Mi rna array 2013

392 views

Published on

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
392
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
16
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Mi rna array 2013

  1. 1. miScript miRNA PCR Arrays Simultaneous Detection of Genome-Wide or Pathway-Focused miRNA Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com support@sabiosciences.com (US) SAB.EU@qiagen.com (international) Sample & Assay Technologies
  2. 2. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview miRNA isolation miScript miRNA PCR Arrays and Assays Pre-amplification of miRNA Data Analysis miScript miRNA PCR Array Applications Cancer Development & Differentiation Genome-Wide Discovery -2- Sample & Assay Technologies
  3. 3. What Is MicroRNA? Endogenously expressed small functional RNAs (19-25 nt) . Regulate mRNA expression post-transcriptionally mRNA degradation, but also translation inhibition . Only partial sequence complementarity required One miRNA can potentially regulate hundreds of mRNAs One mRNA can be regulated by multiple miRNAs . Another layer of complexity for regulating gene expression -3- Sample & Assay Technologies
  4. 4. Canonical pathway of microRNA biogenesis Transcribed by RNA Polymerase II as a long primary transcript (pri-miRNAs), which may contain more than one miRNA. In the nucleus, Pri-miRNAs are processed to hairpin-like pre-miRNAs by RNAse IIIlike enzyme Drosha Pre-miRNAs are then exported to the Cytosol by Exportin 5 In the cytosol RNAse III-like Dicer processes these precursors to mature miRNAs These miRNAs are incorporated in RISC miRNAs with high homology to the target mRNA lead to mRNA cleavage miRNAs with imperfect base pairing to the target mRNA lead to translational repression and/or mRNA degradation Krol, J et.al., (2010) Nature Rev Genetics, 11, 597; Winter, J. et.al., (2009) Nature Cell Biology, 11, 228 -4- Sample & Assay Technologies
  5. 5. miRNA genomic structure Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can also be in clusters, transcribed by the host gene promoter Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene miRNAs can be transcribed from the negative strand within or near a protein coding gene -5- Sample & Assay Technologies
  6. 6. Multiple loci can generate the same mature miRNA But are under different regulatory control Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron4 1302-6 7 intronic Protein coding/HDAC9; intron 1 1302-8 9 intronic Protein coding/ch9orf174 20: 49231173-49231322 [-]; Sense 7: 18166843-18166932 [-] ; Antisense 9: 100125836-100125963 [-]; Antisense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org -6- Sample & Assay Technologies
  7. 7. miRNAs are continually being discovered miRNA database: www.mirbase.org New miRNAs continually discovered (release 19.0, August 2012) . . . Human: 1066 (V16) 2032 (v19) Mouse: 940 (v16) 1281 (v19) Rat: 653 (v16) 721 (v19) Nomenclature Pri-miRNA (>100nt) Pre-miRNA (~70nt) Mature miRNA (~20nt) . -7- Sample & Assay Technologies
  8. 8. miRNA Research is an exponentially growing field HighWire + PubMed Publications miRBase Entries 25000 mature miRNA sequences miRNA Publications 12000 10000 8000 6000 4000 2000 0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 * Projected * Year 20000 15000 10000 5000 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 miRBase Version Virtually every publication includes quantification experiments. Changes in miRNA correlated with gene expression changes in development, differentiation, signal transduction, infection, aging, and disease. -8- Sample & Assay Technologies
  9. 9. Why Analyze miRNA Expression Patterns? Potential for genome-wide coverage, even though >1000 miRNAs identified . miRNA expression profiles correlate with: Protein & Gene Expression Levels, Biological Phenotypes . miRNA regulated genes are involved in a variety of biological processes and diseases: Cancer Development Immunology Aging Heart Diseases Neurological Diseases . -9- Sample & Assay Technologies
