The document describes miScript miRNA PCR Arrays for analyzing miRNA expression patterns. It discusses miRNA biogenesis and function, and how the miScript system allows for genome-wide and pathway-focused miRNA analysis using a qPCR-based approach. The miScript arrays offer high reproducibility, sensitivity, and the ability to discover cancer-related and developmentally regulated miRNAs. They can be used to screen focused miRNA panels or conduct genome-wide screens to discover novel miRNA roles.
This document discusses new assays for microRNA (miRNA) research, including isolation, expression analysis, and functional analysis. It describes miRNA isolation kits that can purify miRNAs from various sample types. For expression analysis, it highlights real-time PCR-based miRNA assays, including miRNA PCR arrays that can profile hundreds of miRNAs simultaneously. It also discusses tools for identifying miRNA targets and analyzing miRNA function, such as miRNA mimics and inhibitors. Examples are given of how these assays have been used to study miRNAs in cancer and other diseases.
This document describes miScript miRNA PCR Arrays, which allow for the simultaneous detection of genome-wide or pathway-focused microRNA (miRNA) expression. It provides an overview of miRNA biology and research, details the miScript miRNA PCR Array system workflow from isolation to data analysis, and discusses applications in cancer research, development, differentiation, and genome-wide discovery. The system offers validated miRNA assays, controls, and optimized reagents to enable reproducible and reliable miRNA expression profiling from RNA samples.
1) The webinar discusses advanced microRNA (miRNA) expression analysis from experimental design through data analysis.
2) It focuses on using miScript miRNA PCR Arrays to profile miRNA expression and the ∆∆CT method to analyze the real-time PCR data.
3) The webinar provides examples of using the arrays to analyze miRNA expression differences between normal lung tissue and lung tumors, and in serum miRNA experiments.
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...QIAGEN
miRNAs are small functional RNAs, which regulate gene expression post-transcriptionally. The miScript miRNA PCR Array System is a sensitive and reliable technology for detection of mature miRNAs in any laboratory. In this slideshow, the challenges of miRNA data analysis and solutions that the miScript miRNA PCR Arrays provide for researchers interested in identifying miRNA from cells, tissues and FFPE samples are described. You will also learn how to use our GeneGlobe Data Analysis Center to identify miRNAs that may be important in your favorite biological pathway or disease.
The document discusses RNA interference (RNAi) solutions for gene knockdown research. It describes using short interfering RNA (siRNA) and short hairpin RNA (shRNA) to temporarily or permanently suppress gene expression. Challenges of RNAi experiments include off-target effects and variability in knockdown efficiency. The document promotes solutions from QIAGEN, including validated siRNA and shRNA designs with controls, to help optimize RNAi experiments and reduce non-specific effects.
The document discusses various topics related to molecular profiling and personalized medicine. It describes first generation molecular profiling techniques like gene sequencing, microarrays, and PCR. It then covers next generation sequencing technologies like Roche 454, Illumina, and ABI SOLID. It also discusses second generation techniques for DNA and RNA profiling including exome sequencing, ChIP-seq, and RNA-seq. Finally, it briefly mentions third generation sequencing and epigenetic profiling.
This document describes pathway-powered PCR arrays for gene expression analysis. It discusses:
- PCR arrays that analyze the expression of genes involved in biological pathways, covering sample prep through data analysis.
- Over 140 pathway-focused PCR arrays are available covering cancer, inflammation, neuroscience, and other areas.
- The PCR arrays allow analysis of mRNA expression from various sample types in a high-sensitivity and reproducible manner using real-time PCR instrumentation.
Reporter assay and q pcr application 2012Elsa von Licy
This document summarizes a presentation on high-performance cell-based assay and qPCR technologies for pathway-focused research. The presentation overview discusses QIAGEN's SABiosciences portfolio, PCR arrays, Cignal and Cignal Lenti pathway reporters, and provides a summary. PCR arrays allow analysis of mRNA expression of up to 84 genes related to biological pathways in a single experiment. Cignal reporter assays use dual-luciferase reporters to study 45 signal transduction pathways. Cignal Lenti reporters use lentiviral delivery of luciferase or GFP reporters to study pathways in difficult to transfect cells like stem cells or primary cells.
This document discusses new assays for microRNA (miRNA) research, including isolation, expression analysis, and functional analysis. It describes miRNA isolation kits that can purify miRNAs from various sample types. For expression analysis, it highlights real-time PCR-based miRNA assays, including miRNA PCR arrays that can profile hundreds of miRNAs simultaneously. It also discusses tools for identifying miRNA targets and analyzing miRNA function, such as miRNA mimics and inhibitors. Examples are given of how these assays have been used to study miRNAs in cancer and other diseases.
This document describes miScript miRNA PCR Arrays, which allow for the simultaneous detection of genome-wide or pathway-focused microRNA (miRNA) expression. It provides an overview of miRNA biology and research, details the miScript miRNA PCR Array system workflow from isolation to data analysis, and discusses applications in cancer research, development, differentiation, and genome-wide discovery. The system offers validated miRNA assays, controls, and optimized reagents to enable reproducible and reliable miRNA expression profiling from RNA samples.
1) The webinar discusses advanced microRNA (miRNA) expression analysis from experimental design through data analysis.
2) It focuses on using miScript miRNA PCR Arrays to profile miRNA expression and the ∆∆CT method to analyze the real-time PCR data.
3) The webinar provides examples of using the arrays to analyze miRNA expression differences between normal lung tissue and lung tumors, and in serum miRNA experiments.
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...QIAGEN
miRNAs are small functional RNAs, which regulate gene expression post-transcriptionally. The miScript miRNA PCR Array System is a sensitive and reliable technology for detection of mature miRNAs in any laboratory. In this slideshow, the challenges of miRNA data analysis and solutions that the miScript miRNA PCR Arrays provide for researchers interested in identifying miRNA from cells, tissues and FFPE samples are described. You will also learn how to use our GeneGlobe Data Analysis Center to identify miRNAs that may be important in your favorite biological pathway or disease.
The document discusses RNA interference (RNAi) solutions for gene knockdown research. It describes using short interfering RNA (siRNA) and short hairpin RNA (shRNA) to temporarily or permanently suppress gene expression. Challenges of RNAi experiments include off-target effects and variability in knockdown efficiency. The document promotes solutions from QIAGEN, including validated siRNA and shRNA designs with controls, to help optimize RNAi experiments and reduce non-specific effects.
The document discusses various topics related to molecular profiling and personalized medicine. It describes first generation molecular profiling techniques like gene sequencing, microarrays, and PCR. It then covers next generation sequencing technologies like Roche 454, Illumina, and ABI SOLID. It also discusses second generation techniques for DNA and RNA profiling including exome sequencing, ChIP-seq, and RNA-seq. Finally, it briefly mentions third generation sequencing and epigenetic profiling.
This document describes pathway-powered PCR arrays for gene expression analysis. It discusses:
- PCR arrays that analyze the expression of genes involved in biological pathways, covering sample prep through data analysis.
- Over 140 pathway-focused PCR arrays are available covering cancer, inflammation, neuroscience, and other areas.
- The PCR arrays allow analysis of mRNA expression from various sample types in a high-sensitivity and reproducible manner using real-time PCR instrumentation.
