
block-DCTcoefficients from intra-block and inter-block relation and the statistical moments of characteristic
functions of the test image is selected as features. The features are extracted from the BDCT JPEG 2-array.
Support Vector Machine with cross-validation is implemented for the classification.The proposed scheme gives
improved outcome in attacking.
Secure Image Transmission for Cloud Storage System Using Hybrid SchemeIJERD Editor
- Data over the cloud is transferred or transmitted between servers and users. Privacy of that
data is very important as it belongs to personal information. If data get hacked by the hacker, can be
used to defame a person’s social data. Sometimes delay are held during data transmission. i.e. Mobile
communication, bandwidth is low. Hence compression algorithms are proposed for fast and efficient
transmission, encryption is used for security purposes and blurring is used by providing additional
layers of security. These algorithms are hybridized for having a robust and efficient security and
transmission over cloud storage system.
Application of Buckley-Leverett Equation in Modeling the Radius of Invasion i...IJERD Editor
A thorough review of existing literature indicates that the Buckley-Leverett equation only analyzes
waterflood practices directly without any adjustments on real reservoir scenarios. By doing so, quite a number
of errors are introduced into these analyses. Also, for most waterflood scenarios, a radial investigation is more
appropriate than a simplified linear system. This study investigates the adoption of the Buckley-Leverett
equation to estimate the radius invasion of the displacing fluid during waterflooding. The model is also adopted
for a Microbial flood and a comparative analysis is conducted for both waterflooding and microbial flooding.
Results shown from the analysis doesn’t only records a success in determining the radial distance of the leading
edge of water during the flooding process, but also gives a clearer understanding of the applicability of
microbes to enhance oil production through in-situ production of bio-products like bio surfactans, biogenic
gases, bio acids etc.
Hardware Analysis of Resonant Frequency Converter Using Isolated Circuits And...IJERD Editor
-LLC resonant frequency converter is basically a combo of series as well as parallel resonant ckt. For
LCC resonant converter it is associated with a disadvantage that, though it has two resonant frequencies, the
lower resonant frequency is in ZCS region[5]. For this application, we are not able to design the converter
working at this resonant frequency. LLC resonant converter existed for a very long time but because of
unknown characteristic of this converter it was used as a series resonant converter with basically a passive
(resistive) load. . Here, it was designed to operate in switching frequency higher than resonant frequency of the
series resonant tank of Lr and Cr converter acts very similar to Series Resonant Converter. The benefit of LLC
resonant converter is narrow switching frequency range with light load[6] . Basically, the control ckt plays a
very imp. role and hence 555 Timer used here provides a perfect square wave as the control ckt provides no
slew rate which makes the square wave really strong and impenetrable. The dead band circuit provides the
exclusive dead band in micro seconds so as to avoid the simultaneous firing of two pairs of IGBT’s where one
pair switches off and the other on for a slightest period of time. Hence, the isolator ckt here is associated with
each and every ckt used because it acts as a driver and an isolation to each of the IGBT is provided with one
exclusive transformer supply[3]. The IGBT’s are fired using the appropriate signal using the previous boards
and hence at last a high frequency rectifier ckt with a filtering capacitor is used to get an exact dc
waveform .The basic goal of this particular analysis is to observe the wave forms and characteristics of
converters with differently positioned passive elements in the form of tank circuits.
Amateurs Radio operator, also known as HAM communicates with other HAMs through Radio
waves. Wireless communication in which Moon is used as natural satellite is called Moon-bounce or EME
(Earth -Moon-Earth) technique. Long distance communication (DXing) using Very High Frequency (VHF)
operated amateur HAM radio was difficult. Even with the modest setup having good transceiver, power
amplifier and high gain antenna with high directivity, VHF DXing is possible. Generally 2X11 YAGI antenna
along with rotor to set horizontal and vertical angle is used. Moon tracking software gives exact location,
visibility of Moon at both the stations and other vital data to acquire real time position of moon.
Importance of Measurements in Smart GridIJERD Editor
- The need to get reliable supply, independence from fossil fuels, and capability to provide clean
energy at a fixed and lower cost, the existing power grid structure is transforming into Smart Grid. The
development of a smart energy distribution grid is a current goal of many nations. A Smart Grid should have
new capabilities such as self-healing, high reliability, energy management, and real-time pricing. This new era
of smart future grid will lead to major changes in existing technologies at generation, transmission and
distribution levels. The incorporation of renewable energy resources and distribution generators in the existing
grid will increase the complexity, optimization problems and instability of the system. This will lead to a
paradigm shift in the instrumentation and control requirements for Smart Grids for high quality, stable and
reliable electricity supply of power. The monitoring of the grid system state and stability relies on the
availability of reliable measurement of data. In this paper the measurement areas that highlight new
measurement challenges, development of the Smart Meters and the critical parameters of electric energy to be
monitored for improving the reliability of power systems has been discussed.
Study of Macro level Properties of SCC using GGBS and Lime stone powderIJERD Editor
One of the major environmental concerns is the disposal of the waste materials and utilization of
industrial by products. Lime stone quarries will produce millions of tons waste dust powder every year. Having
considerable high degree of fineness in comparision to cement this material may be utilized as a partial
replacement to cement. For this purpose an experiment is conducted to investigate the possibility of using lime
stone powder in the production of SCC with combined use GGBS and how it affects the fresh and mechanical
properties of SCC. First SCC is made by replacing cement with GGBS in percentages like 10, 20, 30, 40, 50 and
by taking the optimum mix with GGBS lime stone powder is blended to mix in percentages like 5, 10, 15, 20 as
a partial replacement to cement. Test results shows that the SCC mix with combination of 30% GGBS and 15%
limestone powder gives maximum compressive strength and fresh properties are also in the limits prescribed by
the EFNARC.