  10. 10. Unique miRNA signatures are found in human cancer (first studies around 2005) miRNAs located in genomic regions amplified in cancers (e.g. miR-12-92 cluster) can function as oncogenes, whereas miRNAs located in portions of chromosomes deleted in cancers (e.g. miR-15a-miR-16-1 cluster) can function as tumor suppressors. Abnormal expression of miRNAs has been found in both solid and hematopoietic tumors. miRNA expression fingerprints correlate with clinical and biological characteristics of tumors, including tissue type, differentiation, aggression and response to therapy. The race is on to develop miRNA biomarkers and therapeutics! - 10 - Sample & Assay Technologies
  11. 11. Circa 2011 A growing picture of miRNA dysregulation in cancer Deletions of miRNA-regulated genes have been detected in: >65% of chronic lymphocytic leukemia cases, 50% of mantle-cell lymphomas, 16% to 40% of multiple myelomas, 60% of prostate cancers. Other miRNA abnormalities have been reported in a wide variety of Human neoplasms, including other hematologic malignancies such as promyelocytic leukemia Benign tumors such as leiomyoma and pituitary adenoma Multiple types of carcinomas, including pancreatic, esophageal, thyroid, lung, and breast Neuroblastomas and glioblastomas - 11 - Sample & Assay Technologies
  12. 12. miRNA expression profiling Key considerations Scientific question Well-defined and testable Experimental sample set Statistically meaningful number of replicates (biological replicates) A minimum of 3 replicates recommended Replicates enhance the statistical power Inclusion of proper normalization controls & spike in controls in the analysis Experimental testing platform Simple, straightforward workflow High sensitivity & specificity A variety of PCR arrays to meet your experimental needs Easy and simple data analysis tools Customizable solutions & single assays Availability of companion research tools - 12 - Sample & Assay Technologies
  13. 13. How to Monitor miRNA Expression Levels Northern Blot Very low throughput Very time consuming and complex . Microarrays Profile More Sequences Poor Sensitivity & Dynamic Range, Complicated Protocol . Next-gen sequencing Quantifiable? Discover novel sequences, but need validation Cost for routine analysis of 12+ samples (complex procedures, $$ for instrument) . Real-Time RT-PCR Profiles Fewer Sequences (Up to 384) Simpler Protocol Better Sensitivity, Specificity & Reproducibility . - 13 - Sample & Assay Technologies
  14. 14. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview miRNA isolation miScript miRNA PCR Arrays and Assays Pre-amplification of miRNA Data Analysis miScript miRNA PCR Array Applications Cancer Development & Differentiation Genome-Wide Discovery - 14 - Sample & Assay Technologies
  15. 15. miScript miRNA PCR Array System complete system from isolation to published data miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction . miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat and others: Search miRNA Primers: http://www.qiagen.com/Products/miScriptPrimerAssays.aspx . miScript miRNA PCR Arrays: Pathways and Genomes Optimized miScript SYBR® Green Master Mix . miScript miRNA Data Analysis Excel Template & Web Portal . - 15 - Sample & Assay Technologies
  16. 16. miScript miRNA PCR Array System complete system from isolation to published data miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction . miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat and others: Search miRNA Primers: http://www.qiagen.com/Products/miScriptPrimerAssays.aspx . miScript miRNA PCR Arrays: Pathways and Genomes Optimized miScript SYBR® Green Master Mix . miScript miRNA Data Analysis Excel Template & Web Portal . - 16 - Sample & Assay Technologies
  17. 17. miRNeasy Kits: Mini and Micro Flexible protocols: total RNA or enrichment of miRNA High quality, pure RNA . Suitable for sensitive downstream applications Rapid procedure . Streamlined protocol for lowthroughput or 96-well formats Automated on QIAcube Effective purification of total RNA From a broad range of cells & tissues Efficient enrichment of microRNAs . miRNA enriched fraction & total RNA separately Co-purification of miRNA & total RNA - 17 - Sample & Assay Technologies