Reporter assay and q pcr application 2012Elsa von Licy
This document summarizes a presentation on high-performance cell-based assay and qPCR technologies for pathway-focused research. The presentation overview discusses QIAGEN's SABiosciences portfolio, PCR arrays, Cignal and Cignal Lenti pathway reporters, and provides a summary. PCR arrays allow analysis of mRNA expression of up to 84 genes related to biological pathways in a single experiment. Cignal reporter assays use dual-luciferase reporters to study 45 signal transduction pathways. Cignal Lenti reporters use lentiviral delivery of luciferase or GFP reporters to study pathways in difficult to transfect cells like stem cells or primary cells.
"Massively parallel sequencing in forensic genetics
Dr. Walther Parson
assoc. Prof. Institute of Legal Medicine, Innsbruck, Austria
adj. Prof. Penn State University, PA, USA"
This document provides guidance on planning and executing successful siRNA experiments through following good practices. It reviews key steps including understanding the target transcript through identifying variants and structures, selecting effective siRNAs using design tools and rules, choosing a cell line with appropriate expression profiles, optimizing experimental conditions through controls and pilot experiments, and validating the assay. Following these steps can help achieve optimized gene knockdown.
This document summarizes a webinar series on microRNAs and their role in human disease. It introduces microRNA biogenesis, function, and analysis. The webinar series consists of three parts that will cover microRNA biogenesis and function, advanced microRNA expression analysis, and profiling microRNA expression in different sample types for biomarker development. The document provides an agenda for the first webinar that will discuss microRNA background, genomics, role in disease, isolation technologies, quantification technologies, profiling technologies, and functionalization technologies. It also advertises a newly released product.
This document discusses next generation molecular profiling technologies. It begins with an overview of first generation molecular profiling techniques like gene sequencing, microarrays, and fluorescence in situ hybridization (FISH). It then describes some key advantages of next generation sequencing technologies like their ability to generate more sequence data at lower cost. Examples of second generation DNA and RNA profiling methods are provided, including exome sequencing and RNA-sequencing. The document also briefly discusses emerging areas like third generation sequencing and next generation protein profiling using mass spectrometry. Epigenetic profiling using techniques like methyl-binding domain sequencing is summarized in the section on next generation epigenetic profiling.
miRNA Seq
Dr. Sikandar Hayat Khan discusses miRNA sequencing (miRNA Seq) and its emerging role in medical sciences. He summarizes the process of miRNA Seq which includes miRNA sampling, extraction, cDNA library preparation, sequencing, and bioinformatics analysis. miRNA Seq can provide a wholesome approach for identifying novel miRNA biomarkers for disease and enable prediction of diseases. However, appropriate methodology selection and interpretation of miRNA data requires bioinformatics knowledge.
El martes 26 de septiembre del 2017 organizamos en la Fundación Ramón Areces un Simposio Internacional sobre nuevas perspectivas en la investigación sobre el cáncer. En colaboración con el Centro Nacional de Investigaciones Oncológicas (CNIO) y Weizmann Institute for Science.
RNA-based screening in drug discovery – introducing sgRNA technologiesCandy Smellie
RNA-based screening in drug discovery
Use of X-MAN™ isogenic cell lines in RNAi screening approaches
Comparison of siRNA and sgRNA screening approaches
The challenges of genome-wide CRISPR-Cas9 knockout (GeCKO) screening
Using CRISPR-Cas9 sgRNA for target identification and patient stratification
Moving from screening hit to target validation
sgRNA screening: not just KOs
This document describes SureFIND Transcriptome PCR Arrays, which are ready-to-use cDNA panels that can identify the miRNAs, pathways, or transcription factors that regulate gene expression. Each array contains cDNA from cells treated with different factors, such as miRNA mimics or pathway inhibitors. The document outlines an example where a Transcriptome PCR Array identified three miRNAs - miR-193b, miR-138, and miR-373 - that regulate the INPPL1 gene. Users are encouraged to validate top hits from the arrays.
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Thermo Fisher Scientific
This document summarizes the integration of massively parallel sequencing (MPS) using the Ion PGMTM sequencer into a forensic laboratory. The project aims to begin transforming STR profiling to genomic technologies, add additional SNP markers in a single workflow, and enable non-human DNA testing. Initial results show sequencing of amplified STR products is possible but alignment is challenging. A custom panel of 280 targets including STRs, SNPs, and amelogenin was also tested with most targets detected across samples. Ongoing work focuses on improving sensitivity, reproducibility, and analyzing mixed samples. Implementation of MPS as a routine forensic service is estimated within 3-5 years.
A quick introduction of Genomic Testing Cooperative (GTC).
We strive to offer advanced genomic testing to communities everywhere at an affordable price.
We utilize a cooperative business model that enables academic and commercial laboratories to help physicians treat patients locally with the most advanced precision medicine.
We embrace disruptive deep learning and advanced technology to create scalable efficiencies, incomparable precision, and a more personalized approach to patient care.
https://www.genomictestingcooperative.com
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...Laura Berry
Presented at the NGS Tech and Applications Congress: USA. To find out more, visit:
www.global-engage.com
Masayoshi Itoh is a Senior Scientist at the RIKEN Center for Life Science Technologies (CLST) and Coordinator of the RIKEN Preventive Medicine and Diagnostics Innovation Program (PMI). In this presentation Masayoshi introduces CAP trapper technologies and presents the findings of the FANTOM5 project.
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...QIAGEN
Pyrosequencing is a highly flexible technology based on sequencing-by-synthesis for the rapid and quantitative analysis of any type of sequence variation. The real-time output delivers high-resolution sequence information, making pyrosequencing highly suitable for applications ranging from biallelic or multiallelic SNP analysis, DNA methylation quantification to complex mutation analysis of multiple sequence variations in a single run.
In this slideeck, we introduce the new PyroMark Q48 Autoprep system which enables fully automated template preparation integrated in the pyrosequencing workflow. In addition, a new Multiple Primer Dispensation (MPD) strategy is presented which allows fully automated dispensation of sequencing primer, offering a seamless workflow from samples to quantitative genotyping results.
This slidedeck focuses on the following topics
• Pyrosequencing technology and workflow in genotyping analysis
• Introduction into the new PyroMark Q48 Autoprep
• MPD strategy for a seamless automated pyrosequencing workflow
Join us and learn how you can apply the new pyrosequencing system and protocol to your variant analysis or genotyping research
High Sensitivity Detection of Tumor Gene Mutations-v3Michael Powell
This document summarizes a new method called QClamp PCR that can highly sensitively detect tumor gene mutations. QClamp uses synthetic XNA probes to selectively block amplification of wild-type DNA sequences, improving the sensitivity of PCR to detect mutations present in less than 0.1% of samples. This level of sensitivity allows detection of mutations from biopsy, tissue, or blood samples. The document discusses applications of QClamp PCR for detection of EGFR mutations in lung cancer patients and enriching samples for DNA sequencing. QClamp represents an improvement over other methods by reducing the excess of wild-type DNA that creates high background signals.
1) The document describes QClamp XNA-PCR, a technology from DiaCarta that uses molecular "clamps" to highly sensitively detect low frequency and cell-free circulating mutant DNA.