Seismic Drift Consideration in soft storied RCC buildings: A Critical ReviewIJERD Editor
Reinforced concrete frame buildings are becoming increasingly common in urban India. Many such
buildings constructed in recent times have a special feature – the ground storey is left open for the purpose of
parking, i.e., columns in the ground floor do not have any partition walls (of either masonry or
Reinforced concrete) between them. Such buildings are often called open ground storey buildings. The
relative horizontal displacement in the ground storey is much larger than storeys above it. The total horizontal
earthquake force it can carry in the ground storey is significantly smaller than storeys above it. The soft or weak
storey may exist at any storey level other than ground storey level. The presence of walls in upper storeys
makes them much stiffer than the open ground storey. Still Multi storey reinforced concrete buildings are
continuing to be built in India which has open ground storeys. It is imperative to know the behavior of
soft storey building to the seismic load for designing various retrofit strategies. Hence it is important to
study and understand the response of such buildings and make such buildings earthquake resistant based
on the study to prevent their collapse and to save the loss of life and property.
Post processing of SLM Ti-6Al-4V Alloy in accordance with AMS 4928 standardsIJERD Editor
This Research work was done to find out the impact of AMS 4928 standard heat treatment on
Selective Laser Melted (SLM) Ti-6Al-4V Grade 23 alloy. Ti-6Al-4V Grade 23 is an Extra Low Interstitial
version of Ti alloy with lower impurities and is α+β type alloy at room temperature. SLM is one type of method
in Additive Manufacturing based on Powder bed system. Each powder layer of few microns is coated and a laser
beam is scanned to melt the metal powder according to the specification of the part and subsequently moved
downwards layer by layer. The test coupons were first heat treated according to the above mentioned standard.
The tensile testing and the microstructural analysis were done to compare the results with that of mentioned in
the AMS 4928.The yield stress andPercentage elongation in the test coupons achieved are better than the
minimum requirement by AMS 4928 standard. Coarse lamellar grain structures were obtained with no
continuous network of alpha at prior beta grain boundaries.
Treatment of Waste Water from Organic Fraction Incineration of Municipal Soli...IJERD Editor
Evaporation is one of treatment alternatives of waste water from condensation of vapour in flue gas
or from flue gas scrubber system of an incinerator. The waste water contains tar and heavy metals which are
toxic and must be separated, before discharged to environment or recycled. Due to the relatively low efficiency
of the evaporation process, a combination of the evaporation-absorption process is developed to increase the
efficiency. The aim of this research is to study the separation efficiency of tar from the tar-water mixture from
organic fraction incineration of garbage by evaporation-absorption process, and compared it with the
evaporation process. The evaporation process was performed by evaporating the waste water directly, while the
evaporation-absorption process was carried out by evaporating the waste water before it had been mixed with
palm oil as an absorbent. The results showed that the efficiency to separate the heavy tar of the evaporation
process was 73.27% compared to the combination of evaporation-absorption that was 98.82%. Meanwhile, for
the separation of the light tar, the efficiencies of both process types were almost the same. This system can be
integrated with the incinerator for the treatment of flue gases and waste water generated from the burning of
organic fraction of MSW
Content Based Video Retrieval Using Integrated Feature Extraction and Persona...IJERD Editor
Traditional video retrieval methods fail to meet technical challenges due to large and rapid growth of
multimedia data, demanding effective retrieval systems. In the last decade Content Based Video Retrieval
(CBVR) has become more and more popular. The amount of lecture video data on the Worldwide Web (WWW)
is growing rapidly. Therefore, a more efficient method for video retrieval in WWW or within large lecture video
archives is urgently needed. This paper presents an implementation of automated video indexing and video
search in large videodatabase. First of all, we apply automatic video segmentation and key-frame detection to
extract the frames from video. At next, we extract textual keywords by applying on video i.e. Optical Character
Recognition (OCR) technology on key-frames and Automatic Speech Recognition (ASR) on audio tracks of that
video. At next, we also extractingcolour, texture and edge detector features from different method. At last, we
integrate all the keywords and features which has extracted from above techniques for searching
purpose.Finallysearch similarity measure is applied to retrieve the best matchingcorresponding videos are
presented as output from database. Additionally we are providing Re-ranking of results as per users interest in
original result.
Planar Internal Antenna Design for Cellular Applications & SAR AnalysisIJERD Editor
This paper presents a new design of direct-fed Multi band printed Planar Internal Antenna (PIA), for
cellular applications. The PIA antenna is composed of ground plane, meander radiating strip and two other
parasitic strips are printed on a common substrate. The designed antenna has been simulated in CST
environment. The simulated results for the resonant frequency, return loss, radiation pattern and gain are
presented and discussed. The bandwidths for three resonance achieved on the basis of -6 dB return loss.These
Bandwidths can be utilized for GSM 900, GSM 1800, GSM 1900, LTE 2300 and Bluetooth/WLAN as an
acceptable reference in mobile phones applications. Further the antenna was placed in proximity to the SAR
head on CST environment. The simulated results of SAR analysis are presented in this paper with acceptable
range.