  18. 18. miRNeasy Kits: Mini and Micro Flexible protocols: total RNA or enrichment of miRNA miScript miRNA PCR Assays and Arrays profile mature miRNA from TOTAL RNA . No need to separate miRNA Use co-purified Total RNA Best practice for mRNA and miRNA detection Able to use mRNA now and archive miRNA as cDNA (increased stability and biobanking) - 18 - Sample & Assay Technologies
  19. 19. miRNeasy FFPE Kit Enables purification of high quality total RNA from archival samples 500 million FFPE tissues are archived! Tissue banks, pathology labs, biomedical research labs Current Isolation Methods: Compromised quality and yield Heavily fragmented Cross-linking by formaldehyde interferes with RT Current procedures may not purify all usable RNA, may increase fragmentation, are often ineffective in breaking up cross-links miRNeasy FFPE Kit: High quality, pure total RNA . Novel method prevents cross-linked RNA from blocking downstream applications Optimized lysis buffer with proteinase K RNeasy MinElute for small elution volume - 19 - Sample & Assay Technologies
  20. 20. miRNeasy Serum/Plasma Kit Purification of high quality total RNA from serum or plasma samples - 20 - Sample & Assay Technologies
  21. 21. miScript miRNA PCR Array System complete system from isolation to published data miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction . miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat and others: Search miRNA Primers: http://www.qiagen.com/Products/miScriptPrimerAssays.aspx . miScript miRNA PCR Arrays: Pathways and Genomes Optimized miScript SYBR® Green Master Mix . miScript miRNA Data Analysis Excel Template & Web Portal . - 21 - Sample & Assay Technologies
  22. 22. miRNA RT-PCR Technical Difficulties Short sequence (21-23nt) . Background from contaminating small RNAs (tRNA, rRNA, snRNA) . Highly homologous Many miRNAs have a single nucleotide difference . - 22 - Sample & Assay Technologies
  23. 23. miScript PCR System Reverse Transcription using HiSpec Buffer - 23 - Sample & Assay Technologies
  24. 24. Performance: Universal RT Advantages Ease of Universal Reverse Transcription Reaction Simpler setup, without primer interaction issues Less sample necessary for analyses Equal RT reaction for each miRNA, to ensure reproducible expression analysis . Comprehensive miRNA coverage cDNA can be saved for new analyses when additional miRNA sequences are discovered cDNA can be pre-amplified allowing analysis from few cells or amplification of limiting samples for miRNome analysis . Same specificity as stem loop primers with additional flexibility - 24 - Sample & Assay Technologies
  25. 25. miScript miRNA PCR Array System complete system from isolation to published data miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction . miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat and others: Search miRNA Primers: http://www.qiagen.com/Products/miScriptPrimerAssays.aspx . miScript miRNA PCR Arrays: Pathways and Genomes Optimized miScript SYBR® Green Master Mix . miScript miRNA Data Analysis Excel Template & Web Portal . - 25 - Sample & Assay Technologies
  26. 26. miScript miRNA PCR Arrays Pathway-Focused: 84 miRNAs + 12 Controls 84 miRNAs Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6-2 miRTC PPC Spike in Control miScript PCR Controls for Normalization RT Control PCR Control Cel-miR-39 Alternative data normalization using exogenously spiked Syn-cel-miR-39 miScript miRNA Mimic miScript PCR Controls Data normalization using the ∆∆CT method of relative quantification miRNA reverse-transcription control (miRTC) Assessment of reverse transcription performance Positive PCR control (PPC) Assessment of PCR performance - 26 - Sample & Assay Technologies
  27. 27. miScript miRNA PCR Arrays Available in 96-well, 384-well, and Rotor-Disc 100 Formats 96-well 384-well 384-well (4 x 96) Rotor-Disc 100 - 27 - Sample & Assay Technologies