2) It needs assays that can detect biomarkers present at low frequency in samples containing a high amount of normal DNA. Existing technologies are inadequate for this need.
3) QClamp assays can reliably detect all possible mutations in a gene region using a single reaction. They can achieve ultra-high sensitivity down to 0.01% from minimal sample input.
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
The document describes a new method for sample tracking using plasmid barcodes. Small plasmids are constructed with barcode sequences inserted within a genomic region captured by the sequencing panel. Samples are spiked with different barcoded plasmids prior to sequencing. By mapping the sequencing data to the plasmid references, any potential sample swaps or mix-ups can be detected by observing the expected barcodes. The method provides a cheap and simple way to track samples without additional workflow steps. Testing showed the barcodes are reliably captured and detected in the sequencing data for both exome and amplicon sequencing.
This document discusses GeneRead DNAseq Targeted Exon Enrichment and the GeneRead Library Quantification System for next generation sequencing. It begins with an introduction and agenda, then discusses targeted enrichment including the workflow, principles, data analysis, pathway content, performance data, and an application example. It also discusses library quantification including the workflow and an application example. In summary, the document presents Qiagen's GeneRead DNAseq and Library Quant systems as targeted enrichment and library quantification solutions for next generation sequencing applications.
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Thermo Fisher Scientific
We identified mutations in eleven cell free
(cf) DNA samples by next generation
sequencing (NGS) using the Ion AmpliSeq™
Colon & Lung Cancer Research Panel and
the Ion PGM™ System. Since detection of
low frequency mutant alleles may not always
be called confidently in NGS, we verified
results by rare mutation analysis using
digital PCR on the QuantStudio™ 3D Digital
PCR System as an independent method.
We show that frequencies detected are
consistent for both methods for low
frequency mutant alleles at and below 1%.
microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...Paul Schoenhagen
This document discusses microRNAs (miRNAs) as potential biomarkers for cardiovascular disease diagnosis and therapy. It summarizes that miRNAs have been found to be specifically up or downregulated in different cardiovascular diseases and animal models. Circulating miRNAs have shown promise as biomarkers for conditions like myocardial infarction and coronary artery disease due to their stability and disease-specific expression patterns. Several miRNAs have been identified as biomarkers for acute myocardial infarction that may complement or improve upon existing protein biomarkers. Research is also exploring the potential of miRNA-based therapies for cardiovascular diseases.
1. The study found that the protein Ago2 helps generate microRNAs like miR-451 by directly loading the immature hairpin form into Ago2, skipping the Dicer step of maturation.
2. Mice with inactive Ago2 suffered from anemia due to impaired maturation of miR-451, which protects red blood cells from oxidative stress.
3. Under oxidative stress, mice lacking miR-451 had profound anemia, showing that miR-451 plays an important protective role for red blood cells during times of stress.
"Massively parallel sequencing in forensic genetics
Dr. Walther Parson
assoc. Prof. Institute of Legal Medicine, Innsbruck, Austria
adj. Prof. Penn State University, PA, USA"
This document provides guidance on planning and executing successful siRNA experiments through following good practices. It reviews key steps including understanding the target transcript through identifying variants and structures, selecting effective siRNAs using design tools and rules, choosing a cell line with appropriate expression profiles, optimizing experimental conditions through controls and pilot experiments, and validating the assay. Following these steps can help achieve optimized gene knockdown.
This document summarizes a webinar series on microRNAs and their role in human disease. It introduces microRNA biogenesis, function, and analysis. The webinar series consists of three parts that will cover microRNA biogenesis and function, advanced microRNA expression analysis, and profiling microRNA expression in different sample types for biomarker development. The document provides an agenda for the first webinar that will discuss microRNA background, genomics, role in disease, isolation technologies, quantification technologies, profiling technologies, and functionalization technologies. It also advertises a newly released product.
This document discusses next generation molecular profiling technologies. It begins with an overview of first generation molecular profiling techniques like gene sequencing, microarrays, and fluorescence in situ hybridization (FISH). It then describes some key advantages of next generation sequencing technologies like their ability to generate more sequence data at lower cost. Examples of second generation DNA and RNA profiling methods are provided, including exome sequencing and RNA-sequencing. The document also briefly discusses emerging areas like third generation sequencing and next generation protein profiling using mass spectrometry. Epigenetic profiling using techniques like methyl-binding domain sequencing is summarized in the section on next generation epigenetic profiling.
miRNA Seq
Dr. Sikandar Hayat Khan discusses miRNA sequencing (miRNA Seq) and its emerging role in medical sciences. He summarizes the process of miRNA Seq which includes miRNA sampling, extraction, cDNA library preparation, sequencing, and bioinformatics analysis. miRNA Seq can provide a wholesome approach for identifying novel miRNA biomarkers for disease and enable prediction of diseases. However, appropriate methodology selection and interpretation of miRNA data requires bioinformatics knowledge.
El martes 26 de septiembre del 2017 organizamos en la Fundación Ramón Areces un Simposio Internacional sobre nuevas perspectivas en la investigación sobre el cáncer. En colaboración con el Centro Nacional de Investigaciones Oncológicas (CNIO) y Weizmann Institute for Science.
RNA-based screening in drug discovery – introducing sgRNA technologiesCandy Smellie
RNA-based screening in drug discovery
Use of X-MAN™ isogenic cell lines in RNAi screening approaches
Comparison of siRNA and sgRNA screening approaches
The challenges of genome-wide CRISPR-Cas9 knockout (GeCKO) screening
Using CRISPR-Cas9 sgRNA for target identification and patient stratification
Moving from screening hit to target validation
sgRNA screening: not just KOs
This document describes SureFIND Transcriptome PCR Arrays, which are ready-to-use cDNA panels that can identify the miRNAs, pathways, or transcription factors that regulate gene expression. Each array contains cDNA from cells treated with different factors, such as miRNA mimics or pathway inhibitors. The document outlines an example where a Transcriptome PCR Array identified three miRNAs - miR-193b, miR-138, and miR-373 - that regulate the INPPL1 gene. Users are encouraged to validate top hits from the arrays.
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Thermo Fisher Scientific
This document summarizes the integration of massively parallel sequencing (MPS) using the Ion PGMTM sequencer into a forensic laboratory. The project aims to begin transforming STR profiling to genomic technologies, add additional SNP markers in a single workflow, and enable non-human DNA testing. Initial results show sequencing of amplified STR products is possible but alignment is challenging. A custom panel of 280 targets including STRs, SNPs, and amelogenin was also tested with most targets detected across samples. Ongoing work focuses on improving sensitivity, reproducibility, and analyzing mixed samples. Implementation of MPS as a routine forensic service is estimated within 3-5 years.
A quick introduction of Genomic Testing Cooperative (GTC).
We strive to offer advanced genomic testing to communities everywhere at an affordable price.
We utilize a cooperative business model that enables academic and commercial laboratories to help physicians treat patients locally with the most advanced precision medicine.
We embrace disruptive deep learning and advanced technology to create scalable efficiencies, incomparable precision, and a more personalized approach to patient care.
https://www.genomictestingcooperative.com
CAP Trapper Technologies and Applications, CAP Analysis of Gene Expression (C...Laura Berry
Presented at the NGS Tech and Applications Congress: USA. To find out more, visit:
www.global-engage.com
Masayoshi Itoh is a Senior Scientist at the RIKEN Center for Life Science Technologies (CLST) and Coordinator of the RIKEN Preventive Medicine and Diagnostics Innovation Program (PMI). In this presentation Masayoshi introduces CAP trapper technologies and presents the findings of the FANTOM5 project.