Intelligent learning management system startersIJERD Editor
learning management system (lms) is increasingly gaining popularity in the academic community as
a means of delivering e-learning contents. Simply placing lecture notes and videos among other contents on
lmss do not particularly train the best. This situation could be improved with intelligent tutoring systems (itss)
integration into preferred lms to make it more adaptive and effective, through enhanced student participation
and learning. This work aims, therefore, to create a starter model and a model java its integrated preferred lms.
The its integrated lms starter model was proposed through augmentation and a fluid iterative cycle of
awareness, suggestion, development, evaluation and conclusion. Known open/inexpensive, tried and tested
popular lmss were evaluated at cms matrix site, and complemented. Java its integrated moodle (preferred),
employing certain architectural framework of its integrated lms, was created following the spiral model of
software development
Transcript: Selling digital books in 2024: Insights from industry leaders - T...BookNet Canada
The publishing industry has been selling digital audiobooks and ebooks for over a decade and has found its groove. What’s changed? What has stayed the same? Where do we go from here? Join a group of leading sales peers from across the industry for a conversation about the lessons learned since the popularization of digital books, best practices, digital book supply chain management, and more.
Link to video recording: https://bnctechforum.ca/sessions/selling-digital-books-in-2024-insights-from-industry-leaders/
Presented by BookNet Canada on May 28, 2024, with support from the Department of Canadian Heritage.
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Tobias Schneck
As AI technology is pushing into IT I was wondering myself, as an “infrastructure container kubernetes guy”, how get this fancy AI technology get managed from an infrastructure operational view? Is it possible to apply our lovely cloud native principals as well? What benefit’s both technologies could bring to each other?
Let me take this questions and provide you a short journey through existing deployment models and use cases for AI software. On practical examples, we discuss what cloud/on-premise strategy we may need for applying it to our own infrastructure to get it to work from an enterprise perspective. I want to give an overview about infrastructure requirements and technologies, what could be beneficial or limiting your AI use cases in an enterprise environment. An interactive Demo will give you some insides, what approaches I got already working for real.
Connector Corner: Automate dynamic content and events by pushing a buttonDianaGray10
Here is something new! In our next Connector Corner webinar, we will demonstrate how you can use a single workflow to:
Create a campaign using Mailchimp with merge tags/fields
Send an interactive Slack channel message (using buttons)
Have the message received by managers and peers along with a test email for review
But there’s more:
In a second workflow supporting the same use case, you’ll see:
Your campaign sent to target colleagues for approval
If the “Approve” button is clicked, a Jira/Zendesk ticket is created for the marketing design team
But—if the “Reject” button is pushed, colleagues will be alerted via Slack message
Join us to learn more about this new, human-in-the-loop capability, brought to you by Integration Service connectors.
And...
Speakers:
Akshay Agnihotri, Product Manager
Charlie Greenberg, Host
GraphRAG is All You need? LLM & Knowledge GraphGuy Korland
Guy Korland, CEO and Co-founder of FalkorDB, will review two articles on the integration of language models with knowledge graphs.
1. Unifying Large Language Models and Knowledge Graphs: A Roadmap.
https://arxiv.org/abs/2306.08302
2. Microsoft Research's GraphRAG paper and a review paper on various uses of knowledge graphs:
https://www.microsoft.com/en-us/research/blog/graphrag-unlocking-llm-discovery-on-narrative-private-data/
Essentials of Automations: Optimizing FME Workflows with ParametersSafe Software
Are you looking to streamline your workflows and boost your projects’ efficiency? Do you find yourself searching for ways to add flexibility and control over your FME workflows? If so, you’re in the right place.
Join us for an insightful dive into the world of FME parameters, a critical element in optimizing workflow efficiency. This webinar marks the beginning of our three-part “Essentials of Automation” series. This first webinar is designed to equip you with the knowledge and skills to utilize parameters effectively: enhancing the flexibility, maintainability, and user control of your FME projects.
Here’s what you’ll gain:
- Essentials of FME Parameters: Understand the pivotal role of parameters, including Reader/Writer, Transformer, User, and FME Flow categories. Discover how they are the key to unlocking automation and optimization within your workflows.
- Practical Applications in FME Form: Delve into key user parameter types including choice, connections, and file URLs. Allow users to control how a workflow runs, making your workflows more reusable. Learn to import values and deliver the best user experience for your workflows while enhancing accuracy.
- Optimization Strategies in FME Flow: Explore the creation and strategic deployment of parameters in FME Flow, including the use of deployment and geometry parameters, to maximize workflow efficiency.
- Pro Tips for Success: Gain insights on parameterizing connections and leveraging new features like Conditional Visibility for clarity and simplicity.
We’ll wrap up with a glimpse into future webinars, followed by a Q&A session to address your specific questions surrounding this topic.
Don’t miss this opportunity to elevate your FME expertise and drive your projects to new heights of efficiency.
Let's dive deeper into the world of ODC! Ricardo Alves (OutSystems) will join us to tell all about the new Data Fabric. After that, Sezen de Bruijn (OutSystems) will get into the details on how to best design a sturdy architecture within ODC.
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...Jeffrey Haguewood
Sidekick Solutions uses Bonterra Impact Management (fka Social Solutions Apricot) and automation solutions to integrate data for business workflows.
We believe integration and automation are essential to user experience and the promise of efficient work through technology. Automation is the critical ingredient to realizing that full vision. We develop integration products and services for Bonterra Case Management software to support the deployment of automations for a variety of use cases.