  28. 28. miScript PCR Controls Stable expression and excellent amplification efficiencies Tissue Expression 35 Mean CT 30 SNORD61 SNORD68 25 SNORD72 20 SNORD95 15 SNORD96A RNU6-2 10 5 Brain Kidney Liver Lung Skeletal Muscle Testis Thymus Amplification Efficiencies Primer Hsa Mmu Rno Cfa Mml SNORD61 103 99 95 99 101 SNORD68 101 100 93 97 99 SNORD72 94 100 93 91 97 SNORD95 102 103 98 100 106 SNORD96A 102 95 95 92 104 RNU6-2 98 98 95 99 103 Highly conserved across multiple species Human, Mouse, Rat, Dog, Rhesus macaque Relatively stable expression in many tissues Amplification efficiencies of these assays are 100% Consistent performance in both HiSpec and HiFlex Buffers Ideal normalizers for ∆∆CT method of relative quantification - 28 - Sample & Assay Technologies
  29. 29. miScript miRNA PCR Arrays Redefining miRNA expression profiling Benefit of miScript miRNA PCR Arrays and Assays 100% validated assays Each assay is bench validated Each array is quality controlled Leading miRNome coverage miRNome coverage is continually updated Validated designs on miRBase V16/V18 Assay nomenclature compatible with miRBase V19 New content added monthly for pathway focused content Fully customizable - 29 - Sample & Assay Technologies
  30. 30. miScript miRNA PCR Arrays Reliable and routine miRNA expression profiling Pathway-Focused Arrays Complete miRNome Arrays Human, Mouse, Rat: Human Mouse Rat Dog Rhesus macaque Species miFinder (Dog and Rhesus macaque) Cancer PathwayFinder Brain Cancer Breast Cancer Ovarian Cancer Cell Differentiation & Development Immunopathology Inflammatory Response & Autoimmunity Neurological Development & Disease T-Cell & B-Cell Activation Prostate Cancer Serum & Plasma Assays (miRBase V16) Human 1066 Mouse 940 Rat 653 Dog 277 Rhesus macaque 469 (V18) - 30 - Sample & Assay Technologies
  31. 31. miScript miRNA PCR Arrays Redefining miRNA expression profiling New! High Content Pathway-Focused Arrays Pathway-Focused Arrays miFinder 384HC Human, Mouse, Rat: Profiles the expression of the 372 most abundantly expressed and best characterized miRNAs in miRBase miFinder (Dog and Rhesus macaque) Cancer PathwayFinder Brain Cancer Breast Cancer Ovarian Cancer Cell Differentiation & Development Immunopathology Inflammatory Response & Autoimmunity Neurological Development & Disease T-Cell & B-Cell Activation – New! Prostate Cancer – New! Serum & Plasma Serum & Plasma 384HC Profiles the expression of 372 miRNAs detectable in serum and plasma using the miScript PCR System Cancer Finder 384HC Profiles 372 miRNAs associated with various cancers and cancer stages - 31 - Sample & Assay Technologies
  32. 32. miScript miRNA PCR Array System complete system from isolation to published data miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction . miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat and others: Search miRNA Primers: http://www.qiagen.com/Products/miScriptPrimerAssays.aspx . miScript miRNA PCR Arrays: Pathways and Genomes Optimized miScript SYBR® Green Master Mix . miScript miRNA Data Analysis Excel Template & Web Portal . - 32 - Sample & Assay Technologies
  33. 33. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT) 1 hours . Load Plates (Preferably with 8-Channel Pipettors) 2 minutes . Run 40 cycle qPCR Program 2 hours . Upload and Analyze Data 15 minutes . - 33 - Sample & Assay Technologies
  34. 34. miScript miRNA PCR Arrays Compatible with a wide range of instruments 96-Well: 7000, 7300, 7500, 7700, 7900HT, ViiA 7 FAST 96-Well: 7500, 7900HT, Step One Plus, ViiA 7 FAST 384-Well: 7900HT, ViiA 7 iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384 Opticon, Opticon 2, Chromo 4 Mastercycler ep realplex 2/2S/4/4S LightCycler 480 Mx3000p, Mx3005p, Mx4000p TP-800 RotorGene Q - 34 - Sample & Assay Technologies
  35. 35. Performance: Reproducibility The miscript miRNA PCR Assays are highly reproducible, ensuring run-to-run, plate-to-plate and sample-to-sample reliability. - 35 - Sample & Assay Technologies
  36. 36. Replicates: Technical & Biological Technical Reproducibility of the PCR Arrays is very high Results demonstrate that what you are seeing is a result of biology, not technique. RTC & PPC show technical reproducibility on each plate, and comparable across plates. Biological Needed to verify the results are a result of biology Need multiple samples At least 3 replicates per sample for statistical analysis p values 95% Confidence Intervals - 36 - Sample & Assay Technologies