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...QIAGEN
Pyrosequencing is a highly flexible technology based on sequencing-by-synthesis for the rapid and quantitative analysis of any type of sequence variation. The real-time output delivers high-resolution sequence information, making pyrosequencing highly suitable for applications ranging from biallelic or multiallelic SNP analysis, DNA methylation quantification to complex mutation analysis of multiple sequence variations in a single run.
In this slideeck, we introduce the new PyroMark Q48 Autoprep system which enables fully automated template preparation integrated in the pyrosequencing workflow. In addition, a new Multiple Primer Dispensation (MPD) strategy is presented which allows fully automated dispensation of sequencing primer, offering a seamless workflow from samples to quantitative genotyping results.
This slidedeck focuses on the following topics
• Pyrosequencing technology and workflow in genotyping analysis
• Introduction into the new PyroMark Q48 Autoprep
• MPD strategy for a seamless automated pyrosequencing workflow
Join us and learn how you can apply the new pyrosequencing system and protocol to your variant analysis or genotyping research
High Sensitivity Detection of Tumor Gene Mutations-v3Michael Powell
This document summarizes a new method called QClamp PCR that can highly sensitively detect tumor gene mutations. QClamp uses synthetic XNA probes to selectively block amplification of wild-type DNA sequences, improving the sensitivity of PCR to detect mutations present in less than 0.1% of samples. This level of sensitivity allows detection of mutations from biopsy, tissue, or blood samples. The document discusses applications of QClamp PCR for detection of EGFR mutations in lung cancer patients and enriching samples for DNA sequencing. QClamp represents an improvement over other methods by reducing the excess of wild-type DNA that creates high background signals.
1) The document describes QClamp XNA-PCR, a technology from DiaCarta that uses molecular "clamps" to highly sensitively detect low frequency and cell-free circulating mutant DNA.
2) It needs assays that can detect biomarkers present at low frequency in samples containing a high amount of normal DNA. Existing technologies are inadequate for this need.
3) QClamp assays can reliably detect all possible mutations in a gene region using a single reaction. They can achieve ultra-high sensitivity down to 0.01% from minimal sample input.
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
The document describes a new method for sample tracking using plasmid barcodes. Small plasmids are constructed with barcode sequences inserted within a genomic region captured by the sequencing panel. Samples are spiked with different barcoded plasmids prior to sequencing. By mapping the sequencing data to the plasmid references, any potential sample swaps or mix-ups can be detected by observing the expected barcodes. The method provides a cheap and simple way to track samples without additional workflow steps. Testing showed the barcodes are reliably captured and detected in the sequencing data for both exome and amplicon sequencing.
This document discusses GeneRead DNAseq Targeted Exon Enrichment and the GeneRead Library Quantification System for next generation sequencing. It begins with an introduction and agenda, then discusses targeted enrichment including the workflow, principles, data analysis, pathway content, performance data, and an application example. It also discusses library quantification including the workflow and an application example. In summary, the document presents Qiagen's GeneRead DNAseq and Library Quant systems as targeted enrichment and library quantification solutions for next generation sequencing applications.
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Thermo Fisher Scientific
We identified mutations in eleven cell free
(cf) DNA samples by next generation
sequencing (NGS) using the Ion AmpliSeq™
Colon & Lung Cancer Research Panel and
the Ion PGM™ System. Since detection of
low frequency mutant alleles may not always
be called confidently in NGS, we verified
results by rare mutation analysis using
digital PCR on the QuantStudio™ 3D Digital
PCR System as an independent method.
We show that frequencies detected are
consistent for both methods for low
frequency mutant alleles at and below 1%.
microRNA-based diagnostics and therapy in cardiovascular disease—Summing up t...Paul Schoenhagen
This document discusses microRNAs (miRNAs) as potential biomarkers for cardiovascular disease diagnosis and therapy. It summarizes that miRNAs have been found to be specifically up or downregulated in different cardiovascular diseases and animal models. Circulating miRNAs have shown promise as biomarkers for conditions like myocardial infarction and coronary artery disease due to their stability and disease-specific expression patterns. Several miRNAs have been identified as biomarkers for acute myocardial infarction that may complement or improve upon existing protein biomarkers. Research is also exploring the potential of miRNA-based therapies for cardiovascular diseases.
1. The study found that the protein Ago2 helps generate microRNAs like miR-451 by directly loading the immature hairpin form into Ago2, skipping the Dicer step of maturation.
2. Mice with inactive Ago2 suffered from anemia due to impaired maturation of miR-451, which protects red blood cells from oxidative stress.
3. Under oxidative stress, mice lacking miR-451 had profound anemia, showing that miR-451 plays an important protective role for red blood cells during times of stress.
This document summarizes RNA and protein synthesis. It describes that DNA is made of nucleotides and has a double helix structure. During transcription, RNA polymerase builds an RNA strand that is complementary to DNA. The RNA can be messenger RNA (mRNA), transfer RNA (tRNA), or ribosomal RNA (rRNA). mRNA carries the genetic code from the nucleus to the ribosome. During translation, mRNA matches up with tRNA to add amino acids together and form a protein according to the mRNA's code.
This document provides information about microRNAs (miRNAs) and their applications. It begins with an introduction to miRNAs, including that they are small noncoding RNA molecules that regulate genes. It then discusses the history of miRNA discovery, including the first two miRNAs discovered: lin-4 and let-7. The document proceeds to explain the biogenesis of miRNAs in detail through multiple steps from transcription to incorporation into the RNA-induced silencing complex. It also discusses applications of miRNAs as biomarkers for various diseases and their role in cancer and diabetes.
Integrative transcriptomics to study non-coding RNA functionsMaté Ongenaert
Integrative transcriptomics to study non-coding RNA functions
by dr. ir. Pieter Mestdagh - Center for Medical Genetics, Ghent University
Over the last years, non-coding RNAs (e.g. microRNAs and long non-coding RNAs) have emerged as an important layer of the transcriptome. In order to elucidate their function in disease biology, multiple tools have been developed, ranging from miRNA target prediction algorithms to the more advanced integrative genomics approaches. Through the combination of multiple layers of information, integrative genomics allows a more accurate and comprehensive assessment of non-coding RNA functions in human disease. In this presentation, I will discuss different approaches on how to combine multi-level transcriptome data in order to functionally characterize non-coding RNA networks.
1. The document describes the three main steps in protein synthesis: transcription, RNA processing, and translation.
2. Transcription involves copying a segment of DNA into a complementary mRNA molecule. RNA processing removes introns from pre-mRNA, joining exons to create mature mRNA.
3. Translation uses the mRNA to sequence amino acids via tRNA molecules on ribosomes, forming proteins according to the genetic code.
The 10 basic tips & tricks presented in this slide-deck are based on Frequently Asked Questions raised by scientists, and their answers as supplied by the Ambion technical support teams at Life Technologies.