This video focuses on the notifications, alerts, and approval requests using Slack for Bonterra Impact Management. The solutions covered in this webinar can also be deployed for Microsoft Teams.
Interested in deploying notification automations for Bonterra Impact Management? Contact us at sales@sidekicksolutionsllc.com to discuss next steps.
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...UiPathCommunity
💥 Speed, accuracy, and scaling – discover the superpowers of GenAI in action with UiPath Document Understanding and Communications Mining™:
See how to accelerate model training and optimize model performance with active learning
Learn about the latest enhancements to out-of-the-box document processing – with little to no training required
Get an exclusive demo of the new family of UiPath LLMs – GenAI models specialized for processing different types of documents and messages
This is a hands-on session specifically designed for automation developers and AI enthusiasts seeking to enhance their knowledge in leveraging the latest intelligent document processing capabilities offered by UiPath.
Speakers:
👨🏫 Andras Palfi, Senior Product Manager, UiPath
👩🏫 Lenka Dulovicova, Product Program Manager, UiPath
UiPath Test Automation using UiPath Test Suite series, part 4DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 4. In this session, we will cover Test Manager overview along with SAP heatmap.
The UiPath Test Manager overview with SAP heatmap webinar offers a concise yet comprehensive exploration of the role of a Test Manager within SAP environments, coupled with the utilization of heatmaps for effective testing strategies.
Participants will gain insights into the responsibilities, challenges, and best practices associated with test management in SAP projects. Additionally, the webinar delves into the significance of heatmaps as a visual aid for identifying testing priorities, areas of risk, and resource allocation within SAP landscapes. Through this session, attendees can expect to enhance their understanding of test management principles while learning practical approaches to optimize testing processes in SAP environments using heatmap visualization techniques
What will you get from this session?
1. Insights into SAP testing best practices
2. Heatmap utilization for testing
3. Optimization of testing processes
4. Demo
Topics covered:
Execution from the test manager
Orchestrator execution result
Defect reporting
SAP heatmap example with demo
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...Ramesh Iyer
In today's fast-changing business world, Companies that adapt and embrace new ideas often need help to keep up with the competition. However, fostering a culture of innovation takes much work. It takes vision, leadership and willingness to take risks in the right proportion. Sachin Dev Duggal, co-founder of Builder.ai, has perfected the art of this balance, creating a company culture where creativity and growth are nurtured at each stage.
DevOps and Testing slides at DASA ConnectKari Kakkonen
My and Rik Marselis slides at 30.5.2024 DASA Connect conference. We discuss about what is testing, then what is agile testing and finally what is Testing in DevOps. Finally we had lovely workshop with the participants trying to find out different ways to think about quality and testing in different parts of the DevOps infinity loop.
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered QualityInflectra
In this insightful webinar, Inflectra explores how artificial intelligence (AI) is transforming software development and testing. Discover how AI-powered tools are revolutionizing every stage of the software development lifecycle (SDLC), from design and prototyping to testing, deployment, and monitoring.
Learn about:
• The Future of Testing: How AI is shifting testing towards verification, analysis, and higher-level skills, while reducing repetitive tasks.
• Test Automation: How AI-powered test case generation, optimization, and self-healing tests are making testing more efficient and effective.
• Visual Testing: Explore the emerging capabilities of AI in visual testing and how it's set to revolutionize UI verification.
• Inflectra's AI Solutions: See demonstrations of Inflectra's cutting-edge AI tools like the ChatGPT plugin and Azure Open AI platform, designed to streamline your testing process.
Whether you're a developer, tester, or QA professional, this webinar will give you valuable insights into how AI is shaping the future of software delivery.
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
“MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
1. International Journal of Engineering Research and Development
e-ISSN: 2278-067X, p-ISSN: 2278-800X, www.ijerd.com
Volume 11, Issue 08 (August 2015), PP.30-39
30
“MS-Extractor: An Innovative Approach to Extract
Microsatellites on „Y‟ Chromosome”
Ch. Uma Maheswari1
, Prof. G.V. Padma Raju2
1
2/2 M.Tech(C.S.T) S.R.K.R Engineering College, Bhimavaram ,2
Professor and Head of C.S.E,
S.R.K.R Engineering College, Bhimavaram,Andhra Pradesh, India.
Abstract:- Simple Sequence Repeats (SSR), also known as Microsatellites, have been extensively used as
molecular markers due to their abundance and high degree of polymorphism. The nucleotide sequences of
polymorphic forms of the same gene should be 99.9% identical. So, Microsatellites extraction from the Gene is
crucial. However, Microsatellites repeat count is compared, if they differ largely, he has some disorder. The Y
chromosome likely contains 50 to 60 genes that provide instructions for making proteins. Because only males
have the Y chromosome, the genes on this chromosome tend to be involved in male sex determination and
development. Several Microsatellite Extractors exist and they fail to extract microsatellites on large data sets of
giga bytes and tera bytes in size. The proposed tool “MS-Extractor: An Innovative Approach to extract
Microsatellites on „Y‟ Chromosome” can extract both Perfect as well as Imperfect Microsatellites from large
data sets of human genome „Y‟. The proposed system uses string matching with sliding window approach to
locate Microsatellites and extracts them.
I. INTRODUCTION
1.1. Microsatellites
Microsatellites are tandem repeats of 1-6 nucleotides found at high frequency in the nuclear genomes
of most taxa [2]. As such, they are also known as simple sequence repeats (SSR), variable number tandem
repeats (VNTR) and short tandem repeats (STR).