  37. 37. Pre-amplification for miRNA detection in limiting samples Limiting Samples Body fluids FFPE samples LCM samples Flow-sorted cells Circulating tumor cells Fine needle biopsies - 37 - Sample & Assay Technologies
  38. 38. miScript PreAMP PCR Kit – decrease input up to 1000X Straightforward, reproducible and robust amplification Mean CT: Operator 2 30 25 20 y = 0.9973x + 0.2058 2 R = 0.9913 15 15 20 25 30 Mean CT: Operator 1 Universal reference RNA Two operators Experienced operator First time operator miScript real-time PCR miFinder miScript miRNA PCR Array - 38 - Sample & Assay Technologies
  39. 39. miScript PreAMP: miRNA expression profiling from limiting FFPE samples Excellent results with a fraction of the input 15 13 11 ∆CT: PreAMP 9 7 5 3 1 -1 y = 0.9934x - 0.1457 -3 2 R = 0.9606 -5 -5 -3 -1 1 3 5 7 9 11 13 15 ∆CT: No PreAMP Workflow No PreAMP: 250 ng total RNA, HiSpec Buffer Human miRNome miScript miRNA PCR Array (Plate 1) PreAMP: 10 ng total RNA, HiSpec Buffer one-tenth of cDNA, miScript PreAMP preamplified cDNA used for Human miRNome miScript miRNA PCR Array (Plate 1) Excellent correlation, PreAMP vs. No PreAMP Preamplified cDNA provides enough material for more than 2 full human miScript miRNome profiles. Input was only 1 ng of cDNA! - 39 - Sample & Assay Technologies
  40. 40. miRNA expression profiling using limited serum samples Using the Serum & Plasma 384HC 2-∆CT: Colorectal Cancer vs. Normal 32 : Colorectal Cancer Serum 1.E+03 28 1.E+02 1.E+01 24 1.E+00 -∆CT 20 y = 0.9728x + 0.7671 2 CT Mean: 3 RNA Isolations from Serum Reproducibility 2 R = 0.9757 1.E-01 28 32 CT: Individual RNA Isolation from Serum 2 -∆CT 1.E+03 24 1.E+02 20 1.E+01 16 1.E+00 1.E-01 16 : Normal Serum Workflow 5 µl serum 14 µl total RNA 5 µl total RNA, HiSpec Buffer one-tenth of cDNA, miScript PreAMP preamplified cDNA (0.07 µl SE) used for Human Serum & Plasma 384HC miScript miRNA PCR Array Conclusion: Starting with only 5 µl of serum, significant differences were detected when colorectal cancer serum was compared to normal serum - 40 - Sample & Assay Technologies
  41. 41. miScript miRNA PCR Array System complete system from isolation to published data miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction . miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat and others: Search miRNA Primers: http://www.qiagen.com/Products/miScriptPrimerAssays.aspx . miScript miRNA PCR Arrays: Pathways and Genomes Optimized miScript SYBR® Green Master Mix . miScript miRNA Data Analysis Excel Template & Web Portal . - 41 - Sample & Assay Technologies
  42. 42. Data analysis miScript miRNA PCR Array Data Analysis Tools - 42 - Sample & Assay Technologies
  43. 43. Data analysis using free software miScript miRNA PCR Array Data Analysis Tools Web-Based Software . No installation needed Tailored for each array Raw CT Values to Fold-Change Results . Using ∆∆CT Method Other methods available Multiple Analysis Formats . Scatter Plot Volcano Plot Multi-Group Plot Clustergram . Downloadable Excel Templates also available - 43 - Sample & Assay Technologies
  44. 44. Application Data: Cancer Biomarkers Human Cancer miscript miRNA PCR Array: Many Cancer-Specific miRNA Are Up-regulated in a Colon Tumor. - 44 - Sample & Assay Technologies
  45. 45. Application Data: Cell Differentiation & Development 26 Brain-Specific miRNA 20 Muscle-Specific miRNA Human Cell Differentiation & Development miscript miRNA PCR Array: Identifies 26 Brain- and 20 Muscle-Specific miRNA Potentially Regulating Tissue-Specific Gene Expression. - 45 - Sample & Assay Technologies
  46. 46. Application Data: Genome-Wide Screening 40 Ct Adeno-p53 35 30 203 551a 25 34a 940 20 15 15 20 25 30 35 40 Ct Control miscript Human Genome miRNA PCR Array: Identifies Known and Novel miRNA Targets of the p53 Signaling Pathway - 46 - Sample & Assay Technologies