This document discusses microRNAs (miRNAs), which are 22 nucleotide non-coding RNAs that play important regulatory roles in plants. miRNAs are processed from stem-loop precursors by the enzyme Dicer and mediate post-transcriptional gene silencing by guiding mRNA cleavage or translational repression. Bioinformatic and genetic studies have identified many conserved miRNA families in plants and shown that miRNAs regulate key transcription factors to control developmental processes.
Mir193b–365 is essential for brown fat differentiation by regulating genes involved in adipogenesis. The study identified Mir193b-365 as a microRNA complex necessary for brown adipose tissue differentiation. Blocking Mir193b expression inhibited brown fat marker genes, pointing to its critical role in brown fat development. Mir193b-365 associates closely with mRNAs like Prdm16 and Pparα that help upregulate it during differentiation, inducing adipogenic factors while suppressing myogenic factors.
RNA are at the forefront of automation technology, delivering market leading solution to the world’s most successful manufacturers and aiming to give customers a competitive advantage.
This document provides an overview of the origins and mechanisms of microRNAs (miRNAs) and small interfering RNAs (siRNAs). It discusses how double-stranded RNAs are cut by the enzyme Dicer into short RNA fragments that then base pair with mRNAs to induce degradation or transcriptional silencing. Key players in this RNA interference (RNAi) pathway include Dicer, Argonaute proteins, and the RNA-induced silencing complex (RISC). The document contrasts siRNAs, which originate from long double-stranded RNA, and miRNAs, which are encoded from single-stranded RNA precursors that form hairpin structures. It examines the processing steps and roles of various proteins in mediating the effects of si
microRNA discovery and biomarker development in clinical samplesexiqon
The webinar discussed microRNA discovery and biomarker development in clinical samples using LNATM technology. It covered how LNATM probes can overcome challenges in analyzing microRNAs due to their short length and sequence variations. The webinar also presented a case study using LNATM PCR to detect microRNAs in blood plasma as potential biomarkers for early detection of colorectal cancer. Finally, it discussed challenges in normalizing microRNA qPCR data from serum/plasma samples.
MicroRNAs (miRNAs) are small non-coding RNAs that play important gene regulatory roles in eukaryotic cells. They are approximately 22 nucleotides in length and are transcribed from independent genes or introns, then processed through a biogenesis pathway before targeting mRNAs for silencing or degradation. MiRNAs regulate genes involved in development, metabolism, and diseases like cancer. Their expression and function is tightly controlled through transcriptional and post-transcriptional mechanisms in order to influence protein expression levels. While much progress has been made in understanding miRNAs, further study is still needed to elucidate their complex regulatory networks and roles in development and disease.
RNA is one of the major biological macromolecules essential for life. It has several types that serve different functions. Messenger RNA (mRNA) carries genetic information from DNA to the ribosomes for protein synthesis. Ribosomal RNA (rRNA) is the catalytic component of ribosomes and is involved in protein translation. Transfer RNA (tRNA) transfers specific amino acids to the growing polypeptide chain during translation.
SMi is proud to present its 6th conference on RNAi, miRNA and siRNA which shall tackle some of the most prominent issues that stand in the way of the successful harnessing of the vast potential that the process possesses. RNAi is still a new and exciting area of pharmaceutical development, however significant progress is required in certain areas, in achieving successful targeted delivery and tackling off targeting as two examples.
This conference will display some of the most promising results achieved; from structural determination through to specific therapeutic applications, clinical trial considerations and negotiating the regulatory minefield, attendees can be sure to expect an invaluable learning and networking experience.
The document summarizes key concepts about DNA, RNA, and protein synthesis. It discusses:
1) The structure of DNA as a double helix with nucleotides containing nitrogen bases that allow the strands to replicate.
2) Chromosomes contain DNA and package it tightly for storage in eukaryotic cells. DNA replication results in two DNA molecules each with one original and one new strand.
3) RNA acts as a messenger to transfer DNA instructions to the cell. Transcription and translation lead to protein synthesis on ribosomes according to the genetic code.
4) Mutations can occur through changes to nucleotides and can impact protein function, though most do not affect the organism.
1. DNA is made up of deoxyribose, phosphate groups, and four nitrogenous bases (adenine, guanine, cytosine, thymine).
2. The bases pair up through hydrogen bonding between complementary base pairs (adenine with thymine, cytosine with guanine).
3. The paired bases and sugar-phosphate backbone form the structure of the DNA double helix, with the bases in the middle and the backbones on the outside.
RNA- A polymer of ribonucleotides, is a single stranded structure. There are three major types of RNA- m RNA,t RNA and r RNA. Besides that there are small nuclear,micro RNAs, small interfering and heterogeneous RNAs. Each of them has a specific structure and performs a specific function.
Genomic projects provided clone resources for coding mRNAs, but non-coding mRNAs are still missing for functional studies. Seeing the growing number of non-coding mRNAs, we hope the community will prepare better resources for studying human non-coding mRNAs.
- MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression through base pairing with messenger RNA (mRNA) molecules. They are encoded in the genome and are abundant in many human cell types.
- miRNAs play a vital role in genetic regulation and are involved in most biological processes. Aberrant miRNA expression has been implicated in many diseases.
- miRNAs are initially transcribed as long primary transcripts that are processed in the nucleus by the Drosha enzyme into hairpin-shaped precursor miRNAs. These are then exported into the cytoplasm and further processed by the Dicer enzyme into mature miRNAs that can regulate gene expression through pairing with mRNAs.
The document describes miScript miRNA PCR Arrays, which enable comprehensive profiling of miRNAs for disease research and biomarker discovery. The arrays use a validated PCR technique to quantify miRNA expression levels from tissue samples. They are available in customizable panels focused on specific biological pathways, diseases, or the entire miRNome. The workflow involves isolating miRNA from samples, converting it to cDNA, and running real-time PCR on the array to obtain expression data for targeted miRNAs. The technique provides sensitive and reproducible miRNA profiling to explore their roles in biological contexts and diseases.
The document describes miScript miRNA PCR Arrays, which enable comprehensive profiling of miRNAs for disease research and biomarker discovery. The arrays contain extensively verified assays for miRNAs related to biological pathways and diseases. The miScript PCR system provides sensitive and reproducible quantification of miRNA expression. It allows isolation of miRNA from samples, conversion to cDNA, and real-time PCR profiling of miRNA expression across pathway- or disease-focused arrays.
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...QIAGEN
This document discusses a 4-part webinar series on microRNA (miRNA) research presented by QIAGEN. Part 1 will cover miRNA profiling from biofluids, part 2 will discuss challenges in miRNA research, part 3 will focus on advanced miRNA expression analysis, and part 4 will analyze functional analysis of miRNA. The document provides background on miRNAs and their role in gene expression and disease. It also describes QIAGEN products and solutions for miRNA sample preparation, real-time PCR, data analysis, and functional validation to help researchers overcome challenges in miRNA analysis.
This document discusses RNA interference and provides information about QIAGEN's SureSilencing shRNA plasmids for gene knockdown experiments. It begins with an introduction to RNAi mechanisms and challenges. It then describes QIAGEN's SureSilencing shRNA plasmid solution, which features guaranteed high knockdown efficiency, multiple designs to control off-target effects, and experimental validation. The document reviews the plasmid features, design algorithm, applications and provides a workflow for gene knockdown experiments using the plasmids. It emphasizes the importance of including appropriate controls and validation steps to ensure successful RNAi experiments.