Example of microsatellites:
a) Repeat units
AAAAAAAAAAA= (A) 11 = mononucleotide (11bp)
GTGTGTGTGTGT= (GT) 6 = dinucleotide (12bp)
CTGCTGCTGCTG= (CTG) 4 = trinucleotide (12bp)
ACTCACTCACTC= (ACTC) 4 =tetranucleotide(16bp)
b) Homozygous microsatellite
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTCTACGTGG… (46 bp)
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (46 bp)
c) Heterozygous microsatellite
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCT ATCGGTACTACGTGG… (46 bp)
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG… (50 bp)
A microsatellite locus typically varies in length between 5 and 40 repeats, but longer strings of repeats
are possible. Dinucleotide, tri nucleotide and tetranucleotide repeats are the most common choices for molecular
genetic studies. Dinucleotides are the dominant type of microsatellite repeats in most vertebrates characterized
so far, although trinucleotide repeats are most abundant in plants [2], [3], [4]. Despitethe fact that the
mechanism of microsatellite evolution and function remains unclear, SRs were being widely employed in many
fields soon after their first description [6], [13], [14] because of the high variability which makes them very
powerful genetic markers.
Apart from repeat copy number variation, a microsatellite tract (e.g. GCGCGCGCGC) also suffers
from substitutions and indels of nucleotides thereby becoming an „Imperfect‟ tract (e.g. GCGCGCAGCGC: GC
repeat with an insertion of A). Imperfect microsatellites are more stable than perfect microsatellites as they are
less prone to slippage mutations [11] and are known to play a role in gene regulation [8].
2. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
31
1.2 Y-STR’s
The Y chromosome is one of the smallest human chromosomes with an average size of 60 million base
pairs (Mb).Y chromosome-specific STRs have been proved to be an important tool in paternity cases, especially
when the alleged father is deceased. Y-STRs are also useful for analysis of stains in forensic investigations
when a male suspect is involved. Y-STRs are the most used Y chromosome markers in the forensic field due to
their typing simplicity and high level of diversity. STR typing involves simple and reliable polymerase chain
reaction (PCR)(a) techniques and is tolerant of very degraded samples. Of all Y chromosome polymorphic STRs
in fig. 1 [7] described to date, DYS19, DYS385, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393
and YCAII have more data accumulated, being the most used in population and forensic genetics. A number of
multiplex reactions have been reported in the literature but Y STR multiplexes have not reached their
potential…
Fig. 1 Y chromosome STR‟s
Very little PCR optimization to-date (most work has been done with the original PCR primer sequences).
Summary of Y DNA Population Variation
Fairly significant discrimination powers can be achieved when using many Y STR markers…very
dependent on the population samples selected
Population sub-structure exists and is more significant for Y SNPs
We will need larger databases of Y STRs and Y SNPs for calculating powers of discrimination for Y
haplotypes (for the same reasons as mt DNA).
No commercial Y STR kit exists yet (therefore these markers remain inaccessible to the general forensic DNA
community). The proposed tool MS-Extractor can extract Microsatellite in Y chromosome.
II. LITERATURE SURVEY
In the due course of our studies on microsatellites, we made a survey of existing software tools for
identification and extraction of microsatellites from nucleotide sequences. All these tools can be broadly
classified into three categories: those who can identify
(i) Only perfect microsatellites (e.g. SSRF [10], GMATo [16]).
(ii) Both perfect and imperfect microsatellites (e.g. TRF [3]).
(iii) And can search particular motif in the genome sequence (e.g. SSR scanner [1]).
In our survey we also found some tools that extracts both perfect and imperfect but only considers
substitutions but not indels. TRF tool identifies tandem repeats in larger homologous regions. It uses simple
probabilistic model for tandem repeats, an overview and the set of criteria that guide the recognition process.
This algorithm works without the need of specifying the pattern or pattern sizes. The algorithms of TRF
[3],ATR Hunter [15] and STRING [9] have been designed to find tandem repeats of large-size motifs as large as
2000 bases and hence large numbers of microsatellites go unidentified by these methods. Many of these
programs do not generate alignments between imperfect microsatellites and their expected perfect counter parts,
and therefore require additional post-processing in order to study the mutational events in microsatellites.
Imperfect Microsatellite Extractor [12] also extracts both perfect and imperfect microsatellites but it fails to
extract on large data files. The proposed tool MS-Extractor is fast, highly sensitive and is also flexible where
user can set the limits for imperfection (thus can be used for both perfect and imperfect microsatellites). The
output comprises of a list of microsatellites each of which with information such as its total imperfection
content, point mutations, sequence alignment with its perfect counterpart, whether the locus lies in the coding or
non-coding region along with corresponding known details.
3. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
32
III. METHODOLOGY
The algorithm presented in this paper takes the human genome sequence of „Y‟ chromosome line by
line, process the line and extracts microsatellites present in that line. As a result, large no of Microsatellites are
extracted and it works even on the file of large size. And also, for every motif identified it determines a
consensus pattern. The algorithm identifies microsatellite if that sequence can be expressed as tandem repeat of
size 1-6bp. The repeating motif at every iteration can harbor up to „k‟ number of point mutations (substitutions
or indels of nucleotides). For e.g. CAGTAGCATCAG („CAG‟ repeat with substitutions=2).