  47. 47. Application Data: FFPE Expression rank order of 88 cancer related miRNAs in RNA extracted from one 20µm section of a 2-year old normal human colon FFPE block using the miscript FFPE RNA Extraction Kit. - 47 - Sample & Assay Technologies
  48. 48. miRNA expression profiling using FFPE samples 40 One 5 µM FFPE section used per FFPE isolation RT: 125 ng total RNA, HiSpec Buffer qPCR: Human miFinder miScript miRNA PCR Array – 0.5 ng cDNA per well, Human miFinder PCR Array ∆CT (miRTC – PPC) is used to assess reverse transcription efficiency 32 28 CT Value RT and qPCR Normal Lung 36 Each isolation is from a different section On average, each isolation provided enough total RNA for: – Two full human miRNome profiles – Ten pathway-focused PCR arrays 24 20 16 12 FFPE Isolation 1 FFPE Isolation 2 8 FFPE Isolation 3 20 ∆CT < 7 indicates no inhibition of reverse-transcription 18 16 1 40 32 10 28 CT Value 12 7 13 19 25 31 37 43 49 55 61 67 73 Lung Tumor 36 14 8 6 24 20 63 T: 61 T: 52 T: 43 T: T: 41 32 T: T: T: T: N :2 N :1 23 8 21 0 12 12 -2 2 -3 16 -1 4 N :1 ∆CT (miRTC - PPC) 4 FFPE Isolation 1 FFPE Isolation 2 FFPE Isolation 3 4 1 Sample 7 13 19 25 31 37 43 49 55 61 67 73 Human miFinder miRNA Assay - 48 - Sample & Assay Technologies
  49. 49. miRNA expression profiling using FFPE samples (cont.) 2-∆CT: Tumor vs. Normal Fold-Regulation: Tumor vs. Normal 14 Log2 Fold-Regulation (Tumor vs. Normal) 2 -∆CT : Tumor Lung FFPE Tissue 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 -∆CT 1.E-01 1.E-02 1.E-03 1.E-04 2 : Normal Lung FFPE Tissue 10 6 2 -2 -6 -10 -14 Significant differences exist between the mature miRNA expression levels of the two tissue types ± 2-fold [red lines] used as a cutoff for significance - 49 - Sample & Assay Technologies
  50. 50. miRNA expression profiling using serum samples 2-∆CT: Breast Cancer vs. Normal Normal Serum 1.E+01 : Breast Cancer Serum 38 30 26 -∆CT 22 Serum Isolation 1 18 Serum Isolation 2 Serum Isolation 3 1.E-01 1.E-02 miR-34a 1.E-03 1.E-04 1.E-05 1.E+01 200 µl serum 50 µl total RNA 5 µl total RNA, HiSpec Buffer miFinder miScript miRNA PCR Array 1.E+00 Workflow -∆CT 1.E-01 2 1.E-02 miRNA 1.E-03 6 11 16 21 26 31 36 41 46 51 56 61 1.E-04 1.E-05 14 1 1.E+00 2 CT Value 34 : Normal Serum one-half of cDNA used for 96-well High reproducibility can be achieved using the miRNeasy Supplementary Protocol Each isolation was from a different normal serum donor Significant differences exist between the mature miRNA expression levels of the two tissue types ± 2-fold [red lines] used as a cutoff for significance - 50 - Sample & Assay Technologies
  51. 51. miScript miRNA PCR Arrays QIAGEN PCR Array Service Core Send your samples and receive results! Total RNA Isolation: miRNeasy Kits Reverse Transcription: miScript II RT Kit qPCR: miScript miRNA PCR Arrays Data analysis included! - 51 - Sample & Assay Technologies
  52. 52. SUMMARY miRNA Function . • Regulates gene expression post-transcriptionally miRNA Performance . • RT-PCR vs. Microarrays • Universal vs. Sequence-Specific RT • Specificity, Sensitivity & Reproducibility miRNA Applications . • Screen cancer- or development-focused miRNA panels • Profile miRNAs by genome and follow-up with custom miRNA PCR array panels. - 52 - Sample & Assay Technologies
  53. 53. SciGlobe: Search a for your papers using a bigger database than Pubmed and more relevant than Google Scholar SciGlobe Advantage •Free •Weekly emails on new papers •Download and store papers •Export to citation databases •Larger database than pubmed •More relevant searches than Google scholar Try it Now: http://www.sabiosciences.com/sciglobe.php - 53 - Sample & Assay Technologies
  54. 54. SciGlobe: Search a for your papers using a bigger database than Pubmed and more relevant than Google Scholar SciGlobe Advantage •Free •Weekly emails on new papers •Download and store papers •Export to citation databases •Larger database than pubmed •More relevant searches than Google scholar Try it Now: http://www.sabiosciences.com/sciglobe.php - 54 - Sample & Assay Technologies
  55. 55. Manipulating miRNA function - 55 - Sample & Assay Technologies

×