This document discusses microRNAs (miRNAs) and methods for studying their function and regulation of genes. It describes:
1) What miRNAs are, how they work by incorporating into the RISC complex and repressing target mRNAs through translational repression or degradation.
2) Techniques for manipulating miRNAs in cell lines using reporter assays, mimics, inhibitors and target protectors to study their effects on genes.
3) How to screen for miRNAs that regulate a target gene using ready-made cDNA panels and quantitative PCR. Several examples are provided of identifying miRNAs that regulate important cancer genes.
QIAGEN provides solutions for miRNA purification, quantification, and functional analysis. This includes miRNA purification kits, miRNA expression profiling tools like miScript miRNA PCR Arrays, and products for studying miRNA biogenesis and regulation. The miScript PCR System allows sensitive quantification and profiling of miRNA expression using real-time PCR. miScript miRNA PCR Arrays enable rapid profiling of mature miRNAs in miRNome and pathway-focused panels.
Technical Guide to Qiagen PCR Arrays - Download the GuideQIAGEN
Total RNA discovery with RT2 and miScript PCR Arrays : Explore the RNA universe - Whatever your destination within the RNA universe, QIAGEN will help you get there. The miRNeasy kits deliver pure, high-quality total RNA from a broad range of samples. The RT2 and miScript PCR arrays are a complete solution both for focused analysis of gene and microRNA expression and for validation of microarray and RNA sequencing experiments. Together with the powerful analytics tools of GeneGlobe® and QIAGEN Ingenuity® Pathway Analysis, these products give you a smooth path from your sample to high-quality results.
The document describes RT2 miRNA PCR Arrays from SABiosciences for analyzing microRNA (miRNA) expression. Key points:
Relative Detection
(% perfect match)
1) The system allows simultaneous detection of over 700 miRNAs representing most functional human miRNAs.
hsa-miR-10a
hsa-miR-10b
100
0.01
2) It uses a universal polyadenylation and reverse transcription approach followed by SYBR Green-based real-time PCR, offering improved sensitivity, specificity, and reproducibility over other methods.
hsa-miR-10a
hsa-miR-10b
0.01
This document provides an overview of RNA interference (RNAi) technology and its applications in high-throughput screening. It discusses the RNAi pathway and how siRNAs can be used to silence gene expression. The document outlines some challenges of RNAi screening including off-target effects and highlights the importance of validation. It also promotes QIAGEN's siRNA design tools and libraries for optimizing RNAi experiments and minimizing false positives and negatives in high-throughput screens.
This document describes the development of a prototype synthetic microRNA mixture intended for use as a spike-in control for microRNA profiling platforms. 32 microRNAs were selected based on certain criteria and synthesized. The microRNAs were pooled and combined in varying concentrations according to a Latin Square design to generate 8 control mixtures spanning a 4-log dynamic range. Initial testing on PCR arrays showed the control mixtures generated heterologous calibration curves comparable to homogeneous controls for assessing platform performance. The synthetic microRNA control has the potential to help evaluate various performance characteristics of microRNA profiling platforms.
Extending miRQC’s dynamic range: amplifying the view of Limiting RNA samples ...QIAGEN
The original microRNA quality control (miRQC) study provided an in-depth analysis of commercially available microRNA (miRNA) quantification platforms. Specifically, twelve different
microarray, real-time PCR and small RNA sequencing platforms were assessed for reproducibility, sensitivity, accuracy, specificity and concordance of differential expression using a variety of sample types. Overall, each platform exhibited specific strengths and weaknesses, leading to the
final suggestion that a platform should be chosen on the basis of the experimental setting and the specific research questions. With this suggestion in mind, and the fact that liquid miRNA biopsies are an area of intense interest, we sought to expand the original miRQC study. For our “miRQC extension,” we benchmarked the QIAGEN miScript® PCR System with and without preamplification, and included a specific focus on routinely used biofluids. Concurrently, we benchmarked the miScript PCR System against another SYBR® Green miRNA detection platform. Overall, QIAGEN miScript demonstrated strong reproducibility and accuracy as well as superior detection rate and sensitivity in biofluids. Collectively, QIAGEN miScript provides the leading solution for novel miRNA discoveries.
Single-cell microRNA expression profiling is a challenging workflow. From cell lysis, reverse transcription, preamplificatin to real-time PCR, every step involves technical pitfalls. Therefore it is critical to have a robust system that facilitates universal cDNA synthesis and universal amplification of all miRNAs in one workflow without introducing bias. Here we present a new poster – introducing a robust real-time PCR workflow and protocol for profiling miRNA expression from a single cell and how we analyze the single cells by using the free data analysis software.
The document discusses using PCR arrays to profile gene expression and epigenetics. PCR arrays allow researchers to analyze expression of up to 84 genes related to a pathway or disease using real-time PCR. They include controls to check for genomic DNA contamination and assay performance. As an example, the document describes how a researcher could use a PCR array to compare gene expression between metastatic and non-metastatic breast tumor samples.
This document discusses using gene and miRNA expression profiling to develop biomarkers for monitoring genotoxicity. It describes:
1. Developing gene-based in vitro biomarkers for genotoxicity using RT2 Profiler PCR Arrays to analyze expression of DNA damage and p53 pathway genes in HepG2 cells exposed to genotoxic and non-genotoxic compounds. 11 genes were identified as classifiers.
2. Identifying miRNA-based in vivo biomarkers by profiling miRNA expression in mouse liver after exposure to the carcinogen ENU using miScript PCR Arrays. The mir-34 family showed temporal changes and clustering analysis identified differentially expressed miRNAs.
3. miRNA profiles have potential to serve as biomarkers for genotoxicity
This document describes a study that used miRNA expression profiling to identify potential biomarkers for lung cancer. Researchers used the miRNeasy Serum/Plasma Kit to isolate total RNA from normal and lung cancer serum samples. They then used the miScript PCR System and the Human Serum & Plasma 384HC miScript miRNA PCR Array to analyze miRNA expression levels. Several miRNAs were found to be significantly upregulated in lung cancer serum samples, including miRNAs that have previously been identified as blood-based markers for lung cancer.
This document summarizes a scientific article about overcoming limitations in sample material for miRNA biomarker discovery. It discusses how miRNAs have potential as diagnostic, prognostic, and theranostic biomarkers but valuable sample types like laser-captured samples or circulating tumor cells often have insufficient amounts of material for full miRNA profiling. The article presents an integrated PCR-based system that reduces the sample amount needed for full miRNA profiling by several orders of magnitude, enabling detailed analysis of even the smallest samples. This advance opens up new possibilities for biomarker development using hard-to-obtain sample types.
This document provides an overview of RT2 Profiler PCR Arrays from SABiosciences, which allow for gene expression analysis from small samples and FFPE samples. The document discusses how PCR Arrays work using SABiosciences' PreAMP technology to increase sensitivity for samples containing as little as 1-100ng of RNA. It also reviews the performance data demonstrating the ability of PreAMP to detect more genes and shift genes with high Ct values into the detectable range. Finally, it highlights the complete PCR Array system from SABiosciences which provides optimized kits, controls, and software for reliable gene expression analysis from sample to results in about 3 hours.