The MS-Extractor works based on this definition and employs string matching algorithm with sliding window
approach. MS-Extractor works on three step procedure.
Step 1: preprocessing
Identification of exact location of a microsatellite where the motif is repeated either adjacent to it (type
1 Extraction) (fig 1) or at certain intervals (type 2 Extraction) (fig 2). In this step the number of point mutations
is set to zero.
GCCCAGCAG CAGCAGCAGGCA
Fig. 2 Type 1 Extraction. The motif „CAG‟ is identified tandemly with zero edit operations (k=0). This type can
extend on both sides of the motif.
GCCCAGCAGCACCAGCAGGCA
Fig. 3 Type 2 Extraction. The motif „CAG‟ is identified after some intervention. The intervened sequence CAC
is an iteration of CAG with C->G operation (k=1).
Step 2: Extending motif search
Extension of the microsatellite on both sides of the repeat as long as the imperfection limit is satisfied.
Imperfection limit can be determined using two parameters k (substitutions and indels) and p (percentage of
imperfection) set by the user requirement. The user can set a value for „k‟ between 0 and m where m=repeat
motif size. The number of imperfections between the individual copy and perfect motif is more than the limit.
The percentage imperfection is calculated by
Pencentage of imperefection(p)
=
number of mutation in the motif
number of bases in the motif
*100
Step 3: classification
Given the repeat map of motifs identified, it determines a consensus pattern for the smallest unit in the
tandem repeat. It creates the alignment with left flanking and right flanking sequence of the motif. And also
classifies the motif is identified in coding region or non-coding region of the genome sequence. MS-Extractor
uses .ptt file to classify the identified motifs. These details are shown as follows.
Consensus: TGGTC
Start:[57] End:[66] No. of iterations: 2
Total Imperfections: 0 (Substitutions: 0 Indels: 0) Tract-length: 10
Left Flanking Sequence:
CCCTCTCTAG
TGGTCTGGTC
**********
TGGTCTGGTC
Right Flanking Sequence:
4. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
33
Fig. 3 Flowchart to extract microsatellites
The flowchart of MS-Extractor is shown in fig 3. MS-Extractor scans the genome sequence line by line
and process the line for microsatellites starting from hexa nucleotide (i.e. tract size is set to 6). For e.g.
(ATGCGC)3 is a hexa nucleotide with repeat count =3.If hexa nucleotide is not detected in the sequence, then
tract size is decremented by one and search for the penta nucleotide (i.e. m=5) and so on.
For each nucleotide it search for type 1 and type 2 microsatellites. And then extracts microsatellites
extending both side of the motif. MS-Extractor eliminates redundancy of the motifs as it starts searching from
hexa nucleotide. For e.g. in the sequence CGGCAACGGCAAA, the motif identified is (CGGCAA)2 and the
internal repeat of A within the tract is ignored.
MS-Extractor also creates the summary file with all the identified microsatellites and the repeat
number, tract size, mismatch information (both substitutions and indels), and imperfection percentage for each
base. It also creates alignments for each motif in the summary table.
5. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
34
Algorithm
The algorithm used in MS-Extractor is simple string matching algorithm with sliding window approach. MS-
Extractor uses the following modules.
I. Checks whether the pattern is repeated no of times the user asked
Input: k (size set by user), size(motif size)
Output: 0 for match, negative value for mismatch.
Module: compare (k, size)
Step 1: for (j<size && k< array.size-1; j++, k++)
Read pattern 1
Step 2: for (j<size && k< array.size-1; j++, k++)
Read pattern 2
Step 3: returns the value of Pattern1. compareTo (pattern2).
II. Search for Type 2 Extraction:
Input: txt (sequence), motif size
Output: type 1 motif
Module: motif_check2 (txt, m)
Step 1: initially motif length=6.
Step 2: check whether the motif of length=6 is a mono, di, tri, tetra, penta or hexa nucleotide.
Step 3: expand on both side of motif with the length of the motif identified.
Step 4: compare two regions to check whether they match.
Step 5: if they match store the motif information.
Step 6: else decrement the length and goto step 2.
Step 7: stop.
III. Checks whether the motif is mono, di, tri, tetra, penta or hexa nucleotide.
Input: pat (motif)
Output: type of motif
Module: type_chckr (pat)
Step 1: iis initialized to 0.
Step 2: length of the motif is identified.
Step 3: if i=1, return mono.
Step 4: else if i=2, return di.
Step 5 else if i=3, return tri.
Step 6 else if i=4, return tetra.
Step 7 else if i=5, return penta.
Step 8 else return hexa.
IV. Checks for substitutions in 2 patterns
Input: sub (repeated copy), pat (perfect motif), k (limit)
Output: 0 for no substitutions or r
Module: sub_chckr (sub, pat, k)
Step 1: r, i, j initialized to 0.
Step 2: until pat is not null repeat following 2 steps.
Step 3: pat is compared to sub
Step 4: if equal r++, i++, j++
Step 5: compare r and k, if r>k return 0 else return r.
V. Checks for Indels on the right side pattern
Input:Ind (repeated copy), pat (perfect motif), k (limit)
Output: 0 for no indels or r
Module: indl_chckr (Ind, pat, k)
Step 1: repeat k number of times
Step 2: repeat until r<m (motif size)
Step 3: Ind is copied to temp
Step 4: call sub_chckr (temp, pat, k)
Step 5: if r value is not zero return r else -1.
6. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
35
VI. Search for Type 2 Nucleation sites:
Input: txt (sequence), motif size
Output: type 1 motif
Module: motif_check2 (txt, m)
Step 1: initially motif length=6.
Step 2: check whether the motif of length=6 is a mono, di, tri, tetra, penta or hexa nucleotide.
Step 3: expand on both side of motif with the length of the motif identified.
Step 4: compare two regions to check whether they match.
Step 5: if they match store the motif information.
Step 6: else decrement the length and goto step 2.
Step 7: stop.
These modules are used to identify motifs of size 1-6bp within the limit of substitutions and indels set
by the user. And also we can identify that the motif is of type1 or type 2. MS-Extractor can apply these modules
on both sides of the motif. And also there are other modules for creating primer classification and to create
summary file. The module for imperfection percentage check is also included in this system.
IV. IMPLEMENTATION
MS-Extractor has been developed by using java language, which is platform independent.MS-Extractor
is tested and compared with other tools that extract microsatellites both perfect and imperfect. This tool extracts
motifs from large data sets from mb‟s to gb‟s. User can set parameters through the interface. HTML forms are
used to develop an interface.
The input to the MS-Extractor given by the user involves the human genome sequence of „Y‟
chromosome and also the following parameters; (i) number of repeats, (ii) number of substitutions/indels, (iii)
imperfection percentage,(iv) coding table file. These parameters changed as per user requirements. Once these
parameters set the batch file is executed. The output of this system contains two files. One of them is summary
file which contain information about all the motifs identified along with their number of iterations, tract size,
start & end locations, imperfection percentages for each base. Second file contains primer classification,
alignments of each motif with consensus. These two files can be available in both text format and in HTML
forms. The summary file can be used for further classification of motifs as input to other files. HTML forms
contains links for each motif, these links contains a file attached to it. The file contains the alignment and
consensus.
V. RESULTS AND DISCUSSION
To describe the system capability, we analyze the human genome „Y‟ chromosome and extract
microsatellites. The obtained results are compared with other tools. MS-Extractor is accurate when compared to
those tools. MS-Extractor is fast and flexible and extracts more number of microsatellites. The proposed system
can process the large data sets where as some tools fails to extract from them. To demonstrate the whole process
we run the tool with some parameters in basic mode. The imperfection percentage(p) is set to 10% for all
nucleotides; the imperfection limit is set as follows, (for mono=1, di=1, tri=1, tetra=2, penta=2, hexa=3), and the
repeat number also set (for mono=10, di=5, tri=4, tetra=3, penta=2, hexa=2). Human „Y‟ chromosome is given
as input which is of size 25mb, and a protein information table also provided to classify the coding and no-
coding regions. MS-Extractor identified many more microsatellites from the sequence and created a summary
file as follows;
Table1. Summary file
Consensus Iteration Tract-size Start End imperfection %
CTAACC 6 36 1 36 0
TGGTC 2 10 57 66 0
GCACCT 2 12 3 14 0
CCCTT 2 10 8 17 0
AAT 6 18 1 18 0
TCTGT 2 10 22 31 0
AACCCT 2 12 1 12 0
TTCC 4 16 11 26 6
TCCC 3 12 23 34 8
8. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
37
Table 1: continued
Consensus Iteration Tract-size Start End imperfection %
CTGT 3 12 44 55 8
AGGCCC 2 12 44 55 0
GACCT 2 12 57 68 0
GACCTA 2 12 26 37 0
TAGACC 2 12 50 61 0
CTGT 3 12 43 54 8
AGGCC 2 12 43 54 0
GACCTA 2 12 27 38 0
CTGT 3 12 18 29 8
Table 1 refers to the summary file of MS-Extractor. Summary file contains each and every motif
identified using this marker along with the information of the motif that includes iterations, tract size, starting
and ending positions of the motif. MS-Extractor not only creates summary file. It is more flexible when
compared to other tools presented in literature survey of this paper. It also creates alignment for each motif in
the summary table and these alignments are stored in both text format and in HTML forms, provided as a link to
the particular motif of the consensus. The following is the alignment file;
Table 2. Alignment table
Sequence:
Sequence Length :bp
0Imperfection %c : Mono: 10.0,Di: 10.0, Tri:10.0, Tetra:10.0, Penta: 10.0, Hexa:10.0
Mismatch in Pattern : Mono: 1,Di: 1, Tri:1, Tetra:2, Penta: 2, Hexa:3
Repeat Number : Mono: 10,Di: 5, Tri:4, Tetra:3, Penta: 2, Hexa:2
Composition: A: -100, T: -100, C:-100, G:-100
ALIGNMENTS:
Consensus: CTAACC
Start:[1] End:[36] No. of iterations: 6
Total Imperfections: 0 (Substitutions: 0 Indels: 0) Tract-length: 36
Left Flanking Sequence:
CTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
************************************
CTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
Right Flanking Sequence:
------------------------------------
Consensus: TGGTC
Start:[57] End:[66] No. of iterations: 2
Total Imperfections: 0 (Substitutions: 0 Indels: 0) Tract-length: 10
Left Flanking Sequence:
CCCTCTCTAG
TGGTCTGGTC
**********
TGGTCTGGTC
Right Flanking Sequence:
-----------------------------------
Consensus: GCACCT
Start:[3] End:[14] No. of iterations: 2
Total Imperfections: 0 (Substitutions: 0 Indels: 0) Tract-length: 12
9. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
38
Left Flanking Sequence:
--------AA
GCACCTGCACCT
************
GCACCTGCACCT
Right Flanking Sequence:
Table 2 contains the alignment in the form of consensus for each motif. These alignments are linked to
the corresponding motif in the summary file. These links are provided in HTML forms.The fig 4 shows the
graph that is drawn between TRF, sputnik and MS-Extractor. The input sequence, human genome „Y‟
chromosome is given as input to the all three markers. Both TRF and GMATo failed to extract all motifs in the
given sequence. MS-Extractor showed the utmost performance and extracted all the microsatellites in the „Y‟
chromosome.