Total RNA Discovery for RNA Biomarker Development WebinarQIAGEN
Precision medicine offers to transform patient care by targeting treatment to those with most to gain. To date the most significant advances have been at the level of DNA, for example, the use of somatic DNA alterations as diagnostic indicators of disease and for prediction of pharmacodynamic response. Development of RNA expression signatures as biomarkers has been more problematic. While RNA expression analysis has yielded valuable insights into the biological mechanisms of disease, RNA is a more unstable molecule than DNA, and more easily damaged or degraded during sample collection and isolation. In addition, RNA levels are inherently dynamic and gene expression signatures are extraordinarily complex. Recently, much progress has been made in identifying key changes in gene expression in cancer and other diseases, as well as identifying expression signatures in circulating nucleic acid that have the potential to be developed into diagnostic and prognostic indicators.
This document is an agenda for a webinar on profiling miRNA expression in cells, formalin-fixed paraffin-embedded (FFPE) tissue samples, and serum. The webinar will provide an introduction to miRNAs and disease, discuss sample preparation options for different sample types, and describe the miScript PCR System for profiling miRNA expression. The speaker, Jonathan Shaffer, will summarize the miScript PCR System and take questions at the end of the webinar.
This slidedeck presents a simple and accurate real-time PCR system for relevant biological pathway- and disease-focused mRNA and long noncoding RNA (lncRNA) expression profiling. Learn about the stringent performance built into the technology to ensure its sensitivity, specificity, reproducibility and reliability. Application examples are also presented.
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Elsa von Licy
The document discusses various topics related to scientific reasoning, practices, and argumentation including different styles of scientific thinking, features of scientific knowledge, and teaching and learning science. It provides examples of "crazy ideas" in science that are now accepted, examines the role of argument in science, and outlines the scientific practices and central questions of science. It also discusses developing models, planning investigations, analyzing data, and constructing explanations as key scientific practices.
Anti-philosophy rejects traditional philosophy and logic, instead embracing creativity, spirituality, and personality. It considers philosophy to be dead, kept alive artificially by analytic philosophers. The document criticizes how philosophy is currently taught and argues it has become unproductive, replacing original aims with nonsense. Anti-philosophy's goal is not to destroy philosophy but to transform its current state and avoid fundamentalism in philosophy and science.
There is no_such_thing_as_a_social_science_introElsa von Licy
This document provides an introduction and overview of the arguments made in the book "There is No Such Thing as Social Science". It begins by stating the provocative title and questioning whether the authors will take it back or qualify their position.
It then outlines three ways the term "social science" could be used - referring to a scientific spirit of inquiry, a shared scientific method, or reducibility to natural sciences. The authors argue against the latter two, methodological and substantive reductionism.
The introduction discusses how opponents may accuse the authors of being a priori or anti-reductionist, but argues that those defending social science are actually being dogmatic by insisting it must follow a scientific model. It frames the debate as being
1. miScript miRNA PCR Arrays
Genome-Wide & Pathway-Focused Analysis
With an Advanced qPCR Technology
Samuel J. Rulli, Jr.,Ph.D.
qPCR Applications Scientist
Samuel.Rulli@QIAGEN.com
Sample & Assay Technologies
2. miScript miRNA PCR Arrays
Genome-Wide & Pathway-Focused Analysis
With an Advanced qPCR Technology
Questions? Comments? or Suggestions?
Ask now or contact Technical Support
.
.
Telephone: 888-503-3187; Email: support@SABiosciences.com
.
Sample & Assay Technologies
3. Welcome to SABiosciences: Systems Biology
with a Pathway Focused Approach
•
SABiosciences is now a
Company
-3-
Sample & Assay Technologies
4. Topics to be Covered
Introduction to miRNA
miScript miRNA PCR Array Overview
How It Works
Portfolio
Benefit
miScript miRNA PCR Array Applications
Cancer
Development & Differentiation
Genome-Wide Discovery
-4-
Sample & Assay Technologies
5. What Is MicroRNA?
.
.
.
Endogenously expressed small functional RNAs (19-25 nt)
Regulate mRNA expression post-transcriptionally
mRNA degradation, but also translation inhibition
Only partial sequence complementarity required
One miRNA can potentially regulate hundreds of mRNAs
One mRNA can be regulated by multiple miRNAs
Another layer of complexity for regulating gene expression
-5-
Sample & Assay Technologies
6. Canonical pathway of microRNA biogenesis
NUCLEUS
microRNA Gene
DNA
Transcribed by RNA Polymerase II as
a long primary transcript (pri-miRNAs),
which may contain more than one miRNA.
POL II
Pri-miRNA
Drosha-DGCR8
In the nucleus, Pri-miRNAs are processed
to hairpin-like pre-miRNAs by RNAse IIIlike enzyme Drosha
Pre-miRNA
CYTOPLASM
Exportin
Pre-miRNAs are then exported to the
Cytosol by Exportin 5
Exportin
DICER-TRBP
mature miRNA
Ago
RISC Assembly
These miRNAs are incorporated in RISC
RISC
High homology
mRNA cleavage
In the cytosol RNAse III-like Dicer
processes these precursors to mature
miRNAs
Partial homology
Translational Repression
mRNA degradation
miRNAs with high homology to the target
mRNA lead to mRNA cleavage
miRNAs with imperfect base pairing to the
target mRNA lead to translational
repression and/or mRNA degradation
Krol, J et.al., (2010) Nature Rev Genetics, 11, 597; Winter, J. et.al., (2009) Nature Cell Biology, 11, 228
-6-
Sample & Assay Technologies
7. miRNA genomic structure
(a) Independent Promoter
MyoD
SRF
miR‐1‐1
miR‐1‐1
miR‐133a‐2
miR‐133a‐2
(b) Intronic
miR‐208
Exon‐27
miR‐208
Exon‐28
(c) Exonic
miR‐198
Exon‐10
miR‐198
Exon‐11
Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter
Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can
also be in clusters, transcribed by the host gene promoter
Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene
miRNAs can be transcribed from the negative strand within or near a protein coding gene
-7-
Sample & Assay Technologies
8. Multiple loci can generate the same mature miRNA
But are under different regulatory control
Stem Loop
CHR
Overlapping transcripts
CHR: Coordinates (GRCh37)
1302-1
12
intergenic
12: 113132839-113132981 [-]
1302-3
2
intergenic
2: 114340536-114340673 [-]
1302-7
8
intergenic
8: 142867603-142867674 [-]
1302-10
15
intergenic
15: 102500662-102500799 [-]
1302-11
19
intergenic
19: 71973-72110 [+]
1302-2
1
intronic
Non protein coding
1: 30366-30503 [+] sense
1302-4
2
intronic
Non protein coding
2: 208133999-208134148 [-]
1302-9
9
Non protein coding
9: 30144-30281 [+]; Sense
1302-5
20
intronic
Protein coding/FAM65C; intron4
1302-6
7
intronic
Protein coding/HDAC9; intron 1
1302-8
9
intronic
Protein coding/ch9orf174
20: 49231173-49231322 [-]; Sense
7: 18166843-18166932 [-] ; Antisense
9: 100125836-100125963 [-];
Antisense
Mature-miR-1302: UUGGGACAUACUUAUGCUAAA
www.mirbase.org
-8-
Sample & Assay Technologies
14. miScript miRNA Array format:
Standardized controls (96 well plate)
1
A
B
C
D
E
F
G
H
2
3
4
5
6
7
8
9
10
11
12
84 miRNA Pathway Assays
Controls
1
2
3
4
5
6
7
8
9
10
11
12
H
Cel-miR-39
SNORD61; SNORD68; SNORD72
SNORD95; SNORD96A; RNU6B
miRTC
PPC
Spike in
Control
miScript Controls for
Normalization
RT
Control
PCR
Control
miScript controls: Common for Human, Mouse, Rat and Dog Arrays
- 14 -
Sample & Assay Technologies
15. miScript miRNA PCR Arrays
cDNA Synthesis (miScript II RT KIT)
1 hours
.
Load Plates (Preferably with 8-Channel
Pipettors)
2 minutes
.
Run 40 cycle qPCR Program
2 hours
.
Upload and Analyze Data
15 minutes
.
- 15 -
Sample & Assay Technologies
16. miScript miRNA PCR Arrays
Complete miRNA genome (miRNome)
miRNA Pathway Arrays
Human, Mouse, Rat:
Brain Cancers
Cancer
Cell Differentiation & Development
Immunopathology
Inflammation
miFinder
Neurological Development & Disease
Serum and Plasma (NEW!)
Breast Cancer
Ovarian Cancer
Human miScript miRNA PCR Array
Mouse miScript miRNA PCR Array
Rat miScript miRNA PCR Array
Dog miScript miRNA PCR Array
All miRNA designs based on mirBase 16
- 16 -
Sample & Assay Technologies
17. Compatible Instrumentation: 96- & 384-Well Formats
.
.
.
.
.
96-Well Blocks: 7000, 7300, 7500, 7700, 7900HT, ViiA 7
FAST 96-Well Blocks: 7500, 7900HT, Step One Plus, ViiA 7
FAST 384-Well Block: 7900HT, ViiA 7
.
.
Mastercycler ep realplex 2/2S/4/4S
.
Mx3000p, Mx3005p, Mx4000p
iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384
Opticon, Opticon 2, Chromo 4
LightCycler 480
.
Rotor-Gene Q, Rotor-Gene 6000
miRNA PCR Array Service Core
- 17 -
Sample & Assay Technologies
18. miRNA RT-PCR Technical Difficulties
Short sequence (21-23nt)
.
Background from contaminating small RNAs (tRNA, rRNA, snRNA)
.
Highly homologous
Many miRNAs have a single nucleotide difference
.
- 18 -
Sample & Assay Technologies
19. SABio: Universal miRNA Reverse Transcription
Same cDNA preparation can assay ANY miRNA
miRNA
Poly(A) Polymerase
AAAAAAAA
NNTTTTTTTT
miRNA RT Primer
Reverse Transcriptase
TTTTTTTT
Real-Time PCR
miRNA-Specific Primer
TTTTTTTT
Universal Primer
- 19 -
Sample & Assay Technologies
20. Performance: Universal RT Advantages
Ease of Universal Reverse Transcription Reaction
Simpler setup, without primer interaction issues
Less sample necessary for analyses
Equal RT reaction for each miRNA, to ensure reproducible
expression analysis
Comprehensive miRNA coverage
cDNA can be saved for new analyses when additional miRNA
sequences are discovered
.
.
Similar potential specificity, & additional flexibility!
- 20 -
Sample & Assay Technologies
21. Performance: Reproducibility
The miscript miRNA PCR Assays are highly reproducible,
ensuring run-to-run, plate-to-plate and sample-to-sample
reliability.
- 21 -
Sample & Assay Technologies
22. Replicates: Technical & Biological
Technical
Reproducibility of the PCR Arrays is very high
Results demonstrate that what you are seeing is a result of biology, not
technique.
RTC & PPC show technical reproducibility on each plate, and comparable
across plates.
Biological
Needed to verify the results are a result of biology
Need multiple samples
At least 3 replicates per sample for statistical analysis
p values
95% Confidence Intervals
- 22 -
Sample & Assay Technologies
23. Topics to be Covered
Introduction to miRNA
miScript miRNA PCR Array Overview
How It Works
Portfolio
Benefit
miScript miRNA PCR Array Applications
Cancer
Development & Differentiation
Genome-Wide Discovery
- 23 -
Sample & Assay Technologies
24. Application Data: Cancer Biomarkers
Human Cancer miscript miRNA PCR Array:
Many Cancer-Specific miRNA Are Up-regulated in a
Colon Tumor.
- 24 -
Sample & Assay Technologies
26. Application Data: Genome-Wide Screening
40
Ct Adeno-p53
35
30
203
551a
25
34a
940
20
15
15
20
25
30
35
40
Ct Control
miscript Human Genome miRNA PCR Array: Identifies Known
and Novel miRNA Targets of the p53 Signaling Pathway
- 26 -
Sample & Assay Technologies
27. Application Data: FFPE
Expression rank order of 88
cancer related miRNAs in
RNA extracted from one
20m section of a 2-year
old normal human colon
FFPE block using the
miscript FFPE RNA
Extraction Kit.
- 27 -
Sample & Assay Technologies
28. SUMMARY
miRNA Function
.
•
Regulates gene expression post-transcriptionally
miRNA Performance
.
•
•
•
RT-PCR vs. Microarrays
Universal vs. Sequence-Specific RT
Specificity, Sensitivity & Reproducibility
miRNA Applications
.
•
•
Screen cancer- or development-focused miRNA panels
Discover novel roles for miRNA sequences
How can YOU analyze miRNA in YOUR research?
… With miscript miRNA PCR Arrays & Assays!
- 28 -
Sample & Assay Technologies
29. New User Promotion
Experience miRNA PCR Array Performance Try them today!
Promo Code: FDK-MIS1
Starter Pack for miscript miRNA PCR Arrays
• 2 96-well or 1 384-well (4x96) PCR Arrays (Free)
• Any pathway
• With purchase of:
• mIScript SYBR PCR Kit (200 reaction)
• miscript miRNA 1st Strand cDNA Synthesis Kit
Please call to take advantage of this offer.
Valid for US & Canadian customers
Questions?
Contact Technical Support 9 AM – 6 PM Eastern M – F
Many scientists have discovered the
power of miRNA PCR Arrays.
Contact: 1-888-503-3187 OR support@SABiosciences.com
Join them on the road to success!
http://www.sabiosciences.com/promotion/miscriptdemo.php
- 29 -
Sample & Assay Technologies
30. What’s Next – After PCR Arrays
.
.
.
.
.
.
Validate results with more sample and focused set of genes
Custom PCR Arrays
Identify Transcription Factors Regulating your Gene
Biology-on-Array
Assess Biological Impact
Cignal™ Reporters
Knockdown Analysis
SureSilencing™ shRNA Plasmids
Flexitube/Flexiplate siRNAs
Analyze interaction between DNA & nuclear proteins
ChampionChIP™ Chromatin Immunoprecipitation PCR Arrays
Quantify secreted proteins in blood plasma sera
ELISArrays
- 30 -
Sample & Assay Technologies