Fig 4: A graph that shows performance of markers. TRF extracted up to 50%, whereasGMATo identified
65%, and MS-Extractor identified upto 90% and more for human genome „Y‟ chromosome.
MS-Extractor embodies all the required features for a systematic analysis of microsatellites which are
not readily available in the other tools, as MS-Extractor has been designed keeping in view of the limitations we
encountered with the other available tools. Using MS-Extractor, the users can: (i) search only perfect as well as
imperfect microsatellites; (ii) get the coding/non-coding information of the microsatellite tracts;(iii) generate
alignments with their perfect counter parts to know about substitutions and indels; (iv) restrict the imperfection
limit for repeat unit of each size; (v) set the imperfection percentage threshold of the entire tract of each repeat
size; (vi) restrict the minimum number of repeat units of a tract of each size;
VI. CONCLUSION
In this paper, we proposed a tool MS-Extractor to process the human genome sequences line by line
and extract the microsatellites in single run. As it process the sequence line by line it occupies less memory
space and it is fast. MS-Extractor is accurate and extracts 99% of all microsatellites and creates summary file
with all the information as repeat number. It also provides information about coding/non-coding region. MS-
Extractor is compared with other markers available and our marker showed best results among all other markers
with an effective user interface.MS-Extractor is flexible and user interactive, as it provides a flexible
environment for user by letting user to set the mutation limits and other parameters.The future work for this
marker includes adding SSR standardization and compound microsatellite extraction.
0
20
40
60
80
100
TRF1 GMATo Ms-Extractor
50
65
90
Repetspercentage
Microsatellite markers
Performance of Markers
10. “MS-Extractor: An Innovative Approach to Extract Microsatellites on „Y‟ Chromosome”
39
REFERENCES
[1]. Anwar,T. and Khan,A.U., (2006). SSRscanner: a program for reporting distribution and exact location
of simple sequence repeats. Bio information,1, 89–91.
[2]. Beckmann J.S. &Weber J.L., (1992). Survey of human and rat microsatellites. Genomics, 12, 627–
631.
[3]. Benson,G., (1999). Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res.,
27, 573–580.
[4]. Chen, C.X., Zhou, P., Choi, Y.A., Huang, S., Gmitter, F.G., 2006. Mining and characterizing
microsatellites from citrus ESTs. Theor. Appl. Genet. 112, 1248-1257.
[5]. Kantety, R.V., Rota, M. L., Matthews, D.E., Sorrells, M.E., 2002. Data mining for simple sequence
repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat. Plant Mol. Biol. 48,
501-510.
[6]. Litt, M. &Luty, J.A. (1989) Ahypervariable microsatellite revealed by in vitro amplification of a
dinucleotide repeat within the cardiac muscle actin gene. American Journal ofHuman Genetics, 44,
397-401.
[7]. Mark A. Jobling and Chris Tyler Smith, (2003). The Human „Y‟ Chromosome: An Evolutionary
Marker Comes of Age. Doi: 10. 1038.
[8]. Meloni,R. et al., (1998). A tetranucleotide polymorphic microsatellite, located in the first intron of the
tyrosine hydroxylase gene, acts as a transcription regulatory element in vitro. Hum. Mol. Genet., 7,
423–428.
[9]. Parisi,V. et al., (2003). STRING: finding tandem repeats in DNA sequences. Bioinformatics, 19, 1733–
1738.
[10]. Sreenu,V.B. et al., (2003). MICAS: a fully automated web server for microsatellite extraction and
analysis from prokaryote and viral genomic sequences.Appl. Bioinformatics, 2, 165–168.
[11]. Sturzeneker,R. et al., (1998). Polarity of mutation in tumor-associated microsatellite instability. Hum.
Genet., 102, 231–235.
[12]. Suresh B. Mudunuri and Hampapathalu A. Nagarajaram, (2007).IMEX(Imperfect Microsatellite
Extractor). Vol .23no .10.
[13]. Tautz D. (1989) Hypervariability of simple sequences as a general source for polymorphicDNA
markers. Nucleic Acids Research, 17, 6463-6471.
[14]. Weber J.L. & May P.E. (1989) Abundant class of human DNA polymorphisms which can be typed
using the polymerase chain reaction. American Journal of Human Genetics, 44, 388-396.
[15]. Wexler,Y. et al., (2004). Finding approximate tandem repeats in genomic sequences. RECOMB 2004.
[16]. Xuewen Wang*, Peng Lu &Zhaopeng Luo, 2013. GMATo: a novel tool for the identification and
analysis of microsatellites in large genomes. ISSN 0973-2063 (online) 0973-8894.
[17]. You-Chun Li, Abraham B. Korol, TzionFahima and EviatarNevo, (2004). Microsatellites with in
genes: Structure, function and evolutionMol. Biol. Evol 21(6):991-1